Effect of LRRC46 gene in quantity regulation and control of bovine sinus follicles and application of LRRC46 gene

Abstract

The invention discloses an effect of an LRRC46 gene in regulation and control of the number of sinus follicles of cattle and application of the LRRC46 gene, and belongs to the technical field of production of in-vitro embryos of cattle. The invention discloses that the LRRC46 gene plays a role in regulating and controlling the quantity of the sinus follicles of the cattle for the first time, the expression levels of the LRRC46 gene and the cattle with the quantity of the sinus follicles are remarkably different, and the LRRC46 gene is in positive correlation with the quantity of the sinus follicles of the cattle; early prediction of the number of the bovine sinus follicles can be achieved by detecting the expression quantity of the LRRC46 gene, and the method is simple, easy to operate, low in cost, non-invasive or minimally invasive and has important significance on improvement of OPU efficiency and reduction of cost.

Description

Technical Field

[0001] The present invention relates to the technical field of bovine in vitro embryo production, and more particularly to LRRC46 The role of genes in the regulation of bovine antral follicle number and its application. Background Art

[0002] In Vitro Produced Embryo (IVP) is a technology that uses artificially controlled conditions to allow cattle eggs and sperm to combine in vitro and develop into embryos. Through the screening and transplantation of embryos, high-quality genetic embryos can be selected for transplantation, further improving the genetic quality of offspring. It is an important means of genetic improvement and efficient reproduction of cattle; it can produce a large number of high-quality embryos in a relatively short period of time, accelerating the process of breed improvement and breeding; it can also be combined with sex control technology to significantly increase the proportion of offspring of good-quality cows and realize large-scale production of embryos with controllable traits; in addition, through in vitro fertilization and embryo culture, the reproduction process can be controlled under laboratory conditions to improve reproduction efficiency and success rate.

[0003] Bovine in vitro embryo production specifically includes the following steps: 1) Collect oocytes; 2) Culture the oocytes in a culture medium with specific ingredients until the oocytes mature; 3) Thaw the frozen semen and select high-quality sperm after a series of treatments; 4) Co-incubate the obtained high-quality sperm with oocytes in a specific culture medium to complete in vitro fertilization; 5) Select high-quality embryos and transplant them into the uterus of the recipient cow to achieve pregnancy.

[0004] At present, the main ways of collecting oocytes include the following three: 1) Slaughterhouse ovary collection method, which involves removing ovaries from slaughtered cows, washing them with saline, and transporting them to the laboratory in a warm state. Follicles with a diameter of 3 to 10 mm on the surface of the ovaries are aspirated by a syringe or a vacuum pump; 2) In vivo egg collection (OPU) technology, which involves puncturing the ovarian follicles through the vaginal wall with the help of an ultrasound detector or laparoscope, and using an egg collection needle to aspirate follicular fluid and separate oocytes; 3) Superovulation fallopian tube flushing method, which involves injecting gonadotropins to induce cows to secrete more eggs. At a specific time after ovulation, the fallopian tubes are flushed surgically or non-surgically to collect eggs.

[0005] The ovary collection method at slaughterhouses is low-cost, but it is not possible to select high-quality donors; the oviduct flushing method after superovulation is complex and costly, so it is rarely used. The oocytes provided by the OPU method are not only significantly better than the oocytes from slaughterhouses, but can also continuously collect eggs from cows that have poor superovulation response, pregnant cows, old cows, and calves that have not reached breeding age (7-10 months old), shortening the generation interval by more than 1 year.

[0006] Antral follicles are the main operation objects of OPU. Antral follicles are the key stage before the development of oocytes to maturity, and their diameter is usually 2~6mm. However, the number of antral follicles varies significantly between individual donor cows, and the number of antral follicles in donor cows directly affects the efficiency of OPU. At present, the screening of donor cows with a large number of antral follicles relies on ultrasonic detection of antral follicle count (AFC), which is costly and cannot achieve early prediction. Developing a non-invasive or minimally invasive method to screen OPU donor cows with a large number of antral follicles is of great practical significance for improving OPU efficiency and reducing costs. Summary of the invention

[0007] The object of the present invention is to provide LRRC46 The role of genes in regulating the number of bovine antral follicles and their application, in order to provide a gene significantly correlated with the number of bovine antral follicles, to achieve early prediction, non-invasive or minimally invasive screening of OPU donor cows with a large number of antral follicles, and contribute to improving OPU efficiency and reducing costs.

[0008] To achieve the above object, the present invention provides LRRC46 The application of the gene as a target for detecting the number of bovine antral follicles is to extract blood RNA from the bovine to be tested, reverse transcribe it into cDNA, use the cDNA as a template, and perform qPCR with the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to detect LRRC46 The expression level of the gene, LRRC46 The higher the expression level of the gene, the more antral follicles the cows have.

