Fluorescent PCR (polymerase chain reaction) and digital PCR detection method for gene-edited high-GABA (gamma-aminobutyric acid) tomato

Abstract

The invention discloses a fluorescent PCR (polymerase chain reaction) and digital PCR detection method for gene-edited tomatoes with high GABA (gamma-aminobutyric acid) content, and relates to a detection method for gene-edited tomatoes with high GABA content. The invention solves the problem that the existing gene editing crop has no detection method. According to the fluorescent PCR and digital PCR detection method for the gene-edited high-GABA tomato, the primer and the probe are used for carrying out real-time fluorescent PCR amplification reaction for detection. The method provided by the invention can be used for directly detecting the genome extract of the sample to be detected, the detection process is simple and feasible, and the detection result is accurate. By utilizing the real-time fluorescent PCR and digital PCR detection method provided by the invention, accurate detection of a CRISPR / Cas9 edited high-GABA tomato plant sample can be realized, and the sensitivity can reach 0.1%. Besides, the method provided by the invention is simple and convenient in steps and easy to operate, so that the method has great flexibility in practical application and is an effective method for detecting gene editing components.

Description

Technical Field

[0001] The present invention relates to a method for detecting gene-edited high-GABA tomatoes. Background Art

[0002] As an important emerging frontier technology, gene editing technology has been widely used in the fields of basic theoretical research in life sciences, genetic improvement of economic species, and human health, setting off a subversive revolution. Gene editing technology uses sequence-specific nucleases (SSNs) to generate double-strand breaks (DSBs) in the target gene, which are repaired through the error-prone non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway. Repairing DSBs will randomly introduce base insertions, deletions, or substitutions, which usually leads to mutations in specific parts of the genome such as gene knockout, gene knock-in, or gene replacement. Gene editing technology is specifically divided into three typical tools: ZFN, TALEN, and CRISPR. Specific research and application status: (1) CRISPR: In addition to the model plants Arabidopsis and tobacco, the crops currently used for CRISPR include major crops such as rice and wheat. The main research direction for the above two crops is to develop new disease-resistant or stress-tolerant varieties, such as powdery mildew-resistant wheat and bacterial blight-resistant rice. Other crops include corn, sorghum, tomato, liverwort, citrus, soybean, etc. Currently, gene-edited varieties that increase the content of amylopectin in waxy corn have been launched on the market. In addition to general crops, CRISPR has also been applied to fungi, such as mushrooms that resist browning. Currently, many manufacturers are actively developing related crops, and related products have been approved and launched on the market. For example, high-GABA tomato varieties cultivated using CRISPR / Cas9 technology have been approved for planting and sale in Japan. To date, more than 13,000 papers and 5,343 patents have been published using this technology to study crop breeding, involving dozens of crop species. (2) TALEN: Currently, crops that TALEN is applied to include rice, tomatoes, wheat, soybeans, and potatoes. In the rice sector, rice resistant to bacterial blight has been developed, and in the tomato sector, research on growth hormone regulation is being conducted. Potato varieties that reduce the browning rate and reduce the production of acrylamide have also been launched on the market. To date, more than 800 papers and 262 patents have been published using this technology to study crop breeding, involving a wide range of crop species. (3) ZFN: Currently, the ZFN-1 model is mainly used in tobacco plants. In addition, plants with herbicide-resistant ALS (acetolactate synthase) gene mutations or screening target genes GUS (bet aglucuronidase gene) or GFP (green fluores-cent protein) are also used; ZFN-2 is applied to model plants Arabidopsis and plants with mutant genes GUS. To date, there are 410 papers related to crop breeding using this technology. There are 124 plant gene editing breeding companies at home and abroad, with 1,782 patents.

[0003] The crops that have been commercialized so far are:

[0004] (1) High GABA tomato varieties bred using CRISPR / Cas9 technology have been approved for cultivation and sale in Japan;

[0005] (2) Since the beginning of 2021, Toolgen, a South Korean company, has been conducting field trials in Central Asia on high-oleic soybeans modified using CRISPR-Cas9. It is expected that small-scale field trials will be gradually expanded and commercialized in the next three years.

