Gga-miR-148a-3p related to mycoplasma gallisepticum infection resistance and application of gga-miR-148a-3p

Abstract

The invention belongs to the technical field of breeding of disease-resistant varieties of animals, and discloses a gga-miR-148a-3p molecular marker related to mycoplasma gallisepticum resistance and application of the molecular marker to regulation and control of chicken chronic respiratory disease resistance. The invention finds that the expression quantity of gga-miR-148a-3p in mycoplasma gallisepticum infected chicken lung tissues is obviously reduced, chicken embryo alveolar cells are taken as a research object, the gga-miR-148a-3p expression profiles of mycoplasma gallisepticum infected cells in different time periods are determined, the overexpression of the gga-miR-148a-3p is realized in the cells, the expression of a target gene Rab8A is obviously inhibited, the autophagy of the cells is activated, the mycoplasma gallisepticum is effectively eliminated, and the mycoplasma gallisepticum is effectively eliminated. The invention relates to application of gga-miR-148a-3p in inhibiting mycoplasma gallisepticum infection, inhibiting adhesion and proliferation of the gga-miR-148a-3p, blocking mycoplasma gallisepticum spreading and systemic infection and relieving inflammatory response and apoptosis caused by the mycoplasma gallisepticum infection, and clarifies the action mechanism of the gga-miR-148a-3p participating in regulation and control of mycoplasma The gga-miR-148a-3p disclosed by the invention can be used as a molecular marker related to mycoplasma gallisepticum infection, and by detecting the miRNA, the mycoplasma gallisepticum infected chicken can be subjected to assisted breeding, thereby laying an important foundation for improvement of chicken disease-resistant breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of chicken genetic breeding and molecular marker-assisted selection, and specifically relates to gga-miR-148a-3p related to resistance to Mycoplasma gallisepticum infection and application thereof. Background Art

[0002] Chronic respiratory disease (CRD) caused by Mycoplasma gallisepticum (MG) is a highly contagious disease that is widely prevalent worldwide and has become one of the main infectious diseases that threaten the development of the poultry industry. Once MG enters a chicken farm, it is difficult to remove and is a predisposing factor for other bacterial and viral infections, causing huge economic losses to the poultry industry. Currently, the prevention and treatment of CRD in production mainly involves vaccination and the use of antibiotics, but MG is very easy to mutate. The large-scale use of antibiotics leads to drug residues in chicken and eggs, further endangering human health. At the same time, the emergence of drug-resistant strains further increases the difficulty of preventing and treating CRD. At present, the implementation of "antibiotic reduction or ban" in the breeding industry has made the prevention and treatment of CRD a difficult challenge. Therefore, breeding disease-resistant varieties is an effective way to prevent and treat CRD.

[0003] MicroRNAs (miRNAs) are a type of non-coding single-stranded RNA with a length of about 22 nucleotides, which are widely present in nature. MiRNAs specifically bind to the 3′-UTR of target genes through seed sequences, promote mRNA degradation or inhibit gene translation, and regulate target gene expression at the post-transcriptional level. It is reported that miRNAs are widely involved in various cellular physiological and pathological processes including inflammatory response, cell proliferation, differentiation, apoptosis, pathogenic microorganism infection, natural immunity and acquired immune response through complex signaling pathways. However, the role of gga-miR-148a-3p in Mycoplasma gallisepticum infection needs to be studied. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a gga-miR-148a-3p related to resistance to Mycoplasma gallisepticum infection and its application. The present invention determines the expression spectrum of gga-miR-148a-3p in chicken embryo alveolar cells at different times of MG infection, and proves that it negatively regulates the target gene Rab8A, activates autophagy, and then inhibits MG adhesion and proliferation, blocking its spread and systemic infection. Therefore, gga-miR-148a-3p can be used for molecular breeding of chickens against MG infection.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] A gga-miR-148a-3p related to resistance to infection with Mycoplasma gallisepticum, wherein the nucleotide sequence of the miRNA is UCAGUGCACUACAGAACUUUGU. On the other hand, the present invention provides fluorescent quantitative specific primers for detecting the expression of gga-miR-148a-3p, wherein the nucleotide sequence is: F: CTGGTAGGTCAGTGCACTACAGAAC; R: ACTGGTGTCGTGGAGTCGGC. In order to clarify the function of gga-miR-148a-3p, the present invention adopts a target gene detection method, and uses bioinformatics software to predict that Rab8A is the target gene of gga-miR-148a-3p. Through a dual luciferase reporter system, overexpression and inhibition of gga-miR-148a-3p, it is determined that Rab8A is the target gene of gga-miR-148a-3p. It is shown that gga-miR-148a-3p can regulate the infection of Mycoplasma gallisepticum by negatively regulating the expression of the Rab8A gene. Therefore, gga-miR-148a-3p can be used as a molecular marker for detecting resistance to Mycoplasma gallisepticum infection.

