Nucleic acid sequence for detecting corn stem rot and detection method

Abstract

The invention belongs to the technical field of corn molecular breeding and biology, and particularly relates to a nucleic acid sequence for detecting corn stem rot and a detection method. The application can be the application of a substance for detecting the polymorphism or genotype of an SNP1 site and an SNP2 site in a corn genome in identifying the corn stem rot, and the SNP1 site is the 200th nucleotide of SEQ ID No.7 and is A or G; and the site SNP2 is the 202 nucleotide of SEQ ID No.8, and is A or G. The method can be used for breeding corn stem rot resistant germplasm, and can also be used for identifying the genotype of a to-be-detected corn material in a high-throughput and accurate manner to screen out a stem rot resistant material.

Description

Technical Field

[0001] The invention belongs to the field of corn molecular breeding and biotechnology, and particularly relates to a nucleic acid sequence and a detection method for detecting corn stalk rot. Background Art

[0002] Corn (Zea mays L.) is the main food and feed crop in my country, as well as an important industrial raw material and energy plant. It plays a pivotal role in the national economy and agricultural production. Corn stalk rot is a global soil-borne disease that seriously harms corn production. It mainly causes premature aging of plants and insufficient grain filling, resulting in reduced yields. The stalks of diseased plants are prone to breakage, which restricts the mechanized harvesting of corn in my country. The dominant pathogens that cause corn stalk rot in my country are mainly Fusarium graminearum and Pythium inflatum. Cultivating and promoting stalk rot-resistant varieties is the most economical and effective way to prevent and control it.

[0003] Since stalk rot is greatly affected by pathogens, environment and genotype, and it is difficult to find high resistance and multi-resistance sources, corn stalk rot is becoming more and more serious. At present, most of the resistance loci that have been located have low effects, and few disease resistance genes have been cloned. Further exploration of maize stalk rot resistance QTLs and disease resistance genes, and development of molecular markers closely linked to QTLs, will provide strong support for molecular breeding of stalk rot resistance to aggregate multiple resistance genes, and is expected to improve maize stalk rot resistance. KASP markers do not need to be typed according to the size of DNA fragments, and can get rid of the traditional gel electrophoresis, which is a relatively cumbersome, low-throughput, and expensive detection method, and is more suitable for the rapidly developing high-throughput molecular detection platform at this stage. Therefore, the development of low-cost KASP molecular markers for maize resistance to Fusarium graminearum stalk rot QTLs suitable for high-throughput molecular detection platforms is of great significance for popularizing the application of molecular marker technology and improving the efficiency and level of maize stalk rot resistance breeding in my country. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to identify or assist in identifying corn stalk rot resistance or how to carry out corn breeding. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides any of the following applications of a substance for detecting the polymorphism or genotype of a SNP site in a corn genome: A1) identifying or assisting in identifying corn stalk rot resistance;

[0007] A2) screening or breeding maize lines, strains or varieties resistant to stalk rot;

[0008] A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot;

[0009] A4) Corn breeding;

[0010] A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot;

[0011] A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to stalk rot;

[0012] A7) preparing a product for screening or breeding corn lines, strains or varieties susceptible to stalk rot;

[0013] A8) preparing corn breeding products;

[0014] The SNP site is any of the following:

[0015] P1, the SNP sites are SNP1 site and SNP2 site, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.9 in the sequence list, which is A or G; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.16 in the sequence list, which is A or G;

[0016] P2, the SNP site is the SNP1 site;

[0017] P3. The SNP site is the SNP2 site.

[0018] The SNP1 is located on chromosome 5 of maize, namely B73 RefGen_V3 ( https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3 ) is located at position 178607304, hereinafter referred to as Ks7, and the SNP2 is located at chromosome 5 of maize, namely B73 RefGen_V3 ( https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3 ) is the 182486805th, and is subsequently referred to as Ks8.1.

[0019] Those skilled in the art know that SEQ ID No.7 is composed of the nucleotide sequence of the SNP1 site (the 200th nucleotide of SEQ ID No.7) and its vicinity, and the amount of nucleotide sequence near the SNP site should not be used as a limiting factor for the scope of protection of the present invention. It can be 49bp (SEQ ID No.9), 59bp (SEQ ID No.10), 69bp (SEQID No.11), 79bp (SEQ ID No.12), 89bp (SEQ ID No.13), 99bp (SEQ ID No.14), 149bp (SEQID No.15), 250bp, 300bp, 500bp, 1000bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of the SNP on chromosome 5 of the corn genome. It is composed of the nucleotide sequence of the SNP1 site (nucleotide No. 202 of SEQ ID No. 8) and its vicinity. The amount of nucleotide sequence near the SNP site should not be used as a limiting factor for the scope of protection of the present invention. It can be 49bp (SEQ ID No. 16), 59bp (SEQ ID No. 17), 69bp (SEQ ID No. 18), 79bp (SEQ ID No. 19), 89bp (SEQ ID No. 20), 99bp (SEQ ID No. 21), 149bp (SEQ ID No. 22), 250bp, 300bp, 500bp, 1000bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of SNP on chromosome 5 of the corn genome.

[0020] Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence as shown in SEQ ID No.10; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence as shown in SEQ ID No.17. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence as shown in SEQ ID No.11; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence as shown in SEQ ID No.18. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence as shown in SEQ ID No.12; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence as shown in SEQ ID No.19. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence as shown in SEQ ID No.13; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence as shown in SEQ ID No.20. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence as shown in SEQ ID No.14; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence as shown in SEQ ID No.21. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence as shown in SEQ ID No.15; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence as shown in SEQ ID No.22. Furthermore, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 200 of the sequence shown in SEQ ID No.7; and the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 202 of the sequence shown in SEQ ID No.8.

[0021] The front and back mentioned herein should be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0022] The identification or auxiliary identification of corn stalk rot, or the screening or breeding of corn lines, strains or varieties susceptible to stalk rot described above specifically includes screening out corn plants with a SNP site Ks7 genotype of GG and a SNP site Ks8.1 genotype of AA. The screening or breeding of corn lines, strains or varieties resistant to stalk rot specifically includes screening out corn plants with a SNP site Ks7 genotype of AA and a SNP site Ks8.1 genotype of GG, or screening out corn plants with a SNP site Ks7 genotype of AA or a SNP site Ks8.1 genotype of GG.

