Primer probe combination for detecting bladder cancer and application

Abstract

The invention belongs to the technical field of molecular biology, and discloses a methylation-based bladder cancer detection tumor marker composition and application thereof. Through screening, it is found that the methylation level of CpG sites in target areas in the three genes TWI ST, OTX1 and VI M is closely related to bladder cancer. The invention provides a primer probe combination for detecting the genes, which comprises corresponding primers and probe sequences, and also relates to primers and probes for detecting reference genes. On the basis, a kit for detecting bladder cancer and application are developed. The method comprises the following steps: collecting a urine sample, carrying out DNA extraction, hydrosulphite conversion and PCR reaction, and judging and counting the result. Compared with the prior art, the kit has the advantages of noninvasiveness, convenience, economy, high flux, high sensitivity, high specificity and the like, and the sensitivity and the accuracy of bladder cancer detection are effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a primer-probe combination and application thereof for detecting bladder cancer. Background Art

[0002] Bladder cancer (BC) is one of the most common malignant tumors of the urinary system, and most of them originate from the epithelial and interstitial tissues of the bladder wall. Its main tissue types include urothelial carcinoma, squamous cell carcinoma and adenocarcinoma, of which urothelial carcinoma accounts for more than 90%. Globally, the incidence of bladder cancer ranks ninth among all malignant tumors. It can occur in all age groups, with the high incidence age concentrated in 50-70 years old, and the incidence rate in men is 3-4 times that in women. About 75% of patients have non-muscle invasive bladder cancer (NMIBC), of which 70% of patients will have tumor recurrence, and 15% of patients will have worsening tumor staging and grade. This requires patients diagnosed with NMIBC to receive frequent treatment and monitoring, and also makes BC the type of cancer with the highest lifetime treatment cost for patients.

[0003] The occurrence and development of bladder cancer is a complex, multi-factorial, multi-step pathological process. The specific pathogenesis has not yet been fully elucidated. Both internal genetic factors and external environmental factors play an important role. The malignant transformation of normal bladder cells begins with changes in cell DNA. Chemical carcinogens are the main external pathogenic factors of bladder cancer. Aromatic compounds in tobacco and various chemical products, such as 2-naphthylamine and 4-aminobiphenyl, enter the urine after metabolism, causing bladder epithelial cells to become malignant. Urothelial tumors have multi-centerity in time and space. A history of upper urinary tract cancer is an important risk factor for bladder urothelial cancer. The risk of bladder cancer in such patients is about 15%-50%.

[0004] Hematuria is the most common clinical manifestation of bladder cancer patients. About 80%-90% of patients have intermittent, painless, full-course macroscopic hematuria as the first symptom. As the tumor continues to grow and infiltrate, it will turn into persistent hematuria. However, even in patients at high risk of bladder cancer, the diagnosis rate of hematuria is low, because hematuria may also be caused by other non-malignant genitourinary diseases. Bladder cancer is mainly caused by amine chemicals, local bladder irritation, drug factors, gene mutations and other factors. Patients mainly show symptoms such as urinary retention, dysuria, pain, upper urinary tract obstruction, urination irritation, lower limb edema and distant metastasis; about 10% of bladder cancer patients are accompanied by bladder irritation signs, manifested as frequent urination, urgency, and pain, which indicates that the patient may have carcinoma in situ, muscle-invasive urothelial carcinoma, squamous cell carcinoma or adenocarcinoma. These symptoms seriously affect the life safety and physical health of patients. If not treated in time, they will cause more serious complications such as adverse intestinal reactions, bladder perforation and abnormal urination, which are not conducive to the prognosis of patients.

[0005] As a non-invasive genomic testing method, liquid biopsy can be used as an alternative to primary tumor biopsy to achieve personalized patient monitoring through non-invasive testing. Liquid biopsy has the advantages of easy sample acquisition, little trauma or even non-invasiveness. Its samples usually include blood, urine, saliva and milk. In particular, the analysis of circulating tumor DNA (ctDNA) and urinary tract tumor DNA (utDNA) has a potential role in the diagnosis, staging and monitoring of urothelial carcinoma. The present invention uses PCR technology to amplify bladder cancer-related genes in urine DNA, which can effectively enrich and capture early bladder cancer signals.