[0007] The present invention has the beneficial effects:

[0008] The invention detects the expression of gga-miR-148a-3p in lung tissue and alveolar cells of chickens infected with Mycoplasma gallisepticum, and finds that the expression of gga-miR-148a-3p is significantly inhibited; the invention uses chicken embryo alveolar cells as research objects, overexpresses gga-miR-148a-3p in the cells, and finds that gga-miR-148a-3p significantly inhibits the expression of target gene Rab8A, activates cell autophagy, effectively removes Mycoplasma gallisepticum, inhibits its adhesion and proliferation, blocks the spread and systemic infection of Mycoplasma gallisepticum, and alleviates the inflammatory response and cell damage caused by it, indicating that gga-miR-148a-3p plays a key role in regulating Mycoplasma gallisepticum infection, can be used for molecular markers of chickens against Mycoplasma gallisepticum infection, and can assist in breeding chickens against Mycoplasma gallisepticum infection by detecting the miRNA, which is of great significance to the healthy development of the poultry industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. It is obvious that the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0010] Figure 1 is the temporal expression profile of gga-miR-148a-3p in MG-infected cells and tissues;

[0011] Figure 2 Detection of autophagy-related proteins at different times;

[0012] Figure 3 Incomplete autophagy induced by MG infection promotes its infection process;

[0013] Figure 4 For the target gene prediction analysis of gga-miR-148a-3p;

[0014] Figure 5 Validation of target genes for gga-miR-148a-3p;

[0015] Figure 6 Detection of resistance-related indicators of gga-miR-148a-3p in MG-infected cells. DETAILED DESCRIPTION

[0016] In order to better understand the present invention, the technical solution of the present invention is described below through specific embodiments.

[0017] Example 1 Detection of the expression of gga-miR-148a-3p in lung tissue and alveolar cells infected with Mycoplasma gallisepticum

[0018] A cell model infected with MG was constructed, and fluorescence quantitative analysis of gga-miR-148a-3p in cells infected at different time periods was performed. Primers were designed using Oligo 7.0 software, and the relative expression of target genes and reference genes was detected using SYBR GEEN reagent in a Roche 480 quantitative PCR instrument; the PCR reaction system was: SYBR qPCR MasterMix (dye method qPCR Mix) 10μL, 10μmol / L upstream primer 0.4μL, 10μmol / L downstream primer 0.4μL, double distilled water 6.7μL, cDNA 2.5μL; PCR reaction conditions were: 95℃5min, 95℃10s, 60℃30s, 40 cycles; melting curve: 60℃→95℃, heating 0.3℃ every 15s; quantitative expression results were based on CP values, according to 2 -ΔΔCt Method to calculate its relative expression; the primer pair sequence of gga-miR-148a-3p is: F: CTGGTAGGTCAGTGCACTACAGAAC; R: ACTGGTGTCGTGGAGTCGGC;

[0019] The experimental results are as follows Figure 1 As shown, qPCR results showed that the level of gga-miR-148a-3p was significantly upregulated at 3h after MG infection, but downregulated in cells 6h after MG infection, and was also significantly downregulated in the lung tissue of chicks.

