PCR (Polymerase Chain Reaction) rapid identification method for oblique line moth and prodenia litura

Abstract

The invention provides a PCR (Polymerase Chain Reaction) rapid identification method for oblique line moth and prodenia litura, which comprises the following steps: taking genome DNA (Deoxyribose Nucleic Acid) of an insect to be identified as a template, and carrying out PCR amplification by using two specific forward primers and a public reverse primer; the sequences of the primers are respectively as shown in SEQ ID NO.1-3; and according to the size of a PCR amplification product, the oblique line moth and the prodenia litura can be rapidly and accurately identified. According to the method, complex sequencing operation is not needed, the identification process is greatly simplified, and time and cost are saved. Meanwhile, the method is high in specificity and accuracy, misjudgment caused by similar forms can be effectively avoided, and reliable technical support is provided for related research and practical application. In addition, operation is easy and convenient, the technical requirement for operators is relatively low, and application and popularization are easy.

Description

Technical Field

[0001] The invention relates to the field of biotechnology and provides a PCR rapid identification method for Manduca sphenoptera and Manduca litura. Background Art

[0002] In the field of insect taxonomy, accurate species identification is of great significance for ecological research, pest control, and biodiversity conservation. Species identification methods are mainly divided into three categories: morphological identification, chemical composition analysis, and molecular biological identification. Traditional morphological identification methods usually rely on the external morphological characteristics of insects, such as the shape of wings, stripes, and the structure of antennae. However, the appearance of Hippotion velox and Theretra sp. is very similar, so traditional morphological identification methods often find it difficult to accurately distinguish between Hippotion velox and Theretra sp. In addition, some identification methods based on chemical analysis also have limitations, which require complex sample processing and expensive instruments and equipment, and are cumbersome and costly to operate. With the development of molecular biology technology, identification methods based on DNA sequences have gradually become a research hotspot. However, although the common DNA sequencing method has high accuracy, it is complex to operate, time-consuming, and expensive, and is not suitable for large-scale sample identification. Therefore, there is an urgent need for a simple, fast, accurate, and cost-effective method to distinguish between Hippotion velox and Theretra sp. Summary of the invention

[0003] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a PCR rapid identification method for the clouded slash moth and the litura hawk moth. When distinguishing these two morphologically similar hawk moths, the traditional method is not only difficult to ensure accuracy, but also cumbersome to operate, time-consuming and labor-intensive, and the cost is also high. The core improvement of the present invention is to discover the specific intervals of the clouded slash moth and the litura hawk moth, and cleverly select three specific primers, UNPrimer, X340 and W197, to perform PCR amplification on the genomic DNA of the clouded slash moth and the litura hawk moth, and the clouded slash moth and the litura hawk moth can be quickly and accurately identified by the size of the amplified product.

[0004] In order to achieve the above objectives, the scheme of the present invention includes the following contents:

[0005] On the one hand, the present invention provides a primer for quickly identifying the clouded-spotted slash moth and the hackle moth, comprising two specific forward primers and a common reverse primer, the nucleotide sequences of the specific forward primers are respectively shown as SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequences of the common reverse primers are respectively shown as SEQ ID NO.3.

[0006] The invention also provides a PCR detection kit containing the primers.

[0007] In a second aspect, the present invention relates to the use of the primers or the kit in the rapid identification of Manduca sphenops and Sexta sphenops.

[0008] In a third aspect, the present invention provides a PCR rapid identification method for Manduca sphenopsinae and Manduca liturae, comprising the following steps:

[0009] (1) Using the genomic DNA of the insect to be identified as a template, PCR amplification is performed using two specific forward primers and a common reverse primer; the nucleotide sequences of the specific forward primers are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and the nucleotide sequences of the common reverse primers are shown in SEQ ID NO.5, respectively;

[0010] (2) The size of the PCR amplification product was used to distinguish between the clouded-spotted hawk moth and the litura moth.

[0011] Preferably, step (2) is: if the length of the amplified product fragment is greater than 250 bp, the insect to be identified is the clouded line moth; if the length of the amplified product fragment is less than 250 bp, the insect to be identified is the litura moth.

[0012] Preferably, step (2) is: if the length of the amplified product fragment is 340 bp, the insect to be identified is the clouded line moth; if the length of the amplified product fragment is 197 bp, the insect to be identified is the litura moth.

[0013] Preferably, the PCR amplification reaction system is:

[0014] Green Taq Mix 10μL, 10ng / μL genomic DNA 1μL, 10μmol / L forward primer / reverse primer 0.5μL each, ddH2O 8.0μL.