[0009] Preferably, LRRC46 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0010] One as mentioned above LRRC46 Application of gene in live oocyte collection of cattle, the LRRC46 Cows with high gene expression have greater egg donation potential than cows with low gene expression; LRRC46 The gene expression level determines the number of antral follicles in the donor cow, and then selects the donor cow with high antral follicle number; LRRC46 The upstream primer sequence of the gene expression level is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0011] A method of utilizing the above LRRC46 The method for detecting the potential of cows to donate eggs is to extract blood RNA from the cow to be tested, and reverse transcribe it into cDNA using a kit, and use the cDNA as a template and the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to perform qPCR to detect LRRC46 The expression level of the gene, the higher the expression level, the better the egg donation potential of the tested cow.

[0012] Preferably, the qPCR system is: 2ʹ FastReal qPCR PreMix (SYBR Green) 10 μL, 10 μM forward primer 0.6 μL, 10 μM reverse primer 0.6 μL, cDNA 100 ng, RNase-free ddH 2 Add 3% HO to 20 μL.

[0013] Preferably, the program for qPCR is: 95°C, 15 min; 95°C, 10 s, 55°C, 20 s, 72°C, 20 s, 40 cycles.

[0014] Therefore, the present invention provides LRRC46 The role of genes in regulating the number of bovine antral follicles and their application, the specific technical effects are as follows: (1) This invention is disclosed for the first time LRRC46 The gene plays a role in the regulation of antral follicle number in cattle, and the expression level is significantly different between cattle with high antral follicle number and cattle with low antral follicle number. LRRC46 The gene is negatively correlated with the number of bovine antral follicles; (2) Pass the test LRRC46 The gene expression level can realize the early prediction of the number of bovine antral follicles. The method is simple, easy to operate, low-cost, non-invasive or minimally invasive, and is of great significance to improving OPU efficiency and reducing costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0016] Figure 1 is the statistical result of the average number of follicles per egg collection of cattle in group H and group L in Example 1 of the present invention; Figure 2 is the principal component analysis result in the second embodiment of the present invention; Figure 3 is the heat map result in the second embodiment of the present invention; Figure 4 is the statistical result of differentially expressed genes in Example 2 of the present invention; Figure 5 It is the volcano map of differentially expressed genes in Example 2 of the present invention; Figure 6 is the GO analysis result of the differentially expressed genes in Example 2 of the present invention; Figure 7is the KEGG analysis result of the differentially expressed genes in Example 2 of the present invention; Figure 8 It is the significantly enriched pathway obtained by GO analysis in Example 2 of the present invention; Fig. 9 is a significantly enriched pathway obtained by KEGG analysis in Example 2 of the present invention; Fig.10 is the gene interaction map in Example 2 of the present invention; Fig.11 is the qPCR statistical result in Example 3 of the present invention; Fig.12 These are the qPCR results of the ovaries with three follicles greater than 23 and less than 11 in Example 4 of the present invention. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0018] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0019] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0020] Embodiment 1 Bovine samples with significant differences in the number of antral follicles were obtained as follows: Nine Yanbian yellow cattle (about 4 years old, similar physique, healthy and non-pregnant females) were selected for live egg collection on Mondays and Thursdays of each week starting from April 2023 (live egg collection twice a week) for a total of four weeks. The number of follicles collected each time was counted and recorded, and the average number of follicles for each egg collection of each cow was calculated. The average number of follicles for each egg collection of the 9 cows was added and averaged, and the average number of follicles for each egg collection of the 9 cows was 13.88. The cows with an average number of follicles per egg collection higher than 13.88 were recorded as Group H, and the cows with an average number of follicles per egg collection lower than 13.88 were recorded as Group L. The data of 9 cows in total were obtained, as shown in Table 1. The statistical results of the average number of follicles per egg collection of cows in Group H and Group L are shown in Table 1. Figure 1 As shown, the average number of follicles per egg collection in the H group was 23.90±2.07 (range, 12 to 43, n=4), and the average number of follicles per egg collection in the L group was 11.66±1.87 (range, 4 to 21, n=5). P<0.05.

[0021] Table 1 ;

[0022] Embodiment 2 For the bovine samples with significant differences in the number of antral follicles obtained in Example 1, mixed RNA-seq was performed to search for differentially expressed genes, as follows: The tail vein blood of the cattle in group H and group L was drawn respectively, the tail vein blood of the cattle in group H was mixed, and the tail vein blood of the cattle in group L was mixed, and then RNA-seq was performed separately.