[0020] Example 2 Detection of autophagy-related levels in MG-infected alveolar cells

[0021] A cell model infected with MG was constructed, and the expression of autophagic proteins and autophagic flow in cells at different infection time periods were detected. The cells were treated with mCheery-EGFP-LC3 lentiviral vector. Before infection, the virus was taken out of the refrigerator and slowly thawed on ice, the original culture medium of the cells was aspirated, 1 / 2 volume of fresh culture medium was added, and the virus was added and gently mixed according to the MOI value = 50 for infection. The culture volume was replenished to the full culture volume 4 hours after infection. 8-16 hours after infection, the culture medium containing the virus was aspirated, replaced with fresh complete culture medium, and continued to be cultured at 37°C. The principle of this method is based on the different pH stability of green and red fluorescent proteins. The fluorescence signal of EGFP can be quenched under acidic conditions (pH < 5) inside the lysosome, and the fluorescence signal of mCherry has no obvious change under acidic conditions. In the green and red fusion images, autophagosomes appear as yellow dots (i.e., mCherry+GFP+), while autophagolysosomes appear as red dots (i.e., mCherry+GFP-). When both the yellow and red spots in the cell increase, the autophagic flow increases; when the yellow spots in the cell increase but the red spots do not change, the autophagic flow is blocked. Finally, the number of yellow spots and red spots after overlay is counted to measure the autophagic flow.

[0022] like Figure 2 As shown in the figure, immunofluorescence and WB results showed that Beclin1 began to express 3h after MG infection, but the protein level of Beclin1 began to decrease 12h after infection, which may be due to the loss of stability of Beclin1 mRNA caused by the decrease of PTBP1 protein level in cells. After 12h of MG infection, the expression of autophagy marker gene LC3B II began to upregulate. 6h before MG infection, p62 protein showed normal autophagic degradation, but p62 protein accumulated to a certain extent in cells 12h after infection, indicating that MG infection caused incomplete autophagy in CP-II cells.

[0023] like Figure 3As shown in the figure, cellular autophagy occurred 3 hours after infection, and CQ treatment at 12 hours increased the yellow fluorescence signal formed by the coexistence of LC3 red and green fluorescence in the cells, indicating that the cellular autophagic flow was partially blocked at 12 hours after MG infection. At 48 hours after infection, CQ treatment did not affect the level of autophagic yellow fluorescence. WB results showed that after CQ treatment, the LC3 II protein level increased at 12 hours and there was no significant change at 48 hours. In addition, CQ treatment before 48 hours of infection increased the expression of MG adhesion protein GapA and bacterial load in cells. It shows that after MG infected CP-II cells, the cellular autophagic flow was partially interrupted at 12 hours and completely blocked at 48 hours, promoting its invasion and replication process in cells.

[0024] Example 3 Prediction of target genes of gga-miR-148a-3p

[0025] miRBD and autophagy-related genes were used to predict target genes and target sites of differentially expressed miRNAs. The target gene prediction results showed that gga-miR-148a-3p could target and bind to the Rab8A gene (a negative regulator of autophagy). The Rab8A gene was downregulated, while gga-miR-148a-3p was upregulated, which was consistent with the functional expectation of miRNA negative regulation ( Figure 4 A, B).