[0006] (3) A gene-edited red snapper, "Madai", went on sale in Japan in October 2021. The myostatin gene of the fish was edited using CRISP R gene editing technology. The edible part of the red snapper lacking the myostatin gene was about 1.2-1.6 times, and the feed utilization efficiency was increased by about 14%.

[0007] (4) Other crops that have been granted exemptions include: a. Yinong Yang of the University of Pennsylvania in the United States used CRISPR / Cas9 technology to cultivate gene-edited Agaricus bisporus. By directly knocking out a gene that expresses polyphenol oxidase (PPO) in this edible fungus, its polyphenol oxidase activity can be reduced by 30%, making it less susceptible to enzymatic browning; b. Calyxt, a subsidiary of the French biotechnology company Cellectis, has used TALEN technology to cultivate the following gene-edited crop lines: high-oleic soybeans, high-oleic / low-linolenic soybeans, cold-resistant storage potatoes, bruise-resistant potatoes, and quality-improved alfalfa.

[0008] In the future, more and more gene-edited crops will be commercialized and enter the Chinese market through the border. However, genome editing technology is completely different from traditional genetically modified biotechnology, so the existing genetically modified product detection methods are no longer applicable to gene-edited products. At present, there is no detection method for crops commercialized with gene-editing technology, and the inspection standards are even missing, so the research on detection methods is a major issue that needs to be solved urgently.

[0009] To this end, we proposed real-time fluorescence PCR and digital PCR detection methods for a CRISPR / Cas9 gene-edited high-GABA tomato. Summary of the invention

[0010] In order to solve the problem that there is no detection method for existing gene-edited crops, the present invention provides a fluorescent PCR and digital PCR detection method for gene-edited high GABA tomatoes.

[0011] The fluorescent PCR detection method of gene-edited high GABA tomatoes of the present invention comprises the following steps: extracting tomato sample genes, setting fluorescent signal collection conditions of PCR reaction tubes, the fluorescent signal collection conditions being consistent with the reporter group labeled by the probe, amplifying by real-time fluorescent PCR, and during the PCR amplification process, detecting the Ct value of the test sample, and making a judgment based on the Ct value of the test sample, thereby completing the detection;

[0012] Wherein, the primer sequence is:

[0013] Upstream primer GABA-F: GCACATGTACAATGCTTTACC

[0014] Downstream primer GABA-R: GTGTTTAATTGCTTAGTGGCAGC

[0015] The probe sequence is GABA-P: FAM-GAACGAGACTGCCTGGTTGATGC-TAMRA.

[0016] The real-time fluorescence PCR test results are determined as follows:

[0017] (1) During the amplification process using real-time fluorescent PCR, if the Ct value of the test sample is greater than or equal to 40, it can be determined that the sample does not contain the gene being tested;

[0018] (2) If the Ct value of the test sample is less than or equal to 36, the sample is judged to contain the gene being tested;

[0019] (3) If the Ct value of the test sample is between 36 and 40, the template concentration should be adjusted and the real-time fluorescence PCR should be repeated. If the Ct value of the sample gene detection after re-amplification is still less than 40, it can be determined that the sample contains the gene to be tested. If the Ct value of the sample gene detection after re-amplification is greater than or equal to 40, it can be determined that the sample does not contain the gene to be tested.

[0020] The digital PCR detection method of gene-edited high GABA tomatoes of the present invention comprises the following steps: extracting tomato sample genes, setting the fluorescence signal collection conditions of the PCR reaction tube, the fluorescence signal collection conditions being consistent with the reporter group labeled by the probe, amplifying by real-time digital PCR, and determining the result of the amplification by digital PCR, thereby completing the digital PCR detection;

[0021] Wherein, the primer sequence is:

[0022] Upstream primer GABA-F: GCACATGTACAATGCTTTACC

[0023] Downstream primer GABA-R: GTGTTTAATTGCTTAGTGGCAGC

[0024] The probe sequence is GABA-P: FAM-GAACGAGACTGCCTGGTTGATGC-TAMRA.