[0023] The present invention also provides a method for identifying or assisting in identifying corn stalk rot resistance, the method being any one of the following:

[0024] M1. The method comprises detecting the genotypes of the SNP1 site and the SNP2 site in the tested corn genome, and identifying or assisting in identifying the corn stalk rot resistance according to the genotypes, wherein the SNP1 site is a site on the chromosome 5 of corn, and the nucleotide type thereof is A or G, which is the 50th nucleotide of SEQ ID No.9 in the sequence list; the SNP2 site is a site on the chromosome 5 of corn, and the nucleotide type thereof is A or G, which is the 50th nucleotide of SEQ ID No.16 in the sequence list;

[0025] M2. The method comprises detecting the genotype of the SNP1 site in the corn genome to be tested, and identifying or assisting in identifying corn stalk rot resistance based on the genotype.

[0026] In the above-mentioned M1 method, according to the genotype identification or auxiliary identification of corn stalk rot resistance, the genotype of the SNP site is AAGG, and the stalk rot resistance of the corn to be tested is higher than that of the corn to be tested whose genotype is GGGG or GGAA at the SNP site, and the stalk rot resistance of the corn to be tested whose genotype is GGGG is higher than that of the corn to be tested whose genotype is GGAA at the SNP site; the genotype of the SNP site is AAGG, which is the homozygous type of the SNP1 site A and the homozygous type of the SNP2 site G, the genotype of the SNP site is GGGG, which is the homozygous type of the SNP1 site G and the homozygous type of the SNP2 site G, and the genotype of the SNP site is GGAA, which is the homozygous type of the SNP1 site G and the homozygous type of the SNP2 site A.

[0027] The present invention also provides a method for corn breeding, which comprises detecting the genotype of the aforementioned SNP site in the corn genome, and selecting corn with the genotype of the SNP site being AAGG as a parent for breeding, wherein the AAGG is a homozygous type in which the SNP1 site is A and the SNP2 site is a homozygous type of G.

[0028] The breeding objectives of the method include breeding corn with stalk rot resistance.

[0029] In the above application or / and method, the substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2 can be used to determine the nucleotide types of the SNP1 and SNP2 sites in the above corn genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0030] The present invention also provides application of the aforementioned substance or method in corn breeding.

[0031] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in a corn genome, wherein the product is the aforementioned substance, and the product is any one of the following:

[0032] C1) Products for detecting single nucleotide polymorphisms or genotypes associated with corn stalk rot resistance;

[0033] C2) Products for identifying or assisting in identifying resistance to corn stalk rot;

[0034] C3) Products used for corn breeding;

[0035] C4) screening or breeding products of corn lines, strains or varieties resistant to corn stalk rot;

[0036] C5) A product of screening or breeding corn lines, strains or varieties susceptible to corn stalk rot.

[0037] In the above products, the substance is the following D1), D2) or D3):

[0038] D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site;

[0039] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0040] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0041] In the above-mentioned applications and methods, the PCR primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0042] In the above applications and methods, the product may be a reagent or a kit or a system, and the system may include a combination product of a reagent or a kit, an instrument and an analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader and an online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), and a combination product consisting of PCR primers, PARMS master mix reagents, an online software SNP decoder and a fluorescence quantitative PCR instrument. The product may include the above-mentioned substance for detecting the polymorphism or genotype of the SNP1, SNP2 and / or SNP3 sites in the corn genome.

[0043] The primer combination in the above application or product is F1-1, F1-2, F2-1 and / or F2-2:

[0044] F1-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.1 in the sequence listing, the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.3 in the sequence listing;

[0045] F1-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 179-200 of SEQ ID No.7 in the sequence listing and A at position 200, a single-stranded DNA having a nucleotide sequence of positions 181-200 of SEQ ID No.7 in the sequence listing and G at position 200, and a single-stranded DNA having a nucleotide sequence of positions 228-251 of SEQ ID No.7 in the sequence listing;

[0046] F2-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.4 in the sequence listing, the single-stranded DNA shown in SEQ ID No.5 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.6 in the sequence listing;

[0047] F2-2, a primer set consisting of a single-stranded DNA whose nucleotide sequence is the 178th to 202nd positions of SEQ ID No. 8 in the sequence listing with A at the 202nd position, a single-stranded DNA whose nucleotide sequence is the 178th to 202nd positions of SEQ ID No. 8 in the sequence listing with G at the 202nd position, and a single-stranded DNA shown at the 272th to 291st positions of SEQ ID No. 8 in the sequence listing.

[0048] The present invention also provides application of the above product in corn breeding.

[0049] The present invention also provides a DNA molecule, wherein the DNA molecule is any one of the following:

[0050] N1) The nucleotide sequence is SEQ ID No. 7 in the sequence listing or the DNA molecule of positions 179 to 251 of SEQ ID No. 7 or positions 181 to 251 of SEQ ID No. 7;

[0051] N2) the nucleotide sequence is SEQ ID No. 8 in the sequence listing or the DNA molecule at positions 178 to 291 of SEQ ID No. 8;

[0052] N3) A combination consisting of N1) and N2).

[0053] The present invention also provides the use of the aforementioned DNA molecule in any of the following:

[0054] A1) Identify or assist in identifying resistance to corn stalk rot;

[0055] A2) screening or breeding maize lines, strains or varieties resistant to stalk rot;

[0056] A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot;

[0057] A4) Corn breeding;

[0058] A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot;

[0059] A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to corn stalk rot;

[0060] A7) preparing a product for screening or breeding corn strains, lines or varieties susceptible to corn stalk rot;

[0061] A8) Prepare corn breeding products.

[0062] The SNP sites provided by the present invention can be used to identify or assist in identifying corn stalk rot resistance or for corn breeding. In breeding stalk rot-resistant corn, it is best to select corn with a SNP1 site genotype of AA and a SNP2 site genotype of GG, or select corn with a SNP1 site genotype of AA or a SNP2 site genotype of GG as parents for breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 This is the QTL location for the disease classification of Fusarium graminearum stem rot under single environment and multi-environment joint analysis conditions; in the target QTL location result diagram, the lines represent the QTL location results of Fusarium graminearum stem rot-related traits on chromosome 5 of maize under different environments; the X-axis represents the genetic map position in cM; the Y-axis represents the LOD value. In the additive effect analysis of QTL, the lines represent the additive effect values ​​of different QTLs; the X-axis represents the genetic map position in cM; the Y-axis represents the additive effect value, and the positive and negative values ​​represent the direction of action.

