Composition, kit and method for detecting polymorphism of human TPMT gene and NUDT15 gene

Abstract

The invention belongs to the technical field of gene detection, and particularly provides a composition, a kit and a method for detecting polymorphism of a human TPMT gene and a human NUDT15 gene, and the composition can be used for detecting the polymorphism of the TPMT gene rs1800462 (238Ggt; c) loci of rs1800460 (460Ggt; the A) site is rs1142345 (719Agt; g) site of the NUDT15 gene and rs116855232 (415Cgt; t) loci are polymorphisms. Wild type and mutant type genes can be effectively distinguished based on an amplification block mutation system PCR (ARMS-PCR) method detection technology, and the kit has the advantages of being high in sensitivity and specificity, suitable for various sample types, short in consumed time and easy and convenient to operate. By using the composition and the method provided by the invention, the genomic DNA with the concentration as low as 0.5 ng / mu L can be detected.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a composition, a kit and a method for detecting human TPMT gene and NUDT15 gene polymorphism. Background Art

[0002] Thiopurine drugs are common immunomodulators. The most widely used drugs in clinical practice are 6-thioguanine (6-TG), 6-mercaptopurine (6-MP) and azathioprine (AZA). Thiopurine drugs have good anti-proliferative and immunosuppressive effects, clear efficacy and wide clinical use. However, the "therapeutic window" of this type of drug is narrow, and there are great individual differences in drug effects, especially hepatotoxicity, bone marrow suppression and other dose-dependent adverse reactions of thiopurine drugs. Studies have shown that taking azathioprine can cause bone marrow suppression (neutrophil counts less than 1.5×10 9 / L) occurred in 3%, and severe bone marrow suppression (neutrophil count less than 0.5×10 9 The incidence of thiopurine / L is 0.9%, and the risk of death from bone marrow suppression is about 1%. Such serious adverse reactions are closely related to the complex metabolism of thiopurine drugs and are the biggest obstacle to the clinical application of thiopurine drugs.

[0003] The efficacy and adverse reactions of thiopurine are closely related to the enzymes involved in its metabolic pathway in the body, and multiple genes affect the expression of this group of enzymes. Among them, the genes that have a greater impact on drug metabolism include thiopurine methyltransferase (TPMT) and nucleotide pyrophosphatase (NUDT15). TPMT encodes thiopurine methyltransferase, which can methylate multiple products in the thiopurine metabolic pathway to produce 6-methylthiopurine, reduce the accumulation of effective metabolites 6-thioguanine nucleotides, and thus reduce the incidence of bone marrow toxicity. The enzyme encoded by the NUDT15 gene can metabolize the toxic thiopurine metabolite 6-TGN, thereby reducing toxicity. When the TPMT and / or NUDT15 genes mutate, it will cause 6-T(d)GTP accumulation to cause liver damage, bone marrow suppression and other toxic and side effects. Among them, bone marrow suppression is not only the most common adverse reaction, but also the main reason for patients to interrupt treatment.

[0004] At present, there are some products that can detect the gene polymorphisms of both. For example, Chinese invention patent CN116855600A discloses that the rs1800460, rs1800462, rs1142345 sites of the TPMT gene and the rs116855232 site of the NUDT15 gene can be detected. The number of amplification cycles is long and a melting curve program needs to be set, which increases the sample detection time; and heterozygous mutant samples are prone to the situation where the peak type is connected and the Tm value cannot be accurately judged due to insufficient Tm value differentiation or low template concentration. Chinese invention patent CN111235264A also discloses a detection method for the above sites, but requires 8 different fluorescent probes, which increases the material procurement cost of product research and development. Therefore, this field needs a product with high sensitivity, good specificity, low price and rapid detection that can more comprehensively detect gene polymorphisms related to the metabolism of thiopurine drugs. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems of long detection time, low sensitivity and high cost in the prior art of TPMT and NUDT15 gene polymorphism detection.