[0025] The method for determining the positive well in the determination of the digital PCR test results is: when an amplification signal that is obviously different from that of a negative reaction well appears, this reaction well is recorded as a positive amplification well; the determination method is:

[0026] (1) In two parallel groups of the same sample, at least one group has a positive amplification well, which means that the detected genome contains the detected gene component and is determined to be a positive sample;

[0027] (2) If a positive result is produced in the reaction well of the positive quality control product and a negative result is produced in the reaction well of the negative quality control product, the experiment is considered to be valid; otherwise, the experiment is invalid and needs to be retested;

[0028] (3) Both parallel groups of the same sample have negative reaction wells, indicating that the gene component tested was not detected and the sample was determined to be a negative sample.

[0029] The method provided by the present invention can directly detect the genome extract of the sample to be detected, the detection process is simple and easy, and the detection result is accurate.

[0030] The real-time fluorescence PCR and digital PCR detection methods provided by the present invention can achieve accurate detection of CRISPR / Cas9-edited high GABA tomato plant samples with a sensitivity of up to 0.1%. In addition, the method of the present invention is simple and easy to operate, so it has great flexibility in practical applications and is an effective method for detecting gene editing components. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the Ct value diagram of the real-time fluorescence PCR results of the high GABA gene fragment;

[0032] Figure 2 This is the hotspot map of digital PCR amplification of high GABA gene fragments;

[0033] Figure 3 This is the Ct value graph of the real-time fluorescence PCR results of different varieties of tomatoes and gene-edited tomatoes;

[0034] Figure 4 Amplification hotspot map of digital PCR results for different varieties of tomatoes and gene-edited tomatoes. DETAILED DESCRIPTION

[0035] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0037] Specific implementation method 1: The fluorescent PCR detection method of gene-edited high GABA tomatoes in this implementation method: extract tomato sample genes, set the fluorescent signal collection conditions of the PCR reaction tube, the fluorescent signal collection conditions are consistent with the reporter group labeled by the probe, and amplify by real-time fluorescent PCR. During the PCR amplification process, the Ct value of the test sample is detected, and the judgment is made according to the Ct value of the test sample, that is, the detection is completed;

[0038] Wherein, the primer sequence is:

[0039] Upstream primer GABA-F: GCACATGTACAATGCTTTACC

[0040] Downstream primer GABA-R: GTGTTTAATTGCTTAGTGGCAGC

[0041] The probe sequence is GABA-P: FAM-GAACGAGACTGCCTGGTTGATGC-TAMRA.

[0042] Specific embodiment 2: This embodiment differs from specific embodiment 1 in that the amplification procedure of real-time fluorescence PCR is: pre-denaturation at 95°C for 10S; denaturation at 95°C for 15S, annealing and extension at 60°C for 1min, for a total of 40 cycles, and collecting fluorescence signals at 60°C. Other steps and parameters are the same as those of specific embodiment 1.

[0043] Specific embodiment 3: This embodiment is different from the specific embodiment 1 in that the reaction system of real-time fluorescence PCR amplification includes: 12.5 μL of real-time fluorescence PCR reaction mixture, 1 μL of upstream primer GABA-F, 1 μL of downstream primer GAB A-R, 0.5 μL of probe GABA-P, 2 μL of sample DNA, and ultrapure water to 25 μL. Other steps and parameters are the same as those of the specific embodiment 1.