[0064] Figure 2 The effect verification and fine positioning of the target QTL; (A) QTL effect verification; (B) QTL fine positioning; (C) DSI distribution of heterozygous individual segregating progeny. The recombinant progeny verification method was used for QTL effect verification and fine positioning, and the t test was used to analyze whether there was a difference in DSI between the homozygous progeny of the disease-resistant allele and the homozygous progeny of the disease-susceptible allele of each recombinant individual. If there was a significant difference in DSI between the two groups of genotypes (P<0.05), it was inferred that the parental recombinant individual carried the disease-resistant gene, represented by R; on the contrary, if there was no significant difference between the two groups of genotypes (P>0.05), it was inferred that the parental recombinant individual did not carry the disease-resistant gene, represented by S. The black rectangle represents the homozygous disease-resistant allele segment; the white rectangle represents the homozygous disease-susceptible allele segment; and the gray rectangle represents the heterozygous allele segment. The molecular markers are the markers used in the analysis of the results. The bar graph represents the DSI distribution of plants with different genotypes. “*” indicates P<0.05, “**” indicates P<0.01, and “***” indicates P<0.001. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0066] Fusarium graminearum: recorded in the non-patent document "Li Yaling, Long Shusheng, Ma Bingyuan. Comparative test of cultivation characteristics of Fusarium graminearum [J]. Shaanxi Agricultural Science. 1989 (4): 36-37", the public can obtain it from Northwest Agriculture and Forestry University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. Disease-resistant parent inbred line KA105 (abbreviated as KA105): recorded in the non-patent document "Wang Boxin, Wang Yahui, Chen Pengfei, Liu Xudongyu, Feng Zhiqian, Hao Yinchuan, Zhang Renhe, Zhang Xinghua, Xue Jiquan. Analysis of combining ability of maize inbred lines derived from Shaanxi A group and Shaanxi B group under different density conditions [J]. Acta Agronomica Sinica. 2017, 43 (9): 1328-1336", the public can obtain it from Northwest Agriculture and Forestry University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. Susceptible parent inbred line KB204 (KB204 for short): recorded in the non-patent document "Tian Xiaokang. Evaluation and association analysis of lodging resistance of maize inbred lines bred in Shaanxi A group and Shaanxi B group [D]. Northwest A&F University. 2020", the public can obtain it from Northwest A&F University. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. RIL family: The recombinant inbred line is produced by hybridizing the disease-resistant inbred line KA105 and the disease-susceptible inbred line KB204 to produce an F2 population, which is continuously selfed to the F7-8 generation through single seed transmission to form an F 7:8 Recombinant Inbred Line (RIL) population, totaling 240 copies.

[0067] Population 1: includes the disease-resistant inbred line KA105, the disease-susceptible inbred line KB204 and the RIL family. Detailed information is as follows:

[0068] Table 1 RIL pedigrees (240 copies)

[0069]

[0070]

[0071]

[0072] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources. The following examples use Statistics Analysis System (SAS) 9.2 statistical software to process the data, and the experimental results are expressed as BLUP values. One-way ANOVA test is used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) and P < 0.001 (***) indicate a very significant difference.

[0073] Example 1: Establishment of a method for detecting corn stalk rot resistance

[0074] 1. Convert SNP markers to KASP markers and design primer sets for detecting the markers

[0075] The two SNP markers identified in Example 3 are converted into KASP markers for use in molecular marker-assisted selection breeding. The primer set for detecting KASP markers based on KASP technology is the KASP primer set, including a KASP primer pair for SNP1 and a KASP primer pair for SNP2.

[0076] The KASP primer pair of SNP1 includes two upstream primers (primer Ks7-X and primer Ks7-Y) and one downstream primer (primer Ks7-R) of SNP1. SNP1 is the 200th nucleotide of the DNA molecule shown in SEQ ID No. 7 of the sequence list located in the corn genome. Primer Ks7-X is a primer with a FAM fluorescent label sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks7-R amplifies the fragment of SNP1 with A (corresponding to positions 179-251 of SEQ ID No.7, and the 200th nucleotide is A), and the fluorescent signal of the FAM group can be read by an enzyme reader or a fluorescent quantitative PCR instrument; Primer Ks7-Y is a primer with a HEX fluorescent label sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks7-R amplifies the fragment of SNP1 with G (corresponding to positions 181-251 of SEQ ID No.7, and the 200th nucleotide is G), and the fluorescent signal of the HEX group can be read by an enzyme reader or a fluorescent quantitative PCR instrument. The KASP primer pair of SNP2 includes two upstream primers (primer Ks8.1-X and primer Ks8.1-Y) and one downstream primer (primer Ks8.1-R) of SNP2. SNP2 is the 202nd base of the DNA molecule shown in SEQ ID No. 8 in the sequence list located in the corn genome. Primer Ks8.1-X is a primer with a FAM fluorescent label sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks8.1-R amplifies the fragment of SNP2 with A (corresponding to positions 178-291 of SEQ ID No. 8, and the 202nd nucleotide is A), and the fluorescent signal of the FAM group can be read using an enzyme reader or a fluorescent quantitative PCR instrument; Primer Ks8.1-Y is a primer with a HEX fluorescent label sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks8.1-R amplifies the fragment of SNP2 with G (corresponding to positions 178-291 of SEQ ID No. 8, and the 202nd nucleotide is G), and the fluorescent signal of the HEX group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0077] Table 2 Primers of KASP markers for QTL effect verification

[0078]

[0079]

[0080] Note: Lowercase letters gaaggtgaccaagttcatgct are the specific fluorescent tag sequence FAM; lowercase letters gaaggtcggagtcaacggatt are the specific fluorescent tag sequence HEX.

[0081] 2. Detection Method

[0082] 1. DNA extraction

[0083] The genomic DNA of the leaves of the corn to be tested is extracted and diluted to obtain a template solution, wherein the DNA concentration in the template solution is 30-40 ng / μL.