[0006] To this end, the present invention provides a composition for detecting human TPMT gene and NUDT15 gene polymorphisms, the composition comprising:

[0007] (1) a wild-type ARMS upstream primer of the TPMT gene 238 as shown in SEQ ID NO: 1, a common downstream primer of the TPMT gene 238 as shown in SEQ ID NO: 3, and a common probe of the TPMT gene 238 as shown in SEQ ID NO: 4;

[0008] (2) the TPMT gene 238 mutant ARMS upstream primer as shown in SEQ ID NO: 2, the TPMT gene 238 common downstream primer as shown in SEQ ID NO: 3, and the TPMT gene 238 common probe as shown in SEQ ID NO: 4;

[0009] (3) a wild-type ARMS upstream primer of the TPMT gene 460 as shown in SEQ ID NO:5, a common downstream primer of the TPMT gene 460 as shown in SEQ ID NO:7, and a common probe of the TPMT gene 460 as shown in SEQ ID NO:8;

[0010] (4) a mutant ARMS upstream primer of the TPMT gene 460 as shown in SEQ ID NO:6, a common downstream primer of the TPMT gene 460 as shown in SEQ ID NO:7, and a common probe of the TPMT gene 460 as shown in SEQ ID NO:8;

[0011] (5) a wild-type ARMS upstream primer of the TPMT gene 719 as shown in SEQ ID NO: 9, a common downstream primer of the TPMT gene 719 as shown in SEQ ID NO: 11, and a common probe of the TPMT gene 719 as shown in SEQ ID NO: 12;

[0012] (6) the TPMT gene 719 mutant ARMS upstream primer as shown in SEQ ID NO: 10, the TPMT gene 719 common downstream primer as shown in SEQ ID NO: 11, and the TPMT gene 719 common probe as shown in SEQ ID NO: 12;

[0013] (7) a wild-type ARMS upstream primer of the NUDT15 gene 415 as shown in SEQ ID NO: 13, a common downstream primer of the NUDT15 gene 415 as shown in SEQ ID NO: 15, and a common probe of the NUDT15 gene 415 as shown in SEQ ID NO: 16;

[0014] (8) The NUDT15 gene 415 mutant ARMS upstream primer as shown in SEQ ID NO:14, the NUDT15 gene 415 common downstream primer as shown in SEQ ID NO:15, and the NUDT15 gene 415 common probe as shown in SEQ ID NO:16.

[0015] Specifically, the above composition exists in a combination form, wherein (1), (4), (5), and (8) form one group; (2), (3), (6), and (7) form another group, and the fluorescent reporter groups of the probes in each group are different from each other.

[0016] Specifically, the fluorescent reporter group of the public probe 238 of the TPMT gene as shown in SEQ ID NO:4 is FAM, and the quencher group is MGB; the fluorescent reporter group of the public probe 460 of the TPMT gene as shown in SEQ ID NO:8 is VIC, and the quencher group is MGB; the fluorescent reporter group of the public probe 719 of the TPMT gene as shown in SEQ ID NO:12 is ROX, and the quencher group is MGB; the fluorescent reporter group of the public probe 415 of the NUDT15 gene as shown in SEQ ID NO:16 is SX670, and the quencher group is MGB.

[0017] The present invention also provides a kit for detecting human TPMT gene and NUDT15 gene polymorphism, comprising the above composition.

[0018] Specifically, in the above composition, (1), (4), (5), and (8) form one group; (2), (3), (6), and (7) form another group; and the two groups exist in the form of separate packages.

[0019] Specifically, the amount of the primer in the above composition is 0.2-0.3 μmol / L; the amount of the probe in the composition is 0.1-0.2 μmol / L.

[0020] Specifically, the above-mentioned kit also includes a nucleic acid amplification reaction solution; the components of the nucleic acid amplification reaction solution include tris(hydroxymethylaminomethane) hydrochloride, magnesium chloride, potassium chloride, dNTP / dUTP, DNA polymerase, and uracil-N-glycosylase (UNG enzyme).

[0021] Specifically, the above kit also includes a negative control and a positive control.