[0006] Epigenetics has been a hot topic in tumor research in recent years. Epigenetic changes such as DNA methylation, histone modification, chromatin remodeling, and non-coding RNA regulation are believed to be closely related to the occurrence of tumors. Among them, DNA methylation is the most common epigenetic change, which can regulate cell proliferation, apoptosis, and differentiation, and its level is closely related to the biological characteristics of the tumor, usually leading to gene expression defects. Therefore, DNA methylation markers are widely used in the diagnosis and prognosis of common cancers.

[0007] At present, the research technologies based on methylation detection are mainly divided into whole-genome methylome detection and specific site methylation detection. The cost of whole-genome methylation analysis is relatively high, and it is usually used as a means of high-throughput screening to discover target genes; specific site methylation detection is a technology for detecting specific methylation sites, mainly including quantitative methylation-specific PCR (qMSP), chromatin immunoprecipitation-quantitative real-time PCR (ChIP-qPCR) and methylated RNA binding protein immunoprecipitation-quantitative real-time PCR (MeRIP-qPCR). Among them, quantitative methylation-specific PCR (qMSP) technology has the advantages of high sensitivity, fast detection, strong repeatability, and no need for electrophoresis, hybridization and other operations after PCR, which reduces contamination and operational errors. It can effectively detect abnormal methylation at specific sites in the early stage of tumors and has been widely used in clinical early cancer auxiliary diagnosis.

[0008] The early diagnosis and treatment rate of bladder cancer in my country is low, and the early screening method is not effective. Screening and monitoring of high-risk groups for bladder cancer is the key to achieving early detection, early diagnosis and early treatment of bladder cancer, and thus improving the efficacy of bladder cancer treatment.

[0009] Currently, the main diagnostic methods for bladder cancer include imaging examination, urine examination, urine fluorescence in situ hybridization (FISH) and cystoscopy.

[0010] Imaging examination methods, such as ultrasound, CT, MRI, and magnetic resonance urography, are mainly used to understand the degree and range of bladder lesions and the upper urinary tract, which helps to determine the clinical stage of bladder cancer. However, such methods are not sensitive enough for smaller tumors and it is difficult to make a clear diagnosis. For example, in patent CN201910073333.3, although imaging technology is used to detect bladder cancer, it still faces the problem of difficulty in accurately identifying tiny tumors, which cannot meet the needs of accurate diagnosis of early bladder cancer.

[0011] In urine examination, routine urine examination can detect microscopic hematuria early, but its sensitivity and specificity are low. Urine exfoliative cytology and cystoscopy are the main methods for diagnosing bladder cancer. Cystoscopy combined with biopsy is regarded as the gold standard for detecting bladder cancer. However, this is an invasive operation that requires entering the bladder through the urethra for examination, which may cause complications such as urogenital infection, urethral and bladder bleeding, urethral injury and urethral stricture. Due to its high cost and painful process, patients have low compliance with follow-up. The cystoscopy-related technologies involved in patent CN201810096433.2 are also unable to avoid the disadvantages of these invasive operations. Urine exfoliative cytology and FISH are non-invasive operations. Urine exfoliative cytology has a high specificity, but its sensitivity for diagnosing low-grade bladder cancer is low, it takes a long time, and it is easy to have false positives and miss early tumors; FISH has high sensitivity but low specificity, and the sensitivity of these two methods for low-grade bladder cancer is less than about 16%, and has not yet been widely used in clinical practice. In patent CN201710374744.1, urine-related detection technology was improved, but no significant breakthroughs have been made in the sensitivity and specificity of detecting low-grade bladder cancer.