[0084] 2. KASP molecular marker detection

[0085] First, dilute the six primers to 100 μM with ddH2O, and then prepare the primer working solution according to the following formula. The primer working solution includes primer working solution 1 and primer working solution 2, which can be used in the following KASP reaction system. Primer working solution 1: primer Ks7-X 12 μL, primer Ks7-Y 12 μL, primer Ks7-R 30 μL, ddH2O 46 μL. Primer working solution 2: primer Ks8.1-X 12 μL, primer Ks8.1-Y 12 μL, primer Ks8.1-R 30 μL, ddH2O 46 μL. KASP reaction system: includes 2 μL HiGeno 2×Probe Mix, 1 μL DNA template (20–50 ng / μL), 0.944 μL ddH2O and 0.056 μL primer working solution.

[0086] KASP was performed on a Bio-Rad T100 Thermal Cycler PCR amplification instrument using the Touch down PCR amplification program. The KASP reaction program was as follows: 94°C pre-denaturation for 15 min, first step amplification reaction, 94°C denaturation for 20 s, 65°C annealing for 60 s, 10 cycles, second step amplification reaction, 94°C denaturation for 20 s, 55°C annealing and extension for 60 s, 38 cycles. A blank control (NTC) was also set up in the experiment in which no template DNA was added to the reaction system, and one or more blank controls were set up for each plate.

[0087] 3. Perform fluorescence scanning.

[0088] The PCR reaction products were scanned and the fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). The SNP typing software KclusterCaller (V 3.4.1.36; LGC Hoddesdon, UK) was used to read the genotype data and perform cluster analysis. The genotype of the FAM allele was X:X, the genotype of the HEX allele was Y:Y, and the heterozygous genotype was X:Y. The FAM excitation wavelength was 485nm and the emission wavelength was 520nm. The HEX excitation wavelength was 535nm and the emission wavelength was 556nm. The system reference fluorescence ROX excitation wavelength was 575nm and the emission wavelength was 610nm.

[0089] If the fluorescence using primer working solution 1 shows only the fluorescence signal of the FAM group, the genotype of Ks7 (i.e., SNP1) of the corn to be tested is AA (i.e., Ks7 is homozygous for A in the corn genome); if it shows only the fluorescence signal of the HEX group, the genotype of Ks7 of the corn to be tested is GG (i.e., Ks7 is homozygous for G in the corn genome); if it shows both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group, the genotype of Ks7 of the corn to be tested is AG (i.e., Ks7 is a heterozygous for A and G in the corn genome). If the fluorescence using primer working solution 2 shows only the fluorescence signal of the FAM group, the Ks8.1 (i.e., SNP2) genotype of the corn to be tested is AA (i.e., Ks8.1 is homozygous for A in the corn genome); if it shows only the fluorescence signal of the HEX group, the genotype of Ks8.1 of the corn to be tested is GG (i.e., Ks8.1 is homozygous for G in the corn genome); if it shows both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group, the genotype of Ks8.1 of the corn to be tested is AG (i.e., Ks8.1 is a heterozygous for A and G in the corn genome).

[0090] It can be seen that the genotype of the corn plant to be tested can be defined according to the following rules:

[0091] AAGG genotype: If the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of the HEX group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is AA and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is GG. AAGG identification accuracy = AAGG genotype plants resistant to stalk rot / AAGG genotype plants × 100%.

[0092] AAAA genotype: If the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of the FAM group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is AA and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is AA. AAAA identification accuracy = AAAA genotype plants resistant to stalk rot / AAAA genotype plants × 100%.

[0093] GGGG genotype: If the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of the HEX group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of the HEX group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is GG and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is GG. GGGG identification accuracy = GGGG genotype plants resistant to stalk rot / GGGG genotype plants × 100%.

[0094] GGAA genotype: If the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of the HEX group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of the FAM group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is GG and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is AA. GGAA identification accuracy = GGAA genotype plants resistant to stalk rot / GGAA genotype plants × 100%.

[0095] Example 2: Detecting corn stalk rot resistance using the method of Example 1

[0096] 1. Practical determination of resistance to corn stalk rot

[0097] 1. Field design

[0098] The parents KA105 and KB204 and their 240 RIL populations (RIL families) were identified for stem rot resistance in Yangling, Shaanxi and Sanyuan, Shaanxi in 2019-2020. The location and year were uniformly defined as the environment, abbreviated as "year + location initials", such as 2019YL. The field experiment adopted an incomplete randomized block design, with 2 replications set in each environment, single-row planting, 4m row length, 0.6m row spacing, and a density of 5500 plants / mu. The field management measures were the same as those for local field corn.

[0099] 2. Pathogen culture

[0100] Cultivation of Fusarium graminearum strains: Inoculate the pathogenic bacteria strains isolated from a single spore onto PDA (Potato Dextrose Agar) medium, and culture them in a constant temperature incubator at 25°C for 5-7 days in the dark. When the mycelium has covered the surface of the medium, cut it into equal parts with the medium and inoculate it into sterilized corn kernel medium to carry out the propagation of Fusarium graminearum inoculum. Cultivation of Fusarium graminearum inoculum: Inoculate the pathogenic bacteria strains isolated from a single spore onto PDA (Potato Dextrose Agar) medium, and culture them in a constant temperature incubator at 25°C for 5-7 days in the dark. When the mycelium has covered the surface of the medium, cut it into equal parts with the medium and inoculate it into sterilized corn kernel medium to carry out the propagation of Fusarium graminearum inoculum. Cultivation of Fusarium graminearum inoculum: Inoculate the pathogenic bacteria strains isolated from a single spore onto PDA (Potato Dextrose Agar) medium, and culture them in a constant temperature incubator at 25°C for 15-20 days until the mycelium covers the surface of the kernels. During this period, rub the fungus bag every two days to make full contact between the kernels and fungus blocks to carry out the propagation of Fusarium graminearum inoculum. Preparation of PDA solid culture medium: Wash and peel fresh potatoes, cut them into pieces, weigh 200 g, boil them in boiling water for 30 min, filter through 8 layers of gauze, and collect the filtrate; weigh 20 g of glucose and add it to dissolve, weigh 15 g of agar powder, heat and dissolve it, then pour it into the filtrate, stir evenly, make the solution volume to 1 L, sterilize it at high temperature and high pressure at 121℃ / 20 min, divide it into portions and cool it for use, or store it in a 4℃ refrigerator.

