Goose GSX2 gene body weight and body size related CNV marker and application thereof

Abstract

The invention discloses a goose GSX2 gene body weight and body size related CNV marker and application thereof, the CNV marker is located in a 49560091bp-49560222bp interval of a goose chromosome 4, and the variation type of the interval is a deletion type. The deletion interval is remarkably related to the body weight and body size characters of the geese, the final change of the body weight and body size in the future development process of the geese can be accurately judged, the method can be used for early screening of the body weight and body size characters of the geese, the screening cost is greatly reduced, the genetic breeding process is accelerated, and the breeding efficiency is effectively improved. The method has high economic application value and scientific research value.

Description

Technical Field

[0001] The invention relates to the technical field of goose genetic breeding, and in particular to a CNV marker related to body weight and size of a goose GSX2 gene and an application thereof. Background Art

[0002] Geese are one of the largest edible poultry species currently raised. Body weight and body size are significantly correlated with the growth rate, weight gain and body shape characteristics of geese, and are key indicators for evaluating the production performance of geese. Among them, body weight directly affects consumers' consumption choices and the economic benefits of enterprises. It is the most important economic trait of geese and has been widely studied in the genetic breeding of geese. Body size traits such as chest depth are also important growth traits of geese, which are significantly correlated with body weight and can reflect the growth potential, maturity and production capacity of geese.

[0003] When breeding geese based on their weight and size, accurate weight and size data must be obtained until the goslings reach sexual maturity, and then the individual breeding value is determined based on the obtained data, and then the individual is selected or eliminated. This method has a long breeding cycle, high cost, and low breeding efficiency. Summary of the invention

[0004] The purpose of the present invention is to provide a CNV marker related to weight and size of goose GSX2 gene in order to solve the problems of long cycle and low efficiency of traditional weight and size breeding methods in the prior art. By detecting the polymorphism of CNV markers, the weight and size traits of geese can be quickly determined in the gosling stage, thereby improving breeding efficiency.

[0005] The technical solution of the present invention is described in detail as follows:

[0006] In a first aspect, the present invention provides a CNV marker related to body weight and size of goose GSX2 gene, wherein the CNV marker is located in the interval 49560091bp-49560222bp of goose chromosome 4, and the variation type of the interval is deletion type.

[0007] CNV (Copy number variation) is a type of genomic structural variation, which usually refers to an increase or decrease in the copy number of DNA fragments in a specific region of the genome. It affects genes and phenotypes through mechanisms such as dosage effect, position effect, gene fusion, and gene blocking.

[0008] The study found that when the above CNV marker site is missing, geese have larger weight and body size traits.

[0009] It should be understood that the GSX2 gene CNV marker of the present invention can be a genomic fragment of any length containing the CNV site in the interval 49560091bp-49560222bp of goose chromosome 4, as long as the primers designed when it is used as the target gene can amplify the CNV site. Generally, the target gene length is between 200bp and 700bp.

[0010] Optionally or preferably, the CNV marker has a nucleotide sequence as shown in SEQ ID NO: 1, and the CNV deletion site is located at positions 501-631 of the nucleotide sequence. When the CNV marker is deleted, the goose has a larger weight and body size.

[0011] In a second aspect, the present invention provides the use of the above-mentioned CNV markers related to body weight and size of goose GSX2 gene in goose genetic breeding, for screening or identifying geese with large body weight and size.

[0012] In a third aspect, the present invention provides a reagent for detecting CNV markers related to body weight and size of the goose GSX2 gene, the reagent comprising a primer pair with nucleotide sequences as shown in SEQ ID NOs: 2-3.

[0013] In a fourth aspect, the present invention provides an application of the above detection reagent for screening or identifying geese with large body weight and size.

[0014] In a fifth aspect, the present invention provides a method for screening or identifying geese with large body weight and size, comprising the following steps:

[0015] (1) extracting genomic DNA of the goose to be tested, using the genomic DNA as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, performing a PCR amplification reaction to obtain an amplification product of the CNV marker fragment of the GSX2 gene of the goose to be tested;

[0016] (2) When the sequence polymorphism characteristics of the PCR amplification product showed the CNV marker deletion type, the geese to be tested had a larger weight and body size.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention screens out a CNV molecular marker related to goose weight and body size, which is located in the 49560091bp-49560222bp interval of goose chromosome 4 (Chr04:49560091bp-49560222bp), belonging to the intergenic region adjacent to the GSX2 gene. The present invention also provides a target sequence SEQ ID NO.1 containing the CNV site, which can accurately obtain the polymorphism of the above site by detecting with designed primers, and then can more accurately judge the final changes in the weight and body size of the goose in the future development process according to its polymorphic characteristics, which can be used for early screening of goose weight and body size traits, greatly reducing screening costs, and effectively improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The Manhattan plot and QQ plot of the genome-wide association analysis of goose body weight in the embodiment;

[0020] Figure 2 The Manhattan plot and QQ plot of the genome-wide association analysis of goose breast depth in the embodiment;

[0021] Figure 3 The electrophoresis result diagram of PCR performed on the sample to be tested using the primers of the present invention; DETAILED DESCRIPTION

[0022] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0023] Example 1

[0024] Blood samples and body weight and chest depth trait data were collected from 511 Magang geese (adult geese) from a goose farm in Shanwei City, Guangdong Province. TM The sequencing system obtains raw sequencing data through second-generation whole-genome resequencing.