[0026] To confirm that Rab8A is the target gene of gga-miR-148a-3p, a double fluorescence (wild type and mutant) reporter gene vector of the target gene was constructed ( Figure 5 A), co-transfected with gga-miR-148a-3p mimics. The results of luciferase assay showed that the fluorescence activity of cells was significantly downregulated when cells were co-transfected with WT-Luc-Rab8A 3'UTR and gga-miR-148a-3p, while gga-miR-148a-3p had no effect on the fluorescence intensity ( Figure 5 B). This indicates that the seed sequence of gga-miR-148a-3p can specifically bind to the target sequence of Rab8A 3'UTR. Subsequently, gga-miR-148a-3p was overexpressed or inhibited in cells to detect changes in target genes. The results showed that the overexpression / inhibition of gga-miR-148a-3p in cells was successful, and its corresponding target genes were inhibited / upregulated ( Figure 5 C, D). It was further confirmed that Rab8A is a functional target gene of gga-miR-148a-3p and that miRNA negatively regulates its expression.

[0027] Example 4 Effect of gga-miR-200a-3p in Mycoplasma gallisepticum infection

[0028] gga-miR-148a-3p was overexpressed in cells to verify its resistance to MG infection. After MG-infected cells were treated with mCheery-EGFP-LC3 lentiviral vector, gga-miR-148a-3p was overexpressed in cells, and its cell autophagy, inflammation, apoptosis and MG replication in cells were detected to evaluate its anti-MG infection properties.

[0029] like Figure 6 As shown, the interrupted autophagic flux after MG infection for 48 h was rescued by overexpression of gga-miR-148a-3p ( Figure 6 A). gga-miR-148a-3p reduced the release of inflammatory factors TNF-α and IL-1β induced by MG infection and significantly inhibited the cell apoptosis caused by MG ( Figure 6 B, C). In addition, gga-miR-148a-3p treatment significantly reduced the MG copy number in cells ( Figure 6 D). These results demonstrate that gga-miR-148a-3p can act as an anti-MG biomolecule to alleviate MG-induced inflammation and apoptosis, activate cell autophagy to reduce the MG content in cells.

[0030] In summary, the embodiment of the present invention detected the level of gga-miR-148a-3p in the lung tissue of MG-infected chickens and found that it was significantly inhibited; then, taking chicken alveolar type II epithelial cells as an example, overexpressing the gga-miR-148a-3p in chicken alveolar type II epithelial cells can significantly activate cell autophagy, reduce cell inflammation and apoptosis caused by MG infection, enhance the clearance ability of chicken alveolar type II epithelial cells to MG, and inhibit the proliferation and infection of MG. It shows that the gga-miR-148a-3p described in the present invention can be used for molecular breeding of chickens against Mycoplasma gallisepticum infection, and can also be used to prepare drugs against MG infection.

Claims

1. A gga-miR-148a-3p associated with resistance to Mycoplasma gallisepticum infection, characterized in that The nucleotide sequence of the gga-miR-148a-3p is UCAGUGCACUACAGAACUUUGU.

2. The fluorescent quantitative specific primer for detecting the expression of gga-miR-148a-3p according to claim 1, characterized in that: The primer sequences of gga-miR-148a-3p are: F: CTGGTAGGTCAGTGCACTACAGAAC; R: ACTGGTGTCGTGGAGTCGGC.

3. Use of the gga-miR-148a-3p associated with resistance to Mycoplasma gallisepticum infection according to claim 1 as a molecular marker for resistance to Mycoplasma gallisepticum infection.

4. The gga-miR-148a-3p associated with resistance to Mycoplasma gallisepticum infection according to claim 3, characterized in that The regulated target gene is Rab8A.

5. Use of the gga-miR-148a-3p and its target gene associated with resistance to Mycoplasma gallisepticum infection according to claim 4 as molecular markers or targets for resistance to Mycoplasma gallisepticum infection.

6. The use according to claim 5, characterized in that: The specific method is as follows: Overexpression of gga-miR-148a-3p in chicken alveolar type II epithelial cells can significantly inhibit the target gene Rab8A, activate cell autophagy, effectively eliminate Mycoplasma gallisepticum, inhibit its adhesion and proliferation, block the spread and systemic infection of Mycoplasma gallisepticum, and alleviate the inflammatory response and cell damage caused by it.

Images