Molecular marker co-segregated with day flowering time regulation gene of day lily plant and application of molecular marker

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a KASP molecular marker co-segregated with day flowering time gene GAUT of a hemerocallis plant and application of the KASP molecular marker. When the molecular marker KASP-GAUT is used for detecting the day flowering time genotype of the hemerocallis plant, the material carrying the GAUT genotype (T / T) is in a night flowering type, and the material carrying the GAUT genotype (T / Camp; c / C) is in a daytime flowering type. By utilizing the result, a foundation can be laid for molecular marker-assisted breeding of day flowering time of the hemerocallis plants, the molecular breeding process of day flowering time character regulation of the hemerocallis plants is accelerated, and the selection efficiency of breeding is improved; and a foundation is laid for further accurately controlling the day flowering time of the hemerocallis plants by an efficient means so as to accelerate modern agricultural economic production and application.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and particularly relates to a molecular marker KASP-GAUT co-separated with a daily flowering time regulating gene GAUT of a Hemerocallis plant and an application thereof. Background Art

[0002] Hemerocallis L. is one of the most important perennial plants in the world. China has rich germplasm resources of Hemerocallis and a long history of cultivation, and is the distribution center of Hemerocallis germplasm resources. Hemerocallis plants have rich colors, beautiful flower shapes, strong adaptability, and high ornamental value; while the flower buds of daylilies in the genus are edible and rich in nutrients, with high medicinal and economic value. Controlling the daily flowering time is of great significance for the formation of daylily yield and the extension of the ornamental period of Hemerocallis.

[0003] Flowers are important reproductive organs, and diurnal flower opening times (DFOT) are important life history traits. The flowering time of a plant during the day affects many important processes such as reproductive isolation, hybrid breeding, and heat tolerance. While adapting to different environments, plants have gradually evolved different DFOTs. Different species have specific flowering times. The biological clock responds to the diurnal cycle of the external environment and regulates the precise timing of flowering of plants. Some species bloom during the day, such as roses, roses, roses, dandelions, etc.; some bloom at night, such as epiphyllums, tuberoses, etc.; and some species have periodic opening and closing (water lilies). Flowers open at the right time to attract corresponding pollinators for reproduction, so the DFOT trait is of great significance to plant life activities. Daylilies can be roughly divided into daylily groups that bloom during the day and daylily groups that bloom at night according to the time when their flowers are fully opened. Although different opening times can hinder the gene exchange between the two types of daylilies that open during the day and at night, they have not formed complete reproductive isolation, and they can hybridize with each other and their offspring are fertile. The single flowering period of Hemerocallis plants does not exceed 24 hours. All species in the genus have the characteristic that mature buds open quickly within a few hours. They are plants whose flowering time is precisely and strictly controlled by the biological clock. Therefore, Rodriguez-Enriquez and Grant-Downton believe that Hemerocallis plants are a model plant for studying biological clock rhythms.

[0004] Compared with the study of seasonal flowering time (FT) of plants, there are few reports on the study of the time of flower opening in a day, and the genetic mechanism is also poorly understood. In loofah, Liu et al. constructed a near-isogenic line from two parents with different daily flowering times and detected four QTLs related to daily flowering time on chromosome 1, and speculated that the homologous genes AtSEP1 and AtSOC1 of Arabidopsis thaliana were its regulatory genes; in the Iris × Belamcanda F2 population, a total of six QTLs related to daily flowering time were detected; in rice, Zhuang Chuxiong et al. screened a gene DFOT1 specifically expressed in lodicules, which can control the flowering time of rice in a day through the pectin methylesterase gene family, and DFOT1 is highly conserved in plants. The lodicules in the Poaceae family are evolutionarily conserved with the petals in other flowering plants. It is speculated that the mechanism by which this gene controls the daily flowering time by acting on PME is conserved. In the genetic study of the daily flowering time of Hemerocallis plants, the fertility of Hemerocallis plants with different daily flowering times provides a practical basis for it. In the wild of Hirado Island, Japan, wild daylilies with different daily flowering times formed natural F1 hybrids. Genetic studies on the daily flowering time of the population showed that daytime opening is a dominant trait relative to nighttime opening, and the daily flowering time is controlled by a single gene or a few genes. Further observations on the daily flowering time of the artificial hybrid F2 generation population of daylilies that bloom during the day and at night showed that the number of individuals in the F2 generation population that bloom during the day and at night is roughly the same, which suggests that the daily flowering time is a quality trait controlled by two co-dominant alleles at one locus. Ren Yi constructed different F1, F2, BC1 and BC2 genetic populations using 18 species / varieties as parents, proving that night flowering is a dominant trait and that the daily flowering time conforms to the quantitative trait inheritance of 2 pairs of additive major genes + additive dominant polygenetic inheritance model. Zhang Lingling conducted a genome-wide association analysis of the daily flowering time of daylilies using 73 resequencing materials. To date, no clear daily flowering time regulatory genes and molecular markers for this trait that can be directly applied to molecular marker-assisted breeding have been reported.