[0101] 3. Intra-field bacteria

[0102] During the tasseling period of corn, the field inoculation method of burying the roots is used. Before inoculation, the cultivated seed inoculation material is stirred and mixed. During inoculation, a pit is dug 5-10 cm near the root of the plant, some fibrous roots are cut off to create wounds, 75-85 g of corn kernels with bacteria are placed in the pit, and the soil is covered and compacted. After the inoculation is completed, the field is irrigated to keep the soil moist to promote the reproduction and infection of pathogens.

[0103] 4. Characteristic investigation

[0104] 50–55 days after inoculation, the occurrence of corn stalk rot in the field was identified by the stem splitting method. The plants were cut at the cob attachment point and split longitudinally along the stalk to observe the pathogen infection at the root and stem base and the degree of pith tissue necrosis. The disease rating scale (DRS) was used to identify the phenotype of stalk rot, which was divided into 5 levels:

[0105] Level 1: Highly resistant, normal plants, no obvious symptoms;

[0106] Level 3: disease-resistant, the plant stem surface is normal, and brown lesions appear at the stem tip;

[0107] Level 5: Moderate resistance, the base of the plant stem becomes soft and faded, with obvious water stains; the medullary tissue between the first and second internodes at the base of the stem shrinks and decomposes, and browning symptoms appear;

[0108] Level 7: Infected, the lower stem nodes of the plant gradually turn from green to brown, the stem becomes soft and severely dehydrated, the internal stem pith tissue decomposes into filaments and shrinks severely, and white or rose-red hyphae appear on the stem nodes; the root system becomes soft, dry, and sparse but does not fall over; the fruit clusters begin to droop;

[0109] Level 9: Highly susceptible, the stem of the plant is hollow and constricted, with only necrotic vascular tissue remaining inside the stem, the nodes and internodes turn black and have rose-red marks; the root system is sparse, rotten and hollow, the plant is bent or lodged; the bracts of the female ear are dry and loose, and the female ear droops.

[0110] Select 10 plants with consistent growth in each family, observe and record the disease grading of stem rot one by one, take the average value as the phenotypic value of each family, and use the disease grading mean of a single family to perform multi-environment joint analysis to calculate the BLUP value to represent the multi-environment joint analysis phenotypic value of the family. Among them, the disease grading BLUP value between 1-2 is highly resistant; between 2.01-3 is resistant; between 3.01-5 is moderately resistant; between 5.01-7 is susceptible; and between 7.01-9 is highly susceptible. Investigate and record the number of days from sowing to 50% of the plants shedding pollen in each family.

[0111] 5. Phenotypic data analysis

[0112] In order to evaluate the significance of genotype and environment variance and the interaction between the two, the variance components were calculated using the "PROC MIXED" program in SAS (V9.2) software. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype was used as a fixed effect, flowering date as a covariate, and environment, replication within environment, and interaction between genotype and environment as random effects. The results of variance analysis were used to calculate the broad-sense heritability (H) of stem rot resistance. 2 ): in, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effect of environmental variation on phenotype, the SAS (V9.2) mixed linear model was used to estimate the best linear unbiased prediction (BLUP) of each family. The BLUP value was used as the data for multi-environment joint analysis to draw the phenotypic distribution histogram of each trait, calculate the phenotypic correlation coefficient, and locate the multi-environment joint QTL.

[0113] 6. Using Ks7 and Ks8.1 to identify corn stalk rot resistance

[0114] The genotypes of Ks7 and Ks8.1 of the tested corns shown in Table 1 were detected according to the method of Example 2.

[0115] The disease classification and genotype results of the tested corn shown in Table 1 are shown in Table 3, and the heterozygous genotype is not included in Table 3. In the Pop.1 population, except for the target QTL fine mapping family 638RIL-31, there are 91 recombinant inbred lines with homozygous genotypes at the Ks7 and Ks8.1 molecular markers in the remaining 239 recombinant inbred families.

[0116] The phenotypic identification of RIL families was based on the selection of 10 plants with consistent growth in each family under a single environment, and the incidence of stem rot was observed and recorded one by one. Finally, the average value of the 10 materials was used as the family phenotypic value. The disease grading of a single family was expressed using the BLUP value of multi-environment joint analysis.

[0117] Table 3 Alleles and phenotypes of molecular markers Ks7 and Ks8.1

[0118]

[0119]

[0120]

[0121]

[0122] Note: Ks7: AA (disease resistance allele), GG (disease susceptible allele); Ks8.1: GG (disease resistance allele), AA (disease susceptible allele)

[0123] Table 4 Significance analysis of molecular markers Ks7 and Ks8.1 for disease classification of stem rot

[0124] Ks7 Ks8.1 Phenotype RIL family coefficient (number) BLUP value AA GG Disease resistance 26 <![CDATA[3.16±0.27 c ]]> GG GG Disease resistance 13 <![CDATA[4.69±0.38 b ]]> GG AA Disease 44 <![CDATA[5.36±0.25 a ]]>

[0125] Note: Ks7: AA (disease resistance allele), GG (disease susceptible allele); Ks8.1: GG (disease resistance allele), AA (disease susceptible allele). Different lowercase letters indicate significant differences (P<0.05).

[0126] The statistical results of molecular markers Ks7 and Ks8.1 are shown in Tables 5 and 6. The BLUP value of the recombinant inbred line with the genotype of AA at SNP1 (i.e., Ks7) was significantly lower than that of the recombinant inbred line with the genotype of GG (P < 0.001). The BLUP value of the recombinant inbred line with the genotype of GG at SNP2 (i.e., Ks8.1) was significantly lower than that of the recombinant inbred line with the genotype of AA (P < 0.001).

[0127] Table 5 Significance analysis of disease grading of different genotypes of molecular marker Ks7

[0128]

[0129] Note: One-tailed t-test was used for phenotypic significance analysis. “*” indicates significance at the 0.05 level, “**” indicates significance at the 0.01 level, and “***” indicates significance at the 0.001 level.