[0022] The present invention also provides a method for detecting human TPMT gene and NUDT15 gene polymorphism for non-disease diagnosis and treatment purposes, based on the above composition or the above kit, specifically comprising the following steps:

[0023] S1. Extracting nucleic acid from the sample to be tested;

[0024] S2. Using the composition or kit to perform fluorescent quantitative PCR on nucleic acid;

[0025] S3. Obtain and analyze the results.

[0026] Specifically, the reaction procedure of the above-mentioned fluorescence quantitative PCR amplification is: the first stage is 50°C UNG enzyme treatment for 2 minutes; the second stage is 95°C pre-denaturation for 30 seconds; the third stage is 95°C denaturation for 10 seconds; 56°C annealing and extension for 30 seconds, a total of 45 cycles, and the fluorescence signal is collected at 56°C.

[0027] The composition for detecting human TPMT gene and NUDT15 gene polymorphism provided by the present invention can detect the polymorphisms of TPMT gene rs1800462 (238G>C) site, rs1800460 (460G>A) site, rs1142345 (719A>G) site and NUDT15 gene rs116855232 (415C>T) site.

[0028] ARMS primers are used to distinguish between wild-type and mutant genes. They have high sensitivity and can accurately detect genomic DNA as low as 0.5 ng / μL. They can also accurately detect samples that have been stored for too long or have very low extraction concentrations. They have strong specificity and will not produce non-specific results for genomic DNA as high as 100 ng / μL. Compared with the Taqman probe typing method, the ARMS typing method not only retains the high sensitivity and high specificity of Taqman, but also saves costs. ARMS primers are quick and simple to synthesize, have low synthesis costs, and have better amplification effects.

[0029] The detection technology based on the amplification retardation mutation system PCR (ARMS-PCR) provided by the present invention has a fast detection speed, and the amplification curve of the fluorescent PCR is straight and has a high degree of discrimination, and there is no need to set a program that does not collect fluorescence in the first few cycles. It can effectively distinguish wild-type and mutant genes, is applicable to a variety of sample types, and has the advantages of short time consumption and simple operation.

[0030] The present invention will be further described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The amplification graph of the composition provided by the present invention for detecting TPMT 719 heterozygous type and NUDT15415 wild type EDTA anticoagulated whole blood sample.

[0032] Figure 2 Amplification diagram of oral swab samples of TPMT wild type and NUDT15415 heterozygous type detected by the composition provided by the present invention.

[0033] Figure 3 This is a positive control amplification diagram for detecting the composition provided by the present invention.

[0034] Figure 4 The results are the test results of the sensitivity of the composition provided by the present invention. DETAILED DESCRIPTION

[0035] The technical scheme in the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Although the representative embodiments of the present invention have been described in detail, it should be understood by those skilled in the art that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be limited by the attached claims and their equivalents.

[0036] The present invention provides a composition for detecting human TPMT gene and NUDT15 gene polymorphisms, the composition comprising:

[0037] (1) ARMS upstream primers for detecting the wild type of TPMT gene 238:

[0038] T238-FW:5'-TGTGTCCCCGGTCTGC-3' (SEQ ID NO.1);

[0039] (2) ARMS upstream primers for detecting TPMT gene 238 mutation:

[0040] T238-FM: 5'-TGTGTCCCCGGTCTGG-3' (SEQ ID NO. 2);

[0041] (3) Common downstream primers and probes for detecting the wild type and mutant type of TPMT gene 238:

[0042] T238-R:5'-TATGCTTACTCTAATATAACCCTCTAT-3' (SEQ ID NO.3);

[0043] T238-P:5'-ACCTGCATAAAATCATACAT-3' (SEQ ID NO.4);

[0044] (4) ARMS upstream primers for detecting the wild type of TPMT gene 460:

[0045] T460-FW:5'-GGATTGATGGCAAGTAATGC-3' (SEQ ID NO.5);

[0046] (5) ARMS upstream primers for detecting TPMT gene 460 mutation:

[0047] T460-FM:5'-GGATTGATGGCAACGAATGT-3' (SEQ ID NO.6);

[0048] (6) Common downstream primers and probes for detecting the wild type and mutant type of TPMT gene 460:

[0049] T460-R:5'-CTCTTTCTGGTAGGACAAATATTG-3' (SEQ ID NO.7);

[0050] T460-P:5'-CTCTATCCCAAATCATGTCA-3' (SEQ ID NO.8);

[0051] (7) ARMS upstream primers for detecting the wild type of TPMT gene 719:

[0052] T719-FW:5'-TGACTGTCTTTTTGAAAAGTGATA-3' (SEQ ID NO.9);

[0053] (8) ARMS upstream primers for detecting TPMT gene 719 mutation:

[0054] T719-FM: 5'-TGACTGTCTTTTTGAAAAGTTCTG-3' (SEQ ID NO. 10);

[0055] (9) Common downstream primers and probes for detecting the wild type and mutant type of TPMT gene 719:

[0056] T719-R:5'-CATTACATTTTCAGGCTTTAG-3' (SEQ ID NO. 11);

[0057] T719-P:5'-TGAGACATAGATAAAATAAAATCACACTG-3' (SEQ ID NO. 12);

[0058] (10) ARMS upstream primers for detecting the wild type of NUDT15 gene 415:

[0059] N415-FW:5'-AGCTCTTCTGGGGACTGC-3' (SEQ ID NO.13);

[0060] (11) ARMS upstream primers for detecting NUDT15 gene 415 mutant:

[0061] N415-FM:5'-CAGCTTTTTCTGGGGAATGT-3' (SEQ ID NO.14);

[0062] (12) Common downstream primers and probes for detecting the wild type and mutant type of NUDT15 gene 415:

[0063] N415-R:5'-ATTTCCTTTGTATCCCACCA-3' (SEQ ID NO.15);

[0064] N415-P: 5'-AAGAACAAGGCTATGATCCA-3' (SEQ ID NO. 16).

[0065] The above primers are designed for three SNP sites of TPMT and one SNP site of NUDT15. The specific principle of using primers and probes is: wild-type and mutant ARMS primers and MGB probes are designed for mutation sites, combined with fluorescence quantitative PCR reaction, genomic DNA extracted from human whole blood or oral swab samples is tested, signals are collected by real-time fluorescence PCR instrument, and the △Ct values ​​of wild-type and mutant types are calculated to determine the genetic polymorphism of the test samples.

[0066] Furthermore, among the above primers and probes, (1), (3), (5), (6), (7), (9), (11), and (12) form a group; (2), (3), (4), (6), (8), (9), (10), and (12) form another group. The cross-combination of wild / mutant SNP sites can effectively avoid false negative results caused by missing samples.

[0067] Preferably, the fluorescent reporter groups of the four probes in one group are different from each other, and the fluorescent reporter groups of the four probes in another group are different from each other.

[0068] In a specific embodiment, the fluorescent reporter group of the TPMT gene 238 public probe as shown in SEQ ID NO:4 is FAM, and the quencher group is MGB; the fluorescent reporter group of the TPMT gene 460 public probe as shown in SEQ ID NO:8 is VIC, and the quencher group is MGB; the fluorescent reporter group of the TPMT gene 719 public probe as shown in SEQ ID NO:12 is ROX, and the quencher group is MGB; the fluorescent reporter group of the NUDT15 gene 415 public probe as shown in SEQ ID NO:16 is SX670, and the quencher group is MGB. Among them, SX670 is used as a substitute fluorescent group for CY5, and its fluorescence intensity can be improved by multiple levels.

[0069] The present invention also provides a kit for detecting human TPMT gene and NUDT15 gene polymorphisms, comprising the above composition. In the above composition, (1), (3), (5), (6), (7), (9), (11), (12) form a group; (2), (3), (4), (6), (8), (9), (10), (12) form another group; the two groups exist in the form of separate packages.