[0005] In summary, developing molecular markers that co-segregate with the GAUT gene that regulates daily flowering time in Hemerocallis plants, using molecular markers to identify and select genotypes in the seedling stage of Hemerocallis plants, and further precisely regulating the daily flowering time of plants with efficient means can provide a theoretical basis for extending the ornamental period and bud period of Hemerocallis plants, promoting yield formation, and adjusting the time of flower bud harvesting. Summary of the invention

[0006] One of the purposes of the present invention is to provide a molecular marker co-segregating with the daily flowering time regulating gene GAUT of Hemerocallis plants.

[0007] The second object of the present invention is to provide an application of the above-mentioned molecular marker in molecular breeding of Hemerocallis plants.

[0008] Another object of the present invention is to provide a method for determining the daily flowering time trait / variety of Hemerocallis plants.

[0009] To achieve the above object, the present invention provides the following technical solutions:

[0010] The present invention uses linkage analysis and whole genome association analysis combined with molecular marker development to analyze the daily flowering time of Hemerocallis plants, and obtains a SNP molecular marker that is closely linked to the daily flowering time, located at the 206,889,005th base position on chromosome 5 in the DTHH v1.0 haplotype genome B, and the mutation base type is a mutation from T to C. A KASP molecular marker is designed and named KASP-GA UT. The molecular marker is a nucleotide sequence fragment shown in SEQ ID NO.1 and a nucleotide sequence fragment shown in SEQ ID NO.2, wherein the nucleotide sequence fragment shown in SEQ ID NO.1 is co-segregated with a night flowering gene, and the nucleotide sequence fragment shown in SEQ ID NO.2 is co-segregated with a day flowering gene. The KASP molecular markers are:

[0011] GCGCTTAACCATAGCATATTACCTTCTCCCTCTGGAAGAAAGAAAATTTCCTAG GAG(SEQ IDNO.1);

[0012] GCGCTTAACCATAGCATATTACCTCCTCCCTCTGGAAGAAAGAAAATTTCCTAG GAG (SEQ ID NO. 2).

[0013] The primer pair corresponding to the KASP molecular marker was amplified by 3 PCR primers. The primers were synthesized by Zhengzhou Qingke Biotechnology Co., Ltd. The forward and reverse primer sequences of the primer pair for amplifying the molecular marker were:

[0014] Allele-specific forward primer 1:

[0015] KASP-GAUT-a: 5'-GAAGGTGACCAAGTTCATGCTGCGCTTAACCATAGCATATTAC CTT-3' (SEQ ID NO. 3);

[0016] Allele-specific forward primer 2:

[0017] KASP-GAUT-b: 5'-GAAGGTCGGAGTCAACGGATTGCGCTTAACCATAGCATATTA CCTC-3' (SEQID NO.4);

[0018] Universal reverse primer:

[0019] KASP-GAUT-c: 5'-CTCCTAGGAAATTTTCTTTCTTCCAGAG-3' (SEQ ID NO. 5).

[0020] The present invention also discloses the application of the molecular marker co-segregated with the Hemerocallis plant daily flowering time regulating gene GAUT in the molecular breeding of Hemerocallis plants. The molecular marker is co-segregated with the Hemerocallis plant daily flowering time regulating gene GAUT, and can identify or assist in identifying the Hemerocallis plant daily flowering time type as a night flowering type or a day flowering type at the molecular level, that is, the molecular marker is used to further amplify the PCR to determine the daily flowering time type of the Hemerocallis plant material at the budding stage or the seedling stage, thereby accelerating the breeding process. Those skilled in the art can understand that, for example, by detecting whether the molecular marker of the present invention exists, it can be determined whether a Hemerocallis plant variety is a night flowering variety or a day flowering variety. Specifically, the molecular marker primer pair of the present invention can be used, and the detection can also be performed by a sequencing method.

[0021] The present invention also discloses a method for determining the daily flowering time trait / variety of Hemerocallis plants, the method comprising the following steps:

[0022] (1) extracting genomic DNA of the Hemerocallis plant to be tested;

[0023] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker, and sequencing or fluorescent quantitative PCR detection of the PCR amplification product;

[0024] (3) Determine based on the sequencing result or fluorescence signal of step (2), the specific criteria are:

[0025] If the PCR amplification product is a characteristic band with a length of 57 bp as shown in SEQ ID NO.1 or the measured fluorescence signal is a blue punctuation fluorescence signal of a homozygous genotype (T / T), then the Hemerocallis plant material to be tested is a night-flowering trait / variety; if the PCR amplification product is a characteristic band with a length of 57 bp as shown in SEQ ID NO.2 or the measured fluorescence signal is a red punctuation fluorescence signal of a homozygous genotype (C / C) and a green punctuation fluorescence signal of a heterozygous genotype (T / C), then the Hemerocallis plant material to be tested is a daytime flowering trait / variety.

[0026] In addition, the kit containing the above primer pair can be used to identify the daily flowering time traits of Hemerocallis plants. In specific applications, a reagent containing the above molecular marker primer pair can be selected to