[0130] Table 6 Significance analysis of disease grading of different genotypes of molecular marker Ks8.1

[0131]

[0132] Note: One-tailed t-test was used for phenotypic significance analysis. “*” indicates significance at the 0.05 level, “**” indicates significance at the 0.01 level, and “***” indicates significance at the 0.001 level.

[0133] The above results show that the SNP molecular markers Ks7 and Ks8.1 that are closely linked to the target QTL can be used for identification of corn stalk rot resistance. In breeding corn resistant to stalk rot, it is best to select corn with a genotype of AA at SNP site Ks7 and a genotype of GG at SNP site Ks8.1, or select corn with a genotype of AA at SNP site Ks7 or a genotype of GG at SNP site Ks8.1 as a parent for breeding, or select corn with a genotype of AA at SNP site Ks7 as a parent for breeding.

[0134] Supplementary Table 3

[0135]

[0136]

[0137] Note: “638RIL-53-1”, “638RIL-53-2”, “638RIL-53-3”, and “638RIL-53-4” represent different strains of the 638RIL-53 family, and the same applies to other strains.

[0138] Example 3: Mining SNPs for detecting corn stalk rot

[0139] 1. QTL mapping of resistance to Fusarium graminearum stem rot in maize

[0140] method:

[0141] (1) Characteristic investigation

[0142] 50-55 days after inoculation with Fusarium graminearum, the occurrence of corn stalk rot in the field was identified by the stem splitting method. The plants were cut at the cob attachment and split longitudinally along the stalk to observe the pathogen infection at the root and stem base and the degree of pith tissue necrosis. The stalk rot disease rating scale (DRS) was used to identify the phenotype of stalk rot, see Part 4 of Example 2 for details.

[0143] Select 10 plants with consistent growth in each family, observe and record the disease grade of stem rot one by one, take the average value as the phenotypic value of each family, and use the disease grade mean of a single family to perform multi-environment joint analysis to calculate the BLUP value to represent the multi-environment joint analysis phenotypic value of the family. Among them, the disease grade BLUP value between 1-2 is highly resistant; between 2.01-3 is resistant; between 3.01-5 is moderately resistant; between 5.01-7 is susceptible; and between 7.01-9 is highly susceptible. Investigate and record the number of days from sowing to 50% of the plants shedding pollen in each family.

[0144] (2) Phenotypic data analysis

[0145] In order to evaluate the significance of genotype and environment variance and the interaction between the two, the variance components were calculated using the "PROC MIXED" program in SAS (V9.2) software. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype was used as a fixed effect, flowering date as a covariate, and environment, replication within environment, and interaction between genotype and environment as random effects. The results of variance analysis were used to calculate the broad-sense heritability (H) of stem rot resistance. 2 ): in, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effect of environmental variation on phenotype, the SAS (V9.2) mixed linear model was used to estimate the best linear unbiased prediction (BLUP) of each family. The BLUP value was used as the data for multi-environment joint analysis to draw the phenotypic distribution histogram of each trait, calculate the phenotypic correlation coefficient, and locate the multi-environment joint QTL.

[0146] (3) Linkage map construction: At the 5-6 leaf stage of corn, 5 young leaves of plants with consistent growth were selected from each family and mixed, and genomic DNA was extracted using the conventional CTAB method. The Maize6H-60K chip independently developed by the Corn Research Center of Beijing Academy of Agricultural and Forestry Sciences was used for genotyping analysis. The linkage map was constructed using QTL ICImapping 4.2 software. The Kosambi function was selected to estimate genetic distance. Finally, a total of 48,087 polymorphic SNP markers were screened, redundant markers were removed, and merged into 7,200 bin markers.

[0147] (4) QTL positioning: Based on the constructed high-density genetic linkage map, the phenotypic values ​​of the four stem rot evaluation indicators in the positioning population in single environment and multiple environments were combined to detect the QTL of Fusarium stem rot resistance. The composite interval mapping method (CIM) of Windows QTLCartographer V2.5 software was used for preliminary positioning and genetic effect analysis. LOD = 3 was used as the threshold line, and the confidence interval of the target QTL was determined by decreasing 2 LOD values ​​on both sides of the LOD value peak. Results: The RIL population and parental materials were used to identify the resistance to Fusarium graminearum stem rot in four environments (2019YL, 2019SY, 2020YL and 2020SY). The statistical analysis results showed that there were extremely significant differences in stem rot resistance between the disease-resistant parent KA105 and the susceptible parent KB204 (Table 7). The RIL population showed a wide range of continuous variation between different environments, indicating that stem rot resistance is a quantitative trait controlled by multiple genes.

[0148] Table 7 Phenotypic distribution of recombinant inbred lines of two parents under multiple environments

[0149]

[0150] Note: 2019YL: Yangling in 2019; 2019SY: Sanyuan in 2019; 2020YL: Yangling in 2020; 2020SY: Sanyuan in 2020; BLUP: multi-environment joint analysis.

[0151] In the Pop.1 population, the disease grading ranged from 1 to 9, with a mean of 2.91 to 5.43 and a coefficient of variation of 33% to 65%. The disease grading showed a skewed normal distribution under a single environment, and the BLUP values ​​of multiple environments were normally distributed. The results of the joint variance analysis showed (Table 7) that the differences between genotypes in the RIL population were extremely significant, and the differences between environments and between genotypes and environments were extremely significant. The estimated genetic variance was greater than the estimated variance between environments and between genotypes and environments, indicating that genetic factors were the main source of variation. The heritability of stem rot resistance in the Pop.1 population was 81%.

[0152] Table 8 Variance and heritability analysis of stem rot phenotypic indicators in multiple environments

[0153]

[0154] Note: *** indicates P < 0.001.

[0155] The phenotypic data of disease classification in single environment and BLUP values ​​in multiple environments were used to locate the QTL for resistance to Fusarium graminearum stem rot. A QTL ( Figure 1 ), with a physical position between 178,021,534bp–183,318,514bp (B73 RefGen_V3), about 5.30Mb. The QTL was co-localized in 2020YL, 2020SY and BLUP values ​​(Table 9), with LOD values ​​between 3.87 and 7.48, and the explained phenotypic variation was 5.22%–12.10%. The resistance allele originated from the disease-resistant parent KA105.