[0012] Studies have shown that in the genome of cancer cells, the degree of DNA methylation is reduced, which contributes to the overexpression of proto-oncogenes, the increase of mutation rate, etc. At the same time, the DNA in the promoter region of tumor suppressor genes will be highly methylated, thereby inhibiting the expression of tumor suppressor genes, which is conducive to tumor invasion, metastasis and angiogenesis. Studies have also shown that methylated CpG sites in urine may be promising markers for detecting or monitoring BCa. Therefore, abnormal DNA methylation may be used as a molecular marker for the diagnosis, prognosis and treatment of bladder cancer. Although some methylation markers have been found to be able to distinguish bladder cancer patients from non-bladder cancer subjects to a certain extent, these methylation markers still need to be further improved and verified in terms of sensitivity in diagnosing early bladder cancer, specificity in diagnosing interference samples and bladder cancer negative samples, and sensitivity, in order to achieve the goal of non-invasive diagnosis. In summary, there is an urgent need for a non-invasive, safe, rapid, highly specific, highly sensitive and universally applicable bladder cancer detection method, which has important practical significance for the early screening diagnosis, timely treatment and prognosis of bladder cancer. Summary of the invention

[0013] The invention provides a primer-probe combination for detecting bladder cancer. The primer-probe combination comprises primers and probes for detecting target regions in TWIST, VIM and OTX1 genes. The sequences of the primers and probes are as follows: TWIST-F: AGAGTAGGTCGGGACGTAA; TWIST-R: CCAAAAACCAAACCGCGA; TWIST-P: TTTTCGCGGCGCGGTTA; VIM-F: CGGAGTTACGTGATTACGTT; VIM-R: CCGAAAACGAAACGTAAAAACTA; VIM-P: TACTAAAACGCAACGCGCTA; OTX1-F: GGTTAGAGTTTTTCGGCGTT; OTX1-R: GAAATACGACTCTATACGCGAA; OTX1-P: AAAAACGCGCTCCTCCGA.

[0014] Furthermore, it also includes a primer probe for detecting an internal reference gene, and the primer probe for detecting an internal reference gene includes: β-actin-F: GTGTTTAGGGTTTTTTGTTTTTT; β-actin-R: AATACCTCTCTTACTCTAAACCT; β-actin-P: TGATGGTGGGTATGGGTTAGAA. Furthermore, the detection probes corresponding to the detection primer pair of the detection probe and the internal reference gene ATCB both contain a fluorescent reporter gene and a fluorescent quencher gene, wherein the 5' end of the detection probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, ROX, CY5, and VIC; the 3' end of the detection probe contains a fluorescent quencher group, and the fluorescent quencher group includes any one of MGB, BHQ1, BHQ-2, and BHQ-3.

[0015] Furthermore, the fluorescent group labeled with the probe is FAM, and the quenching group is BHQ1.

[0016] The present invention also provides an application of preparing a kit for detecting bladder cancer. The primer-probe combination is used to prepare a kit for detecting bladder cancer.

[0017] The present invention also provides a bladder cancer detection kit, comprising the primer-probe combination.

[0018] Furthermore, the method also includes Buffer, dNTP, Taq DNA polymerase for PCR reaction, and primer probes corresponding to a positive control, a negative control, and an internal reference gene (β-actin).

[0019] Beneficial effects:

[0020] The present invention screens out CpG sites in the target regions of the three genes TWIST, OTX1, and VIM, whose methylation levels are strongly correlated with bladder cancer, and then designs primer-probe combinations. Compared with the prior art, the present invention has the following significant effects:

[0021] Non-invasive, convenient and fast: Through urine sample testing, invasive operations are avoided, which is convenient for patients and the testing process is relatively fast.

[0022] Economical and applicable: The detection method is low-cost and does not require special equipment. The test results are less affected by differences in instruments and equipment, making it suitable for auxiliary diagnosis and screening of large populations.

[0023] High throughput and high sensitivity: qMSP detection technology is used to detect methylation from non-methylated templates with high sensitivity, and can detect 1% methylation, without the need for post-PCR electrophoresis, hybridization and other operations, reducing contamination and operational errors.