[0025] To ensure the quality and accuracy of the data, the original genome sequencing data of 511 Magan geese were strictly quality controlled. First, SOAPnuke (v1.5.0) software was used to filter the data and remove low-quality sequences. Then, Speedseq (v0.1.2) software was used to align the filtered sequences to the swan goose reference genome to identify all individual CNVs. Finally, SVtools (v0.5.1) software was used to genotype and further filter the CNVs, and Plink (v1.90b6.21) software was used to quality control and extract these CNVs, retaining the CNVs with a minimum allele frequency (MAF) > 0.01 and in the autosomes, and finally 9098 CNV sites were obtained.

[0026] Combined with the phenotypic data, the linear mixed model (LMM) in the GEMMA (v0.98.1) software was used to construct a genome-wide association matrix and a genome-wide association study (GWAS) for body weight and chest depth traits, respectively. GWAS is one of the methods to study the genetic mechanism of complex traits. It mainly determines the genetic factors that affect phenotypic traits by analyzing the association between phenotypic traits and genetic variation. According to the results of GWAS, we converted the P value of each CNV site to -log(P), and the threshold of significant CNV was 0.05 / n (n is the number of CNVs on each chromosome). Finally, we screened out significant CNVs for the next step of analysis, and used the ggplot2 package of the R language to draw the Manhattan plot and the CMplot package of the R language to draw the Quantile-Quantile plot (QQ plot), see Figure 1-2 .

[0027] The CNVrd2 package of R language was used to perform linkage disequilibrium analysis on the significant CNVs of weight and chest depth and the significant SNPs within 1Mb. All significant CNVs independently affected the traits (r 2 <0.2).

[0028] Through the results of GWAS, we screened out the Chr04:49560091bp-49560222bp deletion site in the body weight and chest depth traits. The signal of this site was significant in different trait GWAS.

[0029] Table 1 P values ​​of Chr04:49560091bp-4956022bp2 deletion site in GWAS of different traits

[0030]

[0031] The association analysis between the Chr04:49560091-49560222 deletion site and body weight and size is shown in Table 2 below.

[0032] Table 2 Association analysis between Chr04:49560091-49560222 deletion loci and body weight and size

[0033]

[0034] Note: The values ​​marked with different letters are significantly different, while the values ​​marked with the same letter are not significantly different.

[0035] In the female goose population, this locus showed a significant association with body weight and chest depth.

[0036] In this embodiment, the molecular marker nucleotide sequence of the intercepted Chr04: 49560091bp-49560222bp deletion site is as follows:

[0037] ACATATATATTTCAAAAATAAGTATTCTGAAGTTAAATTTGTAATTTCCTGGGTTCTTAATTATAAGTTTCATGTTAATTGTAAATGTAGCATATATCTTTAGTTTCCAGAGTGTATATTCTAAATGCTATTTAAAATCTAATAAATGAGATCTCTTAGCATTTTAATATTTATAAAAATAATGCTTTCCATGCTACAGAGCCTTTTCTATTATGATAGCTAAGGTATATAGAGGGAGCCATATATCGTG GTGTATTTTGGTTCTAGTATTGCTTTTTGTGTCGTCTGACATGTTTCTGAACAAACAATAATGAACTGGCTGAAATTCACGTAGTGAAGGCAGATCATTCTTATCATGCTTTTCAGAATAACTAGCTGATTGTCAAACCTGGGAATCGGGTTAGGAAGGGCCATTTGTAGGGTTCTGTCCTCATCAACTTGTAGATGATGCCAAATAAGGGAGCATAAACAGACACTCAAGGGAAGAATTAAAATCCAT AATGATCTGAAATTCGTATGTTAAACTAAGT AGGAAGCATTTCATTGAACTTCAGACTGTGGTACTGAAAATAAGAAACTAGAAATGGTCTGCTGGCTAAGTATGAGG TAGTGACACTTCTGTCGCTGTTCTGCATTTCTTCAAAATGGCCTTGCACTGGGTTAGTTCTCTTTTTCACTTTACTGAAGCAAACTAGGATAGAATGATATTCTCTGCATAAATGGAGCACTCCTAGTAACTCAAACACTGCATATAAAAAAATGTAACTTTTTATTCCAAATGAGAGTGAACAAAACATGAGTAAATAGTTCAAGAGACAAGGTTGCTAAGGAAAGCATTGGGAGGGTGAGGGAGGCAGTTCTTCTACAGAAGAAGAGACT TCAGAAGACCGTAAGTTTTCTACTGTACCAAATGTACGTGGAAAGTTACTAGTTACTGTTCATTTTGTTCCCCATAAAAATAATTTTTGAAATTTGGAACAAATCTGCTGACATTTGGAACAGCAATGATGATAGTGATGGATTTTTTTTAGAGTAGACAGATTCATTTTTTCCAATTTGGTTAATGAGTTATGGGATCAGCATGCCTGGGATTCTTGTGGTTAGGCCCTAGACAGGCAGGACACTACAA