[0044] Specific embodiment 4: This embodiment is different from the specific embodiment 1 in that the determination method of the real-time fluorescence PCR detection result is:

[0045] (1) During the amplification process using real-time fluorescent PCR, if the Ct value of the test sample is greater than or equal to 40, it can be determined that the sample does not contain the gene being tested;

[0046] (2) If the Ct value of the test sample is less than or equal to 36, the sample is judged to contain the gene being tested;

[0047] (3) If the Ct value of the test sample is between 36 and 40, the template concentration should be adjusted and the real-time fluorescence PCR should be repeated. If the Ct value of the sample gene detection after re-amplification is still less than 40, it can be determined that the sample contains the gene to be tested. If the Ct value of the sample gene detection after re-amplification is greater than or equal to 40, it can be determined that the sample does not contain the gene to be tested.

[0048] Specific implementation method five: The digital PCR detection method of gene-edited high GABA tomatoes in this implementation method: extract tomato sample genes, set the fluorescence signal collection conditions of the PCR reaction tube, the fluorescence signal collection conditions are consistent with the reporter group labeled by the probe, amplify by real-time digital PCR, and determine the result of the amplification by digital PCR, that is, complete the digital PCR detection;

[0049] Wherein, the primer sequence is:

[0050] Upstream primer GABA-F: GCACATGTACAATGCTTTACC

[0051] Downstream primer GABA-R: GTGTTTAATTGCTTAGTGGCAGC

[0052] The probe sequence is GABA-P: FAM-GAACGAGACTGCCTGGTTGATGC-TAMRA.

[0053] Specific embodiment 6: This embodiment differs from specific embodiment 5 in that the amplification procedure of digital PCR amplification is: hot start 95°C pre-denaturation for 5 minutes; thermal cycle amplification 94°C denaturation for 30 seconds, 60°C annealing for 60 seconds, a total of 49 cycles, and thermal inactivation at 98°C for 10 minutes after the amplification. Other steps and parameters are the same as those of specific embodiment 5.

[0054] Specific embodiment 7: This embodiment is different from specific embodiment 5 in that the reaction system for digital PCR amplification per 20 μL includes: sample DNA 20-30 ng, upstream primer GABA-F and downstream primer GABA-R 8-15 nmol each, probe GABA-P sequence 2-10 nmol, digital PCR amplification enzyme Mix premix 10-15 uL, and the balance is water. Other steps and parameters are the same as those in specific embodiment 5.

[0055] Specific embodiment eight: This embodiment differs from specific embodiment five in that: the method for determining the positive well in the determination of the digital PCR detection result is: if an amplification signal that is obviously different from a negative reaction well appears, this reaction well is recorded as a positive amplification well; the determination method is:

[0056] (1) In two parallel groups of the same sample, at least one group has a positive amplification well, which means that the detected genome contains the detected gene component and is determined to be a positive sample;

[0057] (2) If a positive result is produced in the reaction well of the positive quality control product and a negative result is produced in the reaction well of the negative quality control product, the experiment is considered to be valid; otherwise, the experiment is invalid and needs to be retested;

[0058] (3) Both parallel groups of the same sample have negative reaction wells, indicating that the gene component under test is not detected, and the sample is determined to be negative. Other steps and parameters are the same as those in the fifth embodiment.

[0059] Example 1

[0060] 1. Materials and Methods

[0061] 1.1 Experimental materials: The CRISPR / Cas9-edited high-GABA tomato samples used in this experiment were provided by Professor Zhu Hongliang of the College of Food Science and Nutritional Engineering, China Agricultural University. The real-time fluorescence PCR was performed by Jena, model qTOWER2.2, and the digital PCR was performed by Bio-Rad, model QX200.

[0062] 1.2 Primer design: The primers and probes used in the reaction are shown in Table 1:

[0063] Table 1 Primers and probes used in the reaction

[0064] Primer and probe name Primer, probe sequence (5'-3') Upstream primer GABA-F SEQ ID No.1 Downstream primer GABA-R SEQ ID No.2 Probe GABA-P SEQ ID No.3

[0065] 1.3 Methods for extracting genomes of gene-edited crops

[0066] (1) Grinding and air-drying crop tissue samples;

[0067] (2) Weigh 0.1 g of sample using an analytical balance, add 1.0 mL of PBS buffer, mix thoroughly, centrifuge at 20°C, 12,000 g for 10 min, and discard the supernatant;