[0024] High diagnostic accuracy: The reagents and kits provided effectively improve the sensitivity and specificity of bladder cancer detection. The combined diagnostic method avoids missed detection of early tumors and the occurrence of false positives, and can effectively distinguish bladder cancer patients from healthy people, which is helpful for early diagnosis and large-scale screening of bladder cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Flowchart of the overall method principle. DETAILED DESCRIPTION

[0026] Example 1

[0027] First, highly relevant and suspected highly methylated sites of bladder cancer were screened out through various databases and calculations, and MethyLight methylation primers and probes were designed for the gene fragments of the screened methylated sites; secondly, the feasibility and accuracy of the designed primer probes were verified, and a pair of primers with relatively high sensitivity and specificity was determined. Finally, the methylation level of urine DNA was detected by qMSP.

[0028] 1. Sample collection

[0029] Use a clean urine sample collection tube to collect urine samples with a urine volume of 100-200 mL. After the urine sample is collected, it should be stored at room temperature for no more than 24 hours. The remaining sample should be centrifuged to prepare urine sediment and stored at -40 degrees for long-term storage.

[0030] 2. DNA Extraction

[0031] The present invention uses urine sediment DNA, and DNA extraction uses a urine extraction kit (Quick-DNA Urine Kit) from ZYMO RESEARCH Biological Company. For specific operations, refer to the kit instructions. The obtained DNA is detected for concentration and quantitatively analyzed using nanordop.

[0032] 3. Bisulfite Conversion

[0033] Take 200-500 ng of urine sediment DNA and use the DNA conversion kit (EZ DNA Methylation Kit, D5002) of ZYMO RESEARCH Biological Company to perform bisulfite modification of DNA. For specific operations, please refer to the kit instructions. The conversion process can convert unmethylated cytosine into uracil, while methylated cytosine remains unchanged. Therefore, the same nucleic acid sequence becomes different nucleic acid sequences after conversion due to its different methylation levels, thereby achieving the distinction between methylated and unmethylated sequences. After bisulfite treatment, unmethylated cytosine is converted into uracil, and through subsequent PCR, uracil is converted into thymine, while methylated cytosine remains unchanged.

[0034] 4. PCR reaction

[0035] During the PCR reaction, the primers and probes can specifically bind to the converted methylated DNA, and by detecting the fluorescent signal, it is determined whether the sample is methylated. The amount of each component in the PCR reaction system is shown in Table 1. The PCR reaction procedure is shown in Table 2. The amount of all template DNA loaded is 10 ng.

[0036] Table 1 PCR reaction system (20 μl)

[0037] Components Addition volume (μl) Buffer 2 dNTP 1.6 Upstream primer (5 μM) 0.8 Downstream primer (5 μM) 0.8 Probe (5uM) 0.8 Taq DNA polymerase 0.12 Template DNA (5 ng / μl) 2 ddH2O Filling Total volume 20

[0038] Table 2 PCR reaction program

[0039]

[0040]

[0041] 4. Judgment and statistical methods of test results

[0042] (1) Setting the baseline and reading the Ct value: The fluorescence signal of the first 3-15 cycles of the PCR reaction is set as the baseline. The threshold can be automatically output by the instrument or the baseline can be manually adjusted according to the instrument's instructions. The threshold is set in the linear part of the fluorescence value logarithmic graph. The data is exported from the software and the Ct value is read. If the gene is not amplified, the Ct value is defined as 35. The Ct value is the number of cycles corresponding to reaching the threshold.

[0043] (2) Quality control: Sample testing should set up control groups for quality control, including: positive control, negative control, blank control and internal reference gene. The positive control group is a methylated standard, the negative control is an unmethylated standard, the blank control has no template DNA, and the internal reference gene is β-actin. When the positive control shows an obvious S-shaped amplification curve and the CT value ranges between 28-38, the negative control and the blank control have no amplification, and the Ct value of the sample internal reference gene is ≤35, the experiment is considered valid and the next step of sample result determination can be carried out. Otherwise, the experiment is invalid and must be retested.