[0070] Preferably, the amount of the primer is 0.2-0.3 μmol / L; the amount of the probe is 0.1-0.2 μmol / L.

[0071] Furthermore, the kit also includes a nucleic acid amplification reaction solution; the components of the nucleic acid amplification reaction solution include tris(hydroxymethyl)aminomethane hydrochloride), magnesium chloride, potassium chloride, dNTP / dUTP, DNA polymerase, and UNG enzyme. Preferably, it includes 10-100mmol / L tris(hydroxymethyl)aminomethane hydrochloride solution, 1-5mmol / L magnesium chloride solution, 10-100mmol / L potassium chloride solution, 1-5mmol / L dNTP / dUTP, 5-10U / uL DNA polymerase, and 0.1-2U / μLUNG enzyme. By setting up a UNG enzyme + dUTP anti-pollution system, the possible PCR product contamination is fully degraded by using UNG enzyme to exclude the false positive results that may be caused thereby, thereby ensuring the specificity and accuracy of amplification.

[0072] Furthermore, the kit also includes a negative control and a positive control. The positive control includes a plasmid DNA mixture including 8 SNP target sequences, as follows:

[0073] TPMT gene 238G plasmid sequence (SEQ ID NO: 17):

[0074] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT GCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0075] TPMT gene 238C plasmid sequence (SEQ ID NO: 18):

[0076] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT CCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0077] TPMT gene 460G plasmid sequence (SEQ ID NO:19):

[0078] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGAGCATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0079] TPMT gene 460A plasmid sequence (SEQ ID NO:20):

[0080] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGA A CATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0081] TPMT gene 719A plasmid sequence (SEQ ID NO:21):

[0082] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT A TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0083] TPMT gene 719G plasmid sequence (SEQ ID NO:22):

[0084] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT G TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0085] NUDT15 gene 415C plasmid sequence (SEQ ID NO:23):

[0086] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG CGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0087] NUDT15 gene 415T plasmid sequence (SEQ ID NO: 24):

[0088] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG TGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0089] The underlined parts in the sequence are mutation sites.

[0090] Negative control: TE diluent.

[0091] The present invention also provides a method for detecting human TPMT gene and NUDT15 gene polymorphism for non-disease diagnosis and treatment purposes, based on the above composition or the above kit, specifically comprising the following steps:

[0092] S1. Extracting nucleic acid from the sample to be tested;

[0093] The sample can be whole blood or oral swab.

[0094] S2. Using the composition or kit to perform fluorescent quantitative PCR on nucleic acid;

[0095] The reaction procedure of fluorescence quantitative PCR amplification is preferably: the first stage is 50°C UNG enzyme treatment for 2 minutes; the second stage is 95°C pre-denaturation for 30 seconds; the third stage is 95°C denaturation for 10 seconds; 56°C annealing and extension for 30 seconds, a total of 45 cycles, and the fluorescence signal is collected at 56°C.

[0096] S3. Obtain and analyze the results.

[0097] The nucleic acid of the sample to be tested is subjected to fluorescent quantitative PCR reaction using the wild-type primers and probes of each gene, as well as the mutant primers and probes, and the CT value of the corresponding test result is obtained. The genetic polymorphism of the test sample is determined by calculating the △Ct value of the wild type and the mutant type.

[0098] The effects of the composition, kit and method for detecting human TPMT gene and NUDT15 gene polymorphisms of the present invention are studied below through specific examples.

[0099] Embodiment 1:

[0100] In this embodiment, based on the rs1800462 (238G>C) site, rs1800460 (460G>A) site, rs1142345 (719A>G) site of the TPMT gene and the rs116855232 (415C>T) site of the NUDT15 gene, specific upstream and downstream primers and probes are designed to provide a composition for detecting human TPMT gene and NUDT15 gene polymorphisms, including composition 1 and composition 2, the sequences of which are shown in Table 1.