[0068] (3) Add 1.0 mL of extraction buffer, mix thoroughly, centrifuge at 12000 g for 15 min at 20°C, and discard the supernatant;

[0069] (4) Add 1.0 mL of lysis buffer I and 0.4 mL of lysis buffer II, mix thoroughly, and incubate at 65°C for 40 min; (5) Centrifuge at 12,000 g for 15 min at 20°C, and transfer the supernatant to another new centrifuge tube;

[0070] (6) Add an equal volume of balanced phenol-chloroform solution, mix gently, centrifuge at 12,000 g for 10 min at 20°C, and transfer the supernatant to another new centrifuge tube;

[0071] (7) Add an equal volume of chloroform, mix gently, centrifuge at 12,000 g for 10 min at 20°C, and transfer the supernatant to another new centrifuge tube;

[0072] (8) Add 0.6 volumes of isopropanol and 0.1 volumes of potassium acetate solution, gently invert to mix, let stand at -20°C for more than 2 h, centrifuge at 12000 g for 10 min, and discard the supernatant;

[0073] (9) Add 0.5 mL to 1.0 mL of 70% ethanol solution and mix by inversion. Centrifuge at 12000 g for 10 min and discard the supernatant.

[0074] (10) Dry the DNA pellet. Add 100 μL of water or TE buffer to dissolve the DNA;

[0075] (11) The concentration and purity of the obtained genome were measured by a nucleic acid protein analyzer, and the genome was diluted to 50 ng / μL for later use.

[0076] 1.4 Real-time fluorescence PCR amplification reaction

[0077] (1) Set the fluorescence signal collection conditions of the PCR reaction tube. The fluorescence signal collection conditions should be consistent with the reporter group labeled with the probe.

[0078] (2) The real-time fluorescence PCR reaction system includes: 12.5 μL of mixed solution, 1 μL of upstream primer, 1 μL of downstream primer, 0.5 μL of probe, 2 μL of DNA template, and ultrapure water to 25 μL.

[0079] (3) The amplification procedure of real-time fluorescence PCR was as follows: pre-denaturation at 95°C for 10 s; denaturation at 95°C for 15 s, annealing and extension at 60°C for 1 min, for a total of 40 cycles, and fluorescence signal collection at 60°C.

[0080] (4) During the amplification process using real-time fluorescence PCR, if the Ct value of the test sample is greater than or equal to 40, it can be determined that the sample does not contain the gene being tested. If the Ct value of the test sample is less than or equal to 36, it can be determined that the sample contains the gene being tested. If the Ct value of the test sample is between 36 and 40, the template concentration should be adjusted and the real-time fluorescence PCR should be repeated; if the Ct value of the sample gene after re-amplification is still less than 40, it can be determined that the sample contains the gene being tested; if the Ct value of the sample gene after re-amplification is greater than or equal to 40, it can be determined that the sample does not contain the gene being tested. Figure 1 This is the Ct value diagram of the real-time fluorescence PCR results of the high GABA gene fragment. Figure 1 It can be seen that the primer probe set described in this article has good specificity and stability.

[0081] 1.5 Digital PCR amplification reaction

[0082] (1) The reaction system for each 20 μL digital PCR amplification contains: 20-30 ng DNA template, 8-15 nmol of upstream and downstream primers, 2-10 nmol of probe, 10-15 uL of digital PCR amplification enzyme Mix premix, and the balance is water.

[0083] (2) The amplification program of digital PCR amplification was as follows: hot start pre-denaturation at 95°C for 5 min; thermal cycling (amplification) denaturation at 94°C for 30 s, annealing at 60°C for 60 s, for a total of 49 cycles; and thermal inactivation at 98°C for 10 min after the amplification was completed.