[0044] (3) Result analysis and interpretation method: In the sample to be tested, if the Ct value of at least two amplified target regions in the three replicate wells is ≤40, then the site in this sample is considered to be methylation positive and the sample is a cancer-positive sample, otherwise, it is negative; if the Ct value of the amplified target region is >40, then the site in this sample is considered to be methylation negative and the sample is a cancer-negative sample. According to the above judgment criteria, the methylation levels of the three markers are used to diagnose some urine samples, and the results are compared with the pathological results to calculate the sensitivity and specificity of methylation detection. The sensitivity is the proportion of PCR positive in samples with positive pathological results, and the specificity is the proportion of PCR negative in samples with negative pathological results.

[0045] 5. Results and Statistics

[0046] Sample information: A total of 100 urine samples were collected for testing, including 41 bladder cancer patients, 30 samples of urinary system non-bladder cancer (including 10 benign bladder cancers), and 19 samples of normal people. The test information is shown in the following table:

[0047]

[0048]

[0049]

[0050]

[0051]

[0052] The test results of 100 urine samples are as follows: Single molecule marker detection urine samples

[0053]

[0054]

[0055] Combined detection of urine samples using dual molecular markers

[0056]

[0057] Note: When testing a combination of specimens, if both are negative, the test is considered negative, and if one is negative and the other is positive or both are positive, the test is considered positive.

[0058] From the above results, it can be seen that the single gene locus has a good effect on the auxiliary diagnosis of bladder cancer, and has good specificity for healthy people and other urinary system diseases; the inventors used a combination of two methylation sites to diagnose bladder cancer urine samples, and the results showed that the sensitivity of the joint test was significantly improved and the specificity was also high. Therefore, the combined diagnosis method of two markers is better than the single marker diagnosis method.

Claims

1. A primer-probe combination for detecting bladder cancer, characterized in that: The primer-probe combination includes primers and probes for detecting target regions in TWIST, VIM, and OTX1 genes, and the sequences of the primers and probes are as follows: TWIST-F: AGAGTAGGTCGGGACGTAA; TWIST-R: CCAAAAACCAAACCGCGA; TWIST-P: TTTTCGCGGCGCGGTTA; VIM-F: CGGAGTTACGTGATTACGTT; VIM-R: CCGAAAACGAAACGTAAAAACTA; VIM-P: TACTAAAACGCAACGCGCTA; OTX1-F: GGTTAGAGTTTTTCGGCGTT; OTX1-R: GAAATACGACTCTATACGCGAA; OTX1-P: AAAAACGCGCTCCTCCGA.

2. The primer-probe combination for detecting bladder cancer-related genes according to claim 1, characterized in that: It also includes a primer probe for detecting an internal reference gene, wherein the primer probe for detecting an internal reference gene includes: β-actin-F: GTGTTTAGGGTTTTTTGTTTTTT; β-actin-R: AATACCTCTCTTACTCTAAACCT; β-actin-P: TGATGGTGGGTATGGGTTAGAA.

3. The primer-probe combination for detecting bladder cancer-related genes according to claim 1 or 2, characterized in that: The detection probe and the detection primer pair corresponding to the internal reference gene ATCB both contain a fluorescent reporter gene and a fluorescent quencher gene, wherein the 5' end of the detection probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, ROX, CY5, and VIC; the 3' end of the detection probe contains a fluorescent quencher group, and the fluorescent quencher group includes any one of MGB, BHQ1, BHQ-2, and BHQ-3.

4. The primer-probe combination for detecting bladder cancer-related genes according to claim 3, characterized in that: The fluorescent group labeled with the probe is FAM, and the quenching group is BHQ1.

5. An application of a kit for preparing a kit for detecting bladder cancer, characterized in that: The primer-probe combination according to any one of claims 1 to 4 is used to prepare a kit for detecting bladder cancer.

6. A bladder cancer detection kit, characterized in that: A primer-probe combination comprising any one of claims 1 to 4.

7. The bladder cancer detection kit according to claim 7, characterized in that: The invention also includes a buffer, dNTP, Taq DNA polymerase for PCR reaction, and primer probes corresponding to a positive control, a negative control, and an internal reference gene β-actin.

Images