[0101] Table 1 Primer and probe sequence list

[0102]

[0103]

[0104] Embodiment 2:

[0105] This embodiment provides a kit for detecting human TPMT gene and NUDT15 gene polymorphisms, comprising the composition provided in Example 1, a nucleic acid amplification reaction solution, a negative control, and a positive control.

[0106] The nucleic acid amplification reaction solution includes: 40mmol / L tris(hydroxymethyl)aminomethane hydrochloride solution, 3mmol / L magnesium chloride solution, 70mmol / L potassium chloride solution, 2mmol / L dNTP / dUTP, 5U / uL DNA polymerase, and 0.2U / μL UNG enzyme.

[0107] The positive control contains a mixture of plasmid DNA including 8 SNP target sequences, as follows:

[0108] TPMT gene 238G plasmid sequence (SEQ ID NO: 17):

[0109] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT G CAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0110] TPMT gene 238C plasmid sequence (SEQ ID NO:18):

[0111] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT C CAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0112] TPMT gene 460G plasmid sequence (SEQ ID NO:19):

[0113] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGA GCATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0114] TPMT gene 460A plasmid sequence (SEQ ID NO:20):

[0115] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGA A CATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0116] TPMT gene 719A plasmid sequence (SEQ ID NO:21):

[0117] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT A TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0118] TPMT gene 719G plasmid sequence (SEQ ID NO:22):

[0119] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT G TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0120] NUDT15 gene 415C plasmid sequence (SEQ ID NO:23):

[0121] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG C GTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0122] NUDT15 gene 415T plasmid sequence (SEQ ID NO:24):

[0123] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG TGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0124] Negative control: TE diluent.

[0125] Embodiment 3:

[0126] This example provides a method for detecting human TPMT gene and NUDT15 gene polymorphisms for non-disease diagnosis and treatment purposes based on the kit provided in Example 2, which specifically includes the following steps.

[0127] 1. Reagent preparation

[0128] According to the number of samples to be tested, negative controls, and positive controls, the nucleic acid amplification reaction solution (9 μL / test) was fully mixed with composition 1 (9 μL / test) and composition 2 (9 μL / test) in the primer-probe combination to form detection reagent ① and detection reagent ②. The detection reagent ① and detection reagent ② were dispensed into corresponding PCR reaction tubes at a volume of 18 μL / well, 2 wells for 1 test, and set aside after instantaneous centrifugation.

[0129] 2. Sample processing and sample addition

[0130] (1) In this example, the nucleic acid extraction reagent and nucleic acid extraction kit (magnetic bead method) of Wuhan Haijili Biotechnology Co., Ltd. were used to extract nucleic acids from EDTA anticoagulated whole blood and oral swabs, respectively.

[0131] (2) Add the sample nucleic acid, negative control, and positive control to the corresponding two PCR reaction tubes at a volume of 2 μL / tube, with a total volume of 20 μL / tube. Close the PCR reaction tube cap tightly, mix it upside down, and centrifuge it briefly at low speed to ensure that there are no droplets on the tube wall and no bubbles in the liquid in the tube.

[0132] 3. PCR amplification and result analysis

[0133] (1) Place the PCR reaction tube in a real-time fluorescence quantitative PCR instrument and set four fluorescence detection channels: FAM, VIC, ROX, and CY5.

[0134] (2) The reaction procedure of fluorescence PCR amplification was as follows: the first stage was 50°C UNG enzyme treatment for 2 min; the second stage was 95°C pre-denaturation for 30 s; the third stage was 95°C denaturation for 10 s; and the third stage was 56°C annealing and extension for 30 s, for a total of 45 cycles, and the fluorescence signal was collected at 56°C.

[0135] (3) After the reaction is completed, the CT values ​​of each signal channel (FAM, VIC, ROX, CY5) in the detection reagents ① and ② are obtained, and the polymorphisms of the TPMT gene 238, 460, 719 and NUDT15 gene 415 sites of the test sample are determined according to the △Ct values ​​of the detection reagents ① and ② in each signal channel. The specific gene polymorphism detection results are shown in Table 2.