[0084] (3) If the amplification result shows an amplification signal that is obviously different from the negative reaction well, this reaction well is recorded as a positive amplification well; the method for determining a positive sample is as follows: in the two parallel groups of the same sample, if at least one group has a positive amplification well, it means that the test genome contains the gene component to be tested; when a positive result is produced in the positive quality control reaction well and a negative result is produced in the negative quality control reaction well, the experiment is considered to be a valid experiment; otherwise, the experiment is invalid and the reaction reagent needs to be replaced and repeated; when the reaction tube of the sample to be tested shows a negative result, it means that the gene component to be tested has not been detected; when all the reaction tubes of the sample to be tested show positive results, it means that the sample to be tested contains the gene component to be tested.

[0085] Figure 2 This is a hotspot map of digital PCR amplification of high GABA gene fragments. Figure 2 It can be seen that the primer probe set described in this article has good specificity and stability.

[0086] 1.6 Primer probe specificity and stability verification experiment

[0087] Different varieties of tomatoes (cherry tomatoes, black pearl tomatoes, small yellow tomatoes, large tomatoes, yellow pearl tomatoes, emerald tomatoes, spring peach tomatoes) and CRISPR / Cas9-edited high GABA tomatoes were added to the reaction system, and the screening elements of different templates were amplified by the real-time fluorescence PCR and digital PCR detection methods given in 1.2-1.5. Figure 3 This is the Ct value graph of the real-time fluorescence PCR results of different varieties of tomatoes and gene-edited tomatoes; Figure 4 Amplification hotspot map of digital PCR results for different varieties of tomatoes and gene-edited tomatoes. Figure 3 , 4 The results show that the primer probe described in this article has good specificity and stability.

[0088] 1.7 Amplification system sensitivity verification experiment

[0089] This experiment uses CRISPR / Cas9 edited high GABA tomatoes as templates for gradient dilution. The relative content of the diluted gene-edited crops is 5%, 1%, 0.5%, 0.4%, 0.3%, 0.2%, and 0.1%. It was verified by the real-time fluorescence PCR and digital PCR detection methods given in 1.2-1.5. The results are shown in Table 2-3. The results show that this system can produce stable amplification at a relative concentration of 0.1% of the gene-edited crops, that is, the sensitivity of this real-time fluorescence PCR and digital PCR amplification system is 0.1%.

[0090] Table 2 Results of sensitivity verification experiment of real-time fluorescence PCR amplification system

[0091]

[0092] Table 3 Results of the digital PCR amplification system sensitivity verification experiment

[0093]

[0094] 1.8 Amplification system repeatability verification experiment

[0095] This example uses repeated experiments in the laboratory to verify the repeatability of the system described herein. The real-time fluorescence PCR and digital PCR detection methods given in 1.2-1.5 were used to conduct experiments, and the experimental results were obtained by different personnel in batches. The experimental results show that the reaction system has good repeatability. The results are shown in Tables 2 and 3. Where A, B, and C represent different operators, and the gene editing content represents the mass percentage of each experimental sample.

[0096] 1.9 Blind sample verification experiment of amplification system

[0097] Double-blind experiments were performed with samples prepared in the laboratory. Eight groups of double-blind samples with different compositions were prepared in this part of the experiment, and gene editing component screening experiments were performed using the real-time fluorescence PCR and digital PCR detection methods given in 1.1-1.5. The experimental results show that the reaction system described in this article can accurately identify the gene-edited crop components in the samples. The results are shown in Table 4.

[0098] Table 4 Results of blind sample validation experiment of amplification system

[0099]

[0100] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that further modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A fluorescent PCR detection method for gene-edited high GABA tomatoes, characterized in that: Extract the tomato sample gene, set the fluorescence signal collection conditions of the PCR reaction tube, the fluorescence signal collection conditions are consistent with the reporter group labeled by the probe, and amplify by real-time fluorescence PCR. During the PCR amplification process, the Ct value of the test sample is detected, and the determination is made according to the Ct value of the test sample, and the detection is completed; Wherein, the primer sequence is: Upstream primer GABA-F: GCACATGTACAATGCTTTACC Downstream primer GABA-R: GTGTTTAATTGCTTAGTGGCAGC The probe sequence is GABA-P: FAM-GAACGAGACTGCCTGGTTGATGC-TAMRA.