[0015] Preferably, the PCR reaction program is: 95°C for 3 min; 95°C for 15 sec, 55°C for 15 sec, 72°C for 2 min, 25 cycles; 72°C for 5 min.

[0016] In a fourth aspect, the present invention provides a gene sequence specific to the clouded-spotted slash moth, the gene sequence being as shown in SEQ ID NO.6, or the gene sequence being the reverse sequence of the sequence shown in SEQ ID NO.6, or the gene sequence being the complementary sequence of the sequence shown in SEQ ID NO.6.

[0017] In a fifth aspect, the present invention provides a slash moth-specific gene sequence, the gene sequence is as shown in SEQ ID NO.7, or the gene sequence is the reverse sequence of the sequence shown in SEQ ID NO.7, or the gene sequence is the complementary sequence of the sequence shown in SEQ ID NO.7.

[0018] In a sixth aspect, the present invention provides uses of the above-mentioned specific gene sequence, the uses comprising:

[0019] Used to identify the clouded slash moth and the striped hawk moth, or used to design primers to identify the clouded slash moth and the striped hawk moth.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a PCR rapid identification method for the clouded slash moth and the litura hawk moth, which uses three specific primers for PCR amplification, and can quickly and accurately identify the clouded slash moth and the litura hawk moth according to the size of the amplified product. The method does not require complex sequencing operations, greatly simplifies the identification process, and saves time and cost. At the same time, the method has high specificity and accuracy, can effectively avoid misjudgment caused by morphological similarities, and provides reliable technical support for related research and practical applications. In addition, the operation is simple, the technical requirements for operators are relatively low, and it is easy to promote and apply. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 :Comparative analysis of specific sequences of Manduca sphenoptera and Sexta sphenoptera.

[0023] Figure 2 :Agarose electrophoresis of PCR products of S. sphenoptera and S. litura. M: DL2000. Lanes 1, 4, and 5 are genomic DNA of S. sphenoptera, and lanes 2, 3, and 6 are genomic DNA of S. litura. Primers for lanes 1-2: UNPrimer and X340; primers for lanes 3-4: UNPrimer and W197; primers for lanes 5-6: a mixture of 3 primers. DETAILED DESCRIPTION

[0024] In order to better understand the technical content of the present invention, specific embodiments are provided below to further illustrate the present invention.

[0025] Unless otherwise specified, the experimental methods used in the embodiments of the present invention are all conventional methods.

[0026] Unless otherwise specified, the materials, reagents, etc. used in the embodiments of the present invention can be obtained from commercial sources.

[0027] Example 1 A PCR rapid identification method for Manduca sphenopsinae and Manduca litura

[0028] application The genomic DNA of S. sphenanthera and S. litura were extracted by using Insect DNA Kit (D0926-02), and PCR amplification was performed using primers ITS5.8S and ITS18S (see Table 1). The amplified DNA fragments were recovered by agarose gel electrophoresis and ligated into the pMD 18-T vector. After sequencing analysis, the specific sequences of S. sphenanthera and S. litura were obtained, with lengths of 677 bp (SEQ ID NO.6) and 667 bp (SEQ ID NO.7), respectively. Figure 1 Three primers were designed for the specific sequence (including a common primer UNPrimer and two specific primers X340 and W197 (see Table 1).

[0029] Table 1 Primer sequences

[0030] Species Primer name Primer sequences PCR product size SEQ ID NO ITS18S TACACACCGCCCGTCGCTACTA 1 ITS5.8S ATGTGCGTTCRAAATGTCGATGTTCA 2 Clouded Slash Moth X340 GTTATTAACGAACGCATCTAACAT 340bp 3 Hawkmoth W197 CGATACTACTGAACTACGCATAATA 197bp 4 UNprimer ATGATTTAGTGAGGTCTTCGGA 5

[0031] PCR amplification was performed using the public primer UNPrimer, the specific primers X340 (M. sphenodon) and W197 (M. sphenodon), and the genomic DNA of M. sphenodon and M. sphenodon as templates, respectively. PCR reaction system: Green TaqMix (2×, Novazon, P131-01) 10μL, genomic DNA (10ng / μL) 1μL, forward primer / reverse primer (10μmol / L) 0.5μL each; ddH2O 8.0μL. PCR reaction program: 95℃3min; 95℃15sec, 55℃15sec, 72℃2min, 25 cycles; 72℃, 5min. PCR amplification products were detected by electrophoresis.

[0032] After electrophoresis, only the specific region of a certain size was amplified in the corresponding species, among which the size of the specific region of the clouded-spotted slash moth was 340 bp ( Figure 2 , lane 1), and that of Manduca litura is 197 bp ( Figure 2 , lane 3). When the common primer UNPrimer and the two species-specific primers X340 and W197 were mixed together, PCR reactions were performed using the genomic DNA of the clouded-spotted hawk moth and the hawk moth as templates. After electrophoresis detection, only the specific region of the corresponding size was amplified in the corresponding species, and the specific region of the corresponding size of the other species was not amplified ( Figure 2 , lanes 5-6).

[0033] Since the amplified fragment length of the specific region of the clouded slash moth is 340 bp, while that of the litura moth is 197 bp, when agarose gel electrophoresis is performed using a DNA molecular weight marker (DL 2000), it is easy to compare with the 250 bp band (the second smallest molecular weight band). If the fragment length is greater than 250 bp, it is a clouded slash moth, and if it is less than 250 bp, it is a litura moth ( Figure 2 ).

[0034] In summary, the appearance of the clouded slash moth and the litura moth is very similar and difficult to distinguish. The three primers, UNPrimer, X340 and W197, were used at the same time to PCR amplify the genomic DNA of the clouded slash moth and the litura moth. The PCR products were compared with the 250bp band of the DNA molecular weight marker (DL 2000) by agarose gel electrophoresis. If the band is larger than 250bp, it is the clouded slash moth, and if it is less than 250bp, it is the litura moth. No further sequencing is required, and only one PCR is needed to complete the identification of the clouded slash moth and the litura moth.

[0035] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer for rapid identification of Manduca sphenopsinae and Manduca liturae, characterized in that: It comprises two specific forward primers and a common reverse primer, the nucleotide sequences of the specific forward primers are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively, and the nucleotide sequences of the common reverse primers are shown as SEQ ID NO.3 respectively.

2. A PCR detection kit, characterized in that: Containing the primer according to claim 1.

3. Use of the primers according to claim 1 or the kit according to claim 2 in the rapid identification of the clouded-spotted slash moth and the black-spotted moth.

4. A PCR rapid identification method for Manduca sphenopsinae and Manduca liturae, characterized in that: The following steps are involved: (1) Using the genomic DNA of the insect to be identified as a template, PCR amplification is performed using two specific forward primers and a common reverse primer; the nucleotide sequences of the specific forward primers are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and the nucleotide sequences of the common reverse primers are shown in SEQ ID NO.5, respectively; (2) The size of the PCR amplification product was used to distinguish between the clouded-spotted hawk moth and the litura moth.

5. The PCR rapid identification method of Manduca sphenopsinae and Manduca litura according to claim 1, characterized in that: Step (2) is: if the length of the amplified product fragment is greater than 250 bp, the insect to be identified is the clouded-spotted slash moth; if the length of the amplified product fragment is less than 250 bp, the insect to be identified is the litura moth.

6. The PCR rapid identification method of Manduca sphenopsinae and Manduca liturae according to claim 1, characterized in that: Step (2) is: if the length of the amplified product fragment is 340 bp, the insect to be identified is the clouded-spotted slash moth; if the length of the amplified product fragment is 197 bp, the insect to be identified is the litura moth.

7. The PCR rapid identification method of Manduca sphenopsinae and Manduca litura according to claim 1, characterized in that: The PCR amplification reaction system was: Green Taq Mix 10 μL, 10 ng / μL genomic DNA 1 μL, 10 μmol / L forward primer / reverse primer 0.5 μL each, ddH2O 8.0 μL; PCR reaction program: 95°C for 3 min; 95°C for 15 sec, 55°C for 15 sec, 72°C for 2 min, 25 cycles; 72°C for 5 min.

8. A gene sequence specific to the clouded-spotted hawkmoth, characterized in that: The gene sequence is as shown in SEQ ID NO.6, or the gene sequence is the reverse sequence of the sequence shown in SEQ ID NO.6, or the gene sequence is the complementary sequence of the sequence shown in SEQ ID NO.

6.

9. A gene sequence specific to Scimitar moth, characterized in that: The gene sequence is as shown in SEQ ID NO.7, or the gene sequence is the reverse sequence of the sequence shown in SEQ ID NO.7, or the gene sequence is the complementary sequence of the sequence shown in SEQ ID NO.

7.

10. Use of the gene sequence according to claim 8 and claim 9, characterized in that: The uses include: Used to identify the clouded slash moth and the striped hawk moth, or used to design primers to identify the clouded slash moth and the striped hawk moth.

Images