[0136] Table 2 Gene polymorphism detection results

[0137]

[0138] Embodiment 4:

[0139] This example uses the same kit and method as in Example 3 to detect EDTA anticoagulated whole blood samples of TPMT 719 heterozygous and NUDT15415 wild-type. The amplification results of each detection channel are as follows: Figure 1 As shown in the figure, it can be seen that the composition of the present invention can well detect the polymorphism of human TPMT gene and NUDT15 gene in whole blood samples.

[0140] Embodiment 5:

[0141] This example uses the same kit and method as in Example 3 to detect TPMT wild-type and NUDT15415 heterozygous oral swab samples. The amplification results of each detection channel are as follows: Figure 2 As shown in the figure, it can be seen that the composition of the present invention can well detect the polymorphism of human TPMT gene and NUDT15 gene in oral swab samples.

[0142] Embodiment 6:

[0143] This example uses the same kit and method as in Example 3 to detect the positive control plasmid. The positive control is a mixture of 8 plasmids containing four SNP sites. No nucleic acid extraction is required. The amplification results of each detection channel are as follows: Figure 3 As shown in the figure, it can be seen that the composition of the present invention can well detect the positive control plasmid, indicating that the composition of the present invention can be used to detect human TPMT gene and NUDT15 gene polymorphism.

[0144] Embodiment 7:

[0145] This example uses the same kit and method as in Example 3 to test 8 whole blood samples with unknown test results, and compares them with the Sanger sequencing results. The results are shown in Table 3.

[0146] Table 38 Whole blood sample test results

[0147]

[0148] As can be seen from Table 3, the detection results of the nucleic acid detection kit for testing the TPMT gene and NUDT15 gene polymorphisms related to human thiopurine drug metabolism of the present invention are completely consistent with the Sanger sequencing detection results of the TPMT gene rs1800462 (238G>C) site, rs1800460 (460G>A) site rs1142345 (719A>G) site and NUDT15 gene rs116855232 site (415C>T) site, and the kit has high accuracy.

[0149] Embodiment 8:

[0150] The nucleic acid of sample 6 in Example 7 was extracted with a nucleic acid extraction reagent and diluted to a concentration of 0.5 ng / μL. The same method as in Example 3 was used for detection. The amplification results of each detection channel were as follows: Figure 4 As shown in the figure, it can be seen that when the nucleic acid concentration in the sample is 0.5 ng / μL, the composition of the present invention can still ensure the accuracy of detection.

[0151] The above examples are merely illustrative of the present invention and do not constitute a limitation on the protection scope of the present invention. All designs that are the same or similar to the present invention fall within the protection scope of the present invention.

Claims

1. A composition for detecting human TPMT gene and NUDT15 gene polymorphism, characterized in that: The composition comprises: (1) a wild-type ARMS upstream primer of the TPMT gene 238 as shown in SEQ ID NO: 1, a common downstream primer of the TPMT gene 238 as shown in SEQ ID NO: 3, and a common probe of the TPMT gene 238 as shown in SEQ ID NO: 4; (2) the TPMT gene 238 mutant ARMS upstream primer as shown in SEQ ID NO: 2, the TPMT gene 238 common downstream primer as shown in SEQ ID NO: 3, and the TPMT gene 238 common probe as shown in SEQ ID NO: 4; (3) a wild-type ARMS upstream primer of the TPMT gene 460 as shown in SEQ ID NO:5, a common downstream primer of the TPMT gene 460 as shown in SEQ ID NO:7, and a common probe of the TPMT gene 460 as shown in SEQ ID NO:8; (4) a mutant ARMS upstream primer of the TPMT gene 460 as shown in SEQ ID NO:6, a common downstream primer of the TPMT gene 460 as shown in SEQ ID NO:7, and a common probe of the TPMT gene 460 as shown in SEQ ID NO:8; (5) a wild-type ARMS upstream primer of the TPMT gene 719 as shown in SEQ ID NO: 9, a common downstream primer of the TPMT gene 719 as shown in SEQ ID NO: 11, and a common probe of the TPMT gene 719 as shown in SEQ ID NO: 12; (6) the TPMT gene 719 mutant ARMS upstream primer as shown in SEQ ID NO: 10, the TPMT gene 719 common downstream primer as shown in SEQ ID NO: 11, and the TPMT gene 719 common probe as shown in SEQ ID NO: 12; (7) a wild-type ARMS upstream primer of the NUDT15 gene 415 as shown in SEQ ID NO: 13, a common downstream primer of the NUDT15 gene 415 as shown in SEQ ID NO: 15, and a common probe of the NUDT15 gene 415 as shown in SEQ ID NO: 16; (8) The NUDT15 gene 415 mutant ARMS upstream primer as shown in SEQ ID NO:14, the NUDT15 gene 415 common downstream primer as shown in SEQ ID NO:15, and the NUDT15 gene 415 common probe as shown in SEQ ID NO:

16.

2. The composition for detecting human TPMT gene and NUDT15 gene polymorphism according to claim 1, characterized in that: The composition exists in a combined form, wherein (1), (4), (5), and (8) form one group; (2), (3), (6), and (7) form another group, and the fluorescent reporter groups of the probes in each group are different from each other.

3. The composition for detecting human TPMT gene and NUDT15 gene polymorphism according to claim 2, characterized in that: The fluorescent reporter group of the public probe 238 of the TPMT gene as shown in SEQ ID NO:4 is FAM, and the quencher group is MGB; the fluorescent reporter group of the public probe 460 of the TPMT gene as shown in SEQ ID NO:8 is VIC, and the quencher group is MGB; the fluorescent reporter group of the public probe 719 of the TPMT gene as shown in SEQ ID NO:12 is ROX, and the quencher group is MGB; the fluorescent reporter group of the public probe 415 of the NUDT15 gene as shown in SEQ ID NO:16 is SX670, and the quencher group is MGB.

4. A kit for detecting human TPMT gene and NUDT15 gene polymorphism, characterized in that: The invention comprises the composition according to any one of claims 1 to 3.

5. The kit for detecting human TPMT gene and NUDT15 gene polymorphism according to claim 4, characterized in that: In the composition, (1), (4), (5), and (8) form one group; (2), (3), (6), and (7) form another group; and the two groups are in the form of separate packages.

6. The kit for detecting human TPMT gene and NUDT15 gene polymorphism according to claim 4, characterized in that: The amount of the primer in the composition is 0.2-0.3 μmol / L; the amount of the probe in the composition is 0.1-0.2 μmol / L.

7. The kit for detecting human TPMT gene and NUDT15 gene polymorphism according to claim 4, characterized in that: It also includes a nucleic acid amplification reaction solution; the components of the nucleic acid amplification reaction solution include tris(hydroxymethyl)aminomethane hydrochloride, magnesium chloride, potassium chloride, dNTP / dUTP, DNA polymerase, and uracil-N-glycosylase.

8. The kit for detecting human TPMT gene and NUDT15 gene polymorphism according to claim 4, characterized in that: Negative and positive controls were also included.

9. A method for detecting human TPMT gene and NUDT15 gene polymorphism for non-disease diagnosis and treatment purposes, characterized in that: Based on the composition according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 8, the method comprises the following steps: S1. Extracting nucleic acid from the sample to be tested; S2. Performing fluorescent quantitative PCR on nucleic acid using the composition or kit; S3. Obtain and analyze the results.

10. The method for detecting human TPMT gene and NUDT15 gene polymorphism for non-disease diagnosis and treatment purposes as claimed in claim 9, characterized in that: The reaction procedure of the fluorescent quantitative PCR amplification is: the first stage is 50°C UNG enzyme treatment for 2 minutes; the second stage is 95°C pre-denaturation for 30 seconds; the third stage is 95°C denaturation for 10 seconds; 56°C annealing and extension for 30 seconds, a total of 45 cycles, and the fluorescent signal is collected at 56°C.

Images