2. The fluorescent PCR detection method for gene-edited high GABA tomatoes according to claim 1, characterized in that: The amplification program of real-time fluorescence PCR was as follows: pre-denaturation at 95°C for 10S; denaturation at 95°C for 15S, annealing and extension at 60°C for 1min, for a total of 40 cycles, and fluorescence signals were collected at 60°C.

3. The fluorescent PCR detection method for gene-edited high GABA tomatoes according to claim 1, characterized in that: The reaction system of the real-time fluorescence PCR amplification includes: 12.5 μL of real-time fluorescence PCR reaction mixture, 1 μL of upstream primer GABA-F, 1 μL of downstream primer GABA-R, 0.5 μL of probe GABA-P, 2 μL of sample DNA, and ultrapure water to 25 μL.

4. A fluorescent PCR detection method for gene-edited high GABA tomatoes according to claim 1, characterized in that: The results of real-time fluorescence PCR are determined as follows: (1) During the amplification process using real-time fluorescent PCR, if the Ct value of the test sample is greater than or equal to 40, it can be determined that the sample does not contain the gene being tested; (2) If the Ct value of the test sample is less than or equal to 36, the sample is judged to contain the gene being tested; (3) If the Ct value of the test sample is between 36 and 40, the template concentration should be adjusted and the real-time fluorescence PCR should be repeated; If the Ct value of the sample gene detection after re-amplification is still less than 40, it can be determined that the sample contains the detected gene; If the Ct value of the sample gene detection after re-amplification is greater than or equal to 40, it can be determined that the sample does not contain the detected gene.

5. A digital PCR detection method for gene-edited high GABA tomatoes, characterized in that: Extract the tomato sample gene, set the fluorescence signal collection conditions of the PCR reaction tube, the fluorescence signal collection conditions are consistent with the reporter group labeled by the probe, amplify by real-time digital PCR, and judge the result of the digital PCR amplification, thus completing the digital PCR detection; Wherein, the primer sequence is: Upstream primer GABA-F: GCACATGTACAATGCTTTACC Downstream primer GABA-R: GTGTTTAATTGCTTAGTGGCAGC The probe sequence is GABA-P: FAM-GAACGAGACTGCCTGGTTGATGC-TAMRA.

6. The digital PCR detection method for gene-edited high GABA tomatoes according to claim 5, characterized in that: The amplification program of digital PCR amplification was as follows: hot start pre-denaturation at 95°C for 5 min; thermal cycle amplification with denaturation at 94°C for 30 s and annealing at 60°C for 60 s, for a total of 49 cycles, and thermal inactivation at 98°C for 10 min after the amplification.

7. The digital PCR detection method for gene-edited high GABA tomatoes according to claim 5, characterized in that: The reaction system for each 20 μL digital PCR amplification includes: 20-30 ng sample DNA, 8-15 nmol of upstream primer GABA-F and downstream primer GABA-R, 2-10 nmol of probe GABA-P, 10-15 uL of digital PCR amplification enzyme Mix premix, and the balance is water.

8. The digital PCR detection method for gene-edited high GABA tomatoes according to claim 5, characterized in that: The method for determining the positive well in the determination of the digital PCR test results is: when an amplification signal that is obviously different from that of a negative reaction well appears, this reaction well is recorded as a positive amplification well; the determination method is: (1) In two parallel groups of the same sample, at least one group has a positive amplification well, which means that the detected genome contains the detected gene component and is determined to be a positive sample; (2) If a positive result is produced in the reaction well of the positive quality control product and a negative result is produced in the reaction well of the negative quality control product, the experiment is considered to be valid; otherwise, the experiment is invalid and needs to be retested; (3) Both parallel groups of the same sample have negative reaction wells, indicating that the gene component tested was not detected and the sample was determined to be a negative sample.

Images