[0156] Table 9 QTL analysis of disease classification of Fusarium graminearum stem rot under single and multiple environment conditions

[0157] Characteristics environment chromosome Left side mark Right flank marking LOD <![CDATA[Contribution rate R 2 (%)]]> DRS 2020YL 5 AX-91854907 AX-107957427 3.87 5.48 DRS BLUP 5 AX-108028348 AX-108105099 7.48 12.1 DRS 2020SY 5 AX-108028348 AX-108105099 4.98 5.22

[0158] 2. Verification and fine positioning of QTL effects for maize stalk rot resistance

[0159] Methods: The QTL effect was verified and finely positioned by the recombinant progeny verification method. According to the initial QTL positioning results, the remaining heterozygous lines with fixed background genotypes in the target segment were screened in the RIL population, and the KASP marker was developed to screen the individuals that exchanged in the target segment. The key recombinant individuals were verified by the genotype and stem rot phenotype of the offspring for effect verification and fine positioning. 60-180 plants of each recombinant individual were planted for genotype and stem rot disease classification, and the disease severity index (DSI) of each genotype was calculated. The difference in resistance to Fusarium graminearum stem rot among different genotypes was analyzed by one-tailed t test. If the difference between different genotypes was significant (P < 0.05), it means that the QTL is located in the heterozygous region, and vice versa.

[0160] DSI (%) = (disease grade × number of plants with corresponding grade) × 100 / (maximum disease grade × total number of plants)

[0161] result:

[0162] (1) A heterozygous genotype in the candidate interval of the target resistance QTL was screened out from the F8 RIL family of the Pop.1 population. The remaining heterozygous line material 638RIL-31 with a relatively fixed background genotype was self-pollinated to obtain seeds of the segregating population progeny. The developed molecular markers were used to screen individuals that exchanged in the target segment (Table 5). The key recombinant individuals were precisely located by progeny testing. For each recombinant single plant, 100-200 plants were planted to identify the genotype and stem rot resistance phenotype. The effect verification of the target QTL showed that the homozygous allele from the disease-resistant parent can significantly improve the field resistance to stem rot (P<0.001)( Figure 2 A). Among them, the average DSI of homozygous disease-resistant KA105 / KA105 genotype plants in Yangling in 2021 was 24.55%, and the average DSI of homozygous susceptible KB204 / KB204 genotype plants was 61.62%; in 2022, the average DSI of homozygous KA105 genotype plants in Yangling was 33.49%, and the average DSI of homozygous KB204 genotype plants was 49.05%. The t test results showed that there was a very significant difference in DSI between the two genotypes (P<0.001). In summary, the effect of the located resistance QTL was detected using the remaining heterozygous line 638RIL-31. The results of the two years of experiments were very significantly different, indicating that the genetic effect of the QTL is real. The target QTL locus with homozygous disease-resistant alleles can stably reduce the DSI by 15.56%-37.07%, significantly improving the field resistance of corn to Fusarium graminearum stem rot.

[0163] (2) Molecular markers were encrypted within the candidate interval of the target QTL, and molecular marker primers were designed based on the maize B73 reference genome V3 version sequence. The molecular markers Ks7 and Ks8.1 at both ends of the candidate interval. Ks7 is located at position 178607304 of maize chromosome 5 and is named SNP1. The SNP site and the nucleotides near it are shown in SEQ ID No. 7 of the sequence table, where the 200th base is the SNP site, i.e., B73 RefGen_V3 ( https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3) is an A / G polymorphism. In SEQ ID No.7, R is A or G, and the genotype of the SNP site is as follows: AA, AG or GG. The GG is the homozygous type of the SNP site being G, the AA is the homozygous type of the SNP site being A, and the AG is the heterozygous type of the SNP site being A and G. The corn varieties whose genotype of the SNP site is AA or AG have significantly higher stalk rot resistance than the corn varieties whose genotype of the SNP site is GG. Ks8.1, located at the 182486805th position of chromosome 5 of corn, is named SNP2. The SNP site and the nucleotides nearby are shown in SEQ ID No.8 of the sequence table, wherein the 202nd base is a SNP site, namely B73 RefGen_V3( https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3 ) is an A / G polymorphism. In SEQ ID No.8, R is A or G, and the genotype of the SNP site is as follows: AA, AG or GG. The GG is the homozygous type of the SNP site being G, the AA is the homozygous type of the SNP site being A, and the AG is the heterozygous type of the SNP site being A and G. The corn varieties with the genotype of the SNP site being GG or AG have significantly higher stalk rot resistance than the corn varieties with the genotype of the SNP site being AA.

[0164] (3) The newly developed markers were used to divide the offspring of the segregating population into four recombinant types, and the resistance QTLs were finely located by progeny testing. The results showed that there was a significant difference in DSI between the plants carrying the homozygous KA105 genotype and the homozygous KB204 genotype in types I and IV (P<0.05) ( Figure 2 B), there was no significant difference in DSI between plants carrying homozygous genotypes in type II and III (P>0.05). It was thus determined that the KA105 donor fragment of type IV carried the target QTL. Based on whether each type carried the target QTL, it can be inferred that the site is located between markers Ks7 and Ks8.1 in the heterozygous interval of types I and IV, with a physical distance of approximately 3.87Mb (corresponding to the B73 genome RefGen_V3 information). Among them, there was a significant difference in DSI between plants with homozygous disease-resistant genotypes and homozygous disease-susceptible genotypes in type IV (P<0.05)( Figure 2 In summary, the resistance QTL was located between molecular markers Ks7 and Ks8.1, which are about 3.87 Mb apart in physical location. The allele from the disease-resistant parent can significantly improve the field resistance to stem rot.