[0023] Using Bos_taurus.ARS-UCD1.2.107 as the reference genome, the obtained RNA-seq data were subjected to principal component analysis (PCA), and the results showed good reproducibility among samples, such as Figure 2 As shown, PCA1 and PCA2 explained 96.12% and 1.85% of the gene expression variation, respectively, indicating that the sample clustering was reasonable and could be used for DEGs identification.

[0024] Heatmap results ( Figure 3 ) showed that the gene expression patterns were similar within the groups but different between the groups. This result is consistent with the results of principal component analysis. The higher the gene expression level, the redder the color. Conversely, the lower the gene expression level, the bluer the color.

[0025] The total differentially expressed genes were screened using DESeq2 software, and the screening criteria were set as follows: p <0.05 and |log2FoldChange|>2. A total of 280 genes were significantly differentially expressed between the low follicle group and the high follicle group ( P <0.05), of which 109 genes were up-regulated and 171 genes were down-regulated significantly. The statistical results of differentially expressed genes are as follows Figure 4 As shown in the figure, the volcano plot of differentially expressed genes is shown in Figure 5 shown.

[0026] GO analysis was performed on the differentially expressed genes obtained, such as Figure 6 As shown, the differentially expressed genes were significantly enriched in multiple biological processes, molecular functions, and cellular components related to cell apoptosis and cell proliferation.

[0027] KEGG analysis was performed on the differentially expressed genes obtained, such as Figure 7As shown, these differentially expressed genes were significantly involved in a series of key biological pathways, such as NF-kappa B signaling pathway, Natural killer cell mediated cytotoxicity, PI3K-AKT signaling pathway, etc. These pathways are closely related to the signal transduction mechanisms of cell apoptosis and proliferation.

[0028] Both GO and KEGG analyses showed that differentially expressed genes were enriched in pathways related to cell apoptosis or proliferation. The significantly enriched pathways obtained by GO analysis were as follows: Figure 8 As shown in Figure 2, the significantly enriched pathways obtained by KEGG analysis are as follows Fig. 9 As shown in Figure 2. The GO terms of several significant genes are as follows Figure 8 As shown, the KEGG pathway is Fig. 9 The gene interaction map is shown in Fig.10 shown.

[0029] LRRC46 The genes are differentially expressed genes between the high antral follicle count group and the low antral follicle count group. LRRC46 The expression level of the gene was significantly negatively correlated with the number of bovine follicles: LRRC46 The gene was significantly up-regulated in the group of cows with high antral follicle numbers and significantly down-regulated in the group of cows with low antral follicle numbers.

[0030] Embodiment 3 The qPCR and Sanger sequencing methods were used to investigate LRRC46 The relative expression of genes in high and low antral follicle count cattle is as follows: Obtained from NCBI LRRC46 Primers were designed based on the CDS sequence of the gene (as shown in SEQ ID NO.1), the upstream primer sequence was shown in SEQ ID NO.2, and the downstream primer sequence was shown in SEQ ID NO.3.

[0031] SEQ ID NO.1: ATGCCTGGAGCTAAACTTGCCCAGAGTCCAGAGGAAATCAGTGGCGTGTGCATTACTGAAGCCCTCATCACTAGGCGGAACTTGGCCTTCCCTGAAGATGAGGATCTGTCAGAGAAGATGTTCCACACGCTTGCTGAACTGCAGACTGTTCGCCTGGACCGGGAGGGAATTACCACTATCAGGAACTTAGAGGGCCTCCAGAATCTTCACAGCCTCTATCTGCAAGGGAACAAGATTCAGAGAATTGAGAACCTGGCCTGCGTCCCCTCCTTACGCTTCCTGTCTTTGGCAGGAAACCAAATTAGGCAAGTGGAAAACCTCCGTGACCTCCCCCACCTCCAGTTTCTGGACCTTTCTGAGAACCTGATAGAAACGCTGAAGCTGGATGAATTCCCCGAGAGCCTTCTCATCCTCAACCTGACTGGAAACAGCTGCACCAACCAGGATGGCTACAGGAAGCTGTTGACAGAAGCCCTGCCACTGCTCCTAGACCTGGACGGGCAGCCTGTGGCAGAGCGCTGGACCTCGGACGAGGAGGATACAGCCTTGAGTGATGAGGATGAGGAGTTCCCAGAGCTCAGAGGCCCATTCTGCTCAGAACGAGGCTTCCTCAAGGAGCTGGAGCAGGGAATGAGCAGGCACCGGGAGCTCAGGCAGCAGACAGCCCTGCTGGAGCACCAGCTGAGGGTGGAGACTCAGCCCACCCTCACAGACCTGCCCCCGCTGCCGGGGGCGCCCATGGCTGGGGACAGCAGCCCTTCCGTCACCCCCACACAAGAGAAAGAGACAACCCCGGAGCCCGCTTCCTTGCCAGAGGCCTCCTCTACCACCAAGAGACTGTGCCCTCTGGCTCCCAGGGGCCAGCAAAGCACTATGCAGGCAAGGAAGGGGGCCAGAGCGGCCACAGCCCCCAAGGCCTCTCTGGCTGGGGCCCCCAGCACAACCAAAACTGTGACCAAAAAAATCAAGAAGTGA SEQ ID NO.2: CAGAGGAAATCAGTGGCGTGTG SEQ ID NO.3: AGCAAGCGTGTGGAACATCTTC The blood serum RNA of the two donors H1 and L5 in Example 1 was extracted by the Trizol method, and the RNA that met the quality requirements was reverse transcribed into cDNA using a kit. The reverse transcribed cDNA was used as a template and the qPCR reaction was performed using the system shown in Table 2. The reaction program was: 95°C, 15min; 95°C, 10s, 55°C, 20s, 72°C, 20s, and 40 cycles.