[0038] (SEQ ID NO: 1).

[0039] In the above nucleotide sequence, the mutation sites at positions 501-631 are of deletion type. The TurkeyHSD multiple comparison results found that when the marker mutated to a deletion type, the geese had greater weight and chest depth traits, and this trend was more obvious in the female goose group.

[0040] In summary, by collecting blood samples from Magang geese, using DNBSEQ TM The sequencing system was used for sequencing, and SOAPnuke was used to filter the quality of the sequencing data and remove low-quality sequences. Then, Speedseq was used to align the filtered sequences to the swan goose reference genome to identify all individual CNVs. Finally, SVtools was used to genotype and further filter the CNVs, and Plink was used to perform quality control and extraction on these CNVs to obtain a genotype data set. Combined with its phenotypic measurement data, GEMMA software was used to adopt a single-marker LMM model to screen out the main effect genes and functional mutation sites related to the two traits of weight and chest depth of Magang geese, providing new CNV sites for the breeding selection of weight and chest depth of Magang geese.

[0041] Chr04: 49560091bp-49560222bp deletion site detection: The gene sequence SEQ ID NO.1 was extracted from the Hongyan reference genome, and the primer pair was designed using Primer premier 5.0 software. The primer pair information is shown in Table 3 (primer sequence 5'→3'). The designed primer pair sequence was sent to Sangon Biotech Co., Ltd. for synthesis, and the primer pair was used to perform PCR on blood DNA to test the specificity of the primers. The results are attached. Figure 3 shown.

[0042] Table 3 Primer information for screening Chr04:49560091bp-49560222bp deletion sites

[0043] F:GTAGGGTTCTGTCCTCATCAAC(SEQ ID NO.2) R:CCCTCCCAATGCTTTCCTTA(SEQ ID NO.3)

[0044] Three DNA samples of wild type and heterozygous deletion type and one DNA sample of homozygous deletion type were randomly selected, and a total of seven DNA samples were subjected to PCR amplification. The obtained PCR products were sent to Sangon Biotech for sequencing. Sequencing detection showed that the genotypes of the Chr04:49560091bp-49560222bp deletion site were wild type, heterozygous deletion type and homozygous deletion type, which were consistent with the genotypes obtained by the individual's second-generation genome sequencing.

[0045] The invention concept is described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the core idea of ​​the invention. It should be pointed out that any obvious modification, equivalent substitution or other improvement made by a person of ordinary skill in the art without departing from the invention concept should be included in the protection scope of the present invention.

Claims

1. A CNV marker related to body weight and size of goose GSX2 gene, characterized in that: The CNV marker is located in the 49560091bp-49560222bp interval of goose chromosome 4, and the variation type of the interval is deletion type.

2. The CNV marker according to claim 1, characterized in that The nucleotide sequence is shown in SEQ ID NO:

1. The CNV deletion site is located at positions 501-631 of the nucleotide sequence. When the CNV deletion site is present, the goose has a larger weight and body size.

3. Application of the CNV markers related to body weight and size of goose GSX2 gene according to claim 1 or 2 in goose genetic breeding, characterized in that: Used to screen or identify geese with larger weight and body size.

4. A reagent for detecting CNV markers related to body weight and size of goose GSX2 gene according to claim 1 or 2, characterized in that: The reagents include a primer pair whose nucleotide sequences are shown in SEQ ID NOs: 2-3.

5. Use of the reagent according to claim 4 in goose genetic breeding, characterized in that: Used to screen or identify geese with larger weight and body size.

6. A method for screening or identifying geese with large body weight and size, characterized in that: The following steps are involved: (1) extracting genomic DNA of the goose to be tested, using the genomic DNA as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, performing a PCR amplification reaction to obtain an amplification product of the CNV marker fragment of the GSX2 gene of the goose to be tested; (2) When the sequence polymorphism characteristics of the PCR amplification product showed the CNV marker deletion type, the geese to be tested had a larger weight and body size.

Images