[0165] SEQ ID No.7Ks7: (Chr.5_178607304,B73 RefGen_V3)

[0166] TGGCCATTAGGGCCTCTTTCTACTTCTAGAGGTGGTTGTTTCGCATGCGAAGACTCCTTAGCAAAAGTTGTTCCTTGGTGTTCATGTTAAGGTCCTCTTTCTCTTGGAGGATGTATTTGTATTCTTTAGTGGTGGGCTTAGGTGGTAGCGGCCACTTGTGGTGCTCTGGGAGTGAAGTCTGTGGAACGAACGAAGACCTRAAGATGTCTTTGAGTTAGTGGGAGCTAGATGGTTGTTTTCTTGACAGGTCGGTCCAAACTTTGGCCTGATAGGGGTGTCTCTAGGAGTTGAAAGGAACATGTTCGAGGGTCTCCGAATTGCATGTGTGGACACTTCCTTTGGGGATGAATGGCTCTTTGTGGCGAGGGAAAGTTGGGTCTCTATGGCTAGCTCATTGATG

[0167] SEQ ID No.8 Ks8.1:(Chr.5_182486805,B73 RefGen_V3)

[0168] AGTGTCTCAGACTGGTATTAGCATAGCAACAAAAGTGGCTTAATAGATGTTCAGAATTGAGCGACACTACAGTCAAAGATGCACAACACTTGACACTAGCTTGTACACAGTAAAATTCTTCTCTGGTACACCGTACACATCAGGAGACGAAACAAAACTCCTGCGCTCTCTTATTTAACCAAGATCAGGGACTATGAGGTARTCCTCGTCGTCGGTGACCTCGATCCGGGCCTTTCTTCGCTCTGGCGAACCCCAGCGCCGCCGACGGCGGTTTGGCCGGCCTGTAGTACGCCGCGTCGTTCGCCGCCTGGTATCCGAAAAGCTCCGGCACATCCGCCAACGTCCTGCTGGCTTTGGGCGCCTGCTCGTGGAAGAGGTCGATGTCGGCGAACCACTCCAGC

[0169] Ks7 was named SNP1, and Ks8.1 was named SNP2.

[0170] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Any of the following applications of a substance for detecting polymorphism or genotype of a SNP site in a corn genome, A1) Identifying or assisting in identifying resistance to corn stalk rot; A2) screening or breeding maize lines, strains or varieties resistant to stalk rot; A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Corn breeding; A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot; A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to stalk rot; A7) preparing a product for screening or breeding corn lines, strains or varieties susceptible to stalk rot; A8) preparing corn breeding products; The SNP site is any of the following: P1, the SNP sites are SNP1 site and SNP2 site, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.9 in the sequence list, which is A or G; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.16 in the sequence list, which is A or G; P2, the SNP site is the SNP1 site; P3. The SNP site is the SNP2 site.

2. A method for identifying or assisting in identifying resistance to corn stalk rot, characterized in that: The method is any of the following: M1. The method comprises detecting the genotypes of the SNP1 site and the SNP2 site in the tested corn genome, and identifying or assisting in identifying the corn stalk rot resistance according to the genotypes, wherein the SNP1 site is a site on the chromosome 5 of corn, and the nucleotide type thereof is A or G, which is the 50th nucleotide of SEQ ID No.9 in the sequence list; the SNP2 site is a site on the chromosome 5 of corn, and the nucleotide type thereof is A or G, which is the 50th nucleotide of SEQ ID No.16 in the sequence list; M2. The method comprises detecting the genotype of the SNP1 site in the corn genome to be tested, and identifying or assisting in identifying corn stalk rot resistance based on the genotype.

3. A method for corn breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 2 in the corn genome, and selecting corn with the genotype of the SNP site being AAGG as a parent for breeding, wherein the AAGG is a homozygous type in which the SNP1 site is A and the SNP2 site is a homozygous type of G.

4. Application, characterized in that, The application is the application of the substance described in claim 1 or the method described in claim 2 or 3 in corn breeding, and the chromosome of the corn to be tested contains a DNA fragment, and the DNA fragment is a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.9, or / and contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.

16.

5. A product for detecting the polymorphism or genotype of a SNP site in a corn genome, characterized in that: The product is the substance described in claim 1, and the product is any one of the following: C1) Products for detecting single nucleotide polymorphisms or genotypes associated with corn stalk rot resistance; C2) Products for identifying or assisting in identifying resistance to corn stalk rot; C3) Products used for corn breeding; C4) screening or breeding products of corn lines, strains or varieties resistant to corn stalk rot; C5) A product of screening or breeding corn lines, strains or varieties susceptible to corn stalk rot.

6. The use according to claim 1 or the product according to claim 5, characterized in that: The substance is the following D1), D2) or D3): D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

7. The use or product according to claim 6, characterized in that: The primer combination is F1-1, F1-2, F2-1 and / or F2-2: F1-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.1 in the sequence listing, the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.3 in the sequence listing; F1-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 179-200 of SEQ ID No.7 in the sequence listing and A at position 200, a single-stranded DNA having a nucleotide sequence of positions 181-200 of SEQ ID No.7 in the sequence listing and G at position 200, and a single-stranded DNA having a nucleotide sequence of positions 228-251 of SEQ ID No.7 in the sequence listing; F2-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.4 in the sequence listing, the single-stranded DNA shown in SEQ ID No.5 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.6 in the sequence listing; F2-2, a primer set consisting of a single-stranded DNA whose nucleotide sequence is the 178th to 202nd positions of SEQ ID No. 8 in the sequence listing with A at the 202nd position, a single-stranded DNA whose nucleotide sequence is the 178th to 202nd positions of SEQ ID No. 8 in the sequence listing with G at the 202nd position, and a single-stranded DNA shown at the 272th to 291st positions of SEQ ID No. 8 in the sequence listing.

8. Use of the product according to any one of claims 5 to 7 in corn breeding.

9. A DNA molecule, characterized in that The DNA molecule is any of the following: N1) The nucleotide sequence is SEQ ID No. 7 in the sequence listing or the DNA molecule of positions 179 to 251 of SEQ ID No. 7 or positions 181 to 251 of SEQ ID No. 7; N2) the nucleotide sequence is SEQ ID No. 8 in the sequence listing or the DNA molecule at positions 178 to 291 of SEQ ID No. 8; N3) A combination consisting of N1) and N2).

10. Use of the DNA molecule according to claim 9 in any of the following: A1) Identifying or assisting in identifying resistance to corn stalk rot; A2) screening or breeding maize lines, strains or varieties resistant to stalk rot; A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Corn breeding; A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot; A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to corn stalk rot; A7) preparing a product for screening or breeding corn strains, lines or varieties susceptible to corn stalk rot; A8) Prepare corn breeding products.

Images