[0032] Table 2 ;

[0033] The results are as follows Fig.11 As shown, two cows LRRC46 The expression levels of genes were significantly different.

[0034] Embodiment 4 The ovaries of Yanbian yellow cattle provided by the slaughterhouse were observed by a portable B-ultrasound device, and three ovaries with more than 23 follicles (respectively recorded as H1, H2, and H3) and three ovaries with less than 11 follicles (respectively recorded as L1, L2, and L3) were selected. The ovarian tissue RNA was extracted by the Trizol method, and the RNA that met the quality requirements was reverse transcribed into cDNA using a kit. The reverse transcribed cDNA was used as a template and the qPCR reaction was carried out using the system shown in Table 2. The reaction program was: 95℃, 15min; 95℃, 10s, 55℃, 20s, 72℃, 20s, and 40 cycles.

[0035] The results are as follows Fig.12 As shown, LRRC46 The expression level of the gene in the ovaries with more than 23 follicles is always greater than the expression level in the ovaries with less than 11 follicles, and the difference is significant. LRRC46 The gene plays a role in the regulation of antral follicle number in cattle, and the expression level is significantly different between cattle with high antral follicle number and cattle with low antral follicle number. LRRC46 Genes negatively correlated with the number of bovine antral follicles; detected by LRRC46 The gene expression level can realize the early prediction of the number of bovine antral follicles. The method is simple, easy to operate, low-cost, non-invasive or minimally invasive, and is of great significance to improving OPU efficiency and reducing costs.

[0036] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. LRRC46 The use of a gene as a target for detecting the number of bovine antral follicles is characterized by: The blood RNA of the tested cattle was extracted and reverse transcribed into cDNA. The cDNA was used as a template and qPCR was performed with the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to detect LRRC46 The expression level of the gene, LRRC46 The higher the expression level of the gene, the more antral follicles the cows have.

2. according to claim 1 LRRC46 The use of a gene as a target for detecting the number of bovine antral follicles is characterized by: LRRC46 The CDS sequence of the gene is shown in SEQ ID NO.

1.

3. A method as claimed in claim 2 LRRC46 The application of genes in live oocyte collection of cattle is characterized by: Said LRRC46 Cows with high gene expression have greater egg donation potential than cows with low gene expression; LRRC46 The gene expression level determines the number of antral follicles in the donor cow, and then selects the donor cow with high antral follicle number; LRRC46 The upstream primer sequence of the gene expression level is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.

3.

4. A method of using the method described in claim 2 LRRC46 A method for genetically detecting the potential of bovine egg donors, characterized in that: The blood RNA of the tested cattle was extracted and reverse transcribed into cDNA using a kit. The cDNA was used as a template and qPCR was performed with the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to detect LRRC46 The expression level of the gene, the higher the expression level, the better the egg donation potential of the tested cow.

5. A method according to claim 4 LRRC46 A method for genetically detecting the potential of bovine egg donors, characterized in that: The qPCR system was as follows: 2ʹ FastReal qPCR PreMix (SYBR Green) 10 μL, 10 μM forward primer 0.6 μL, 10 μM reverse primer 0.6 μL, cDNA 100 ng, and RNase-free ddH2O to 20 μL.

6. A method according to claim 4 LRRC46 A method for genetically detecting the potential of bovine egg donors, characterized in that: The qPCR program was: 95°C, 15 min; 95°C, 10 s, 55°C, 20 s, 72°C, 20 s, 40 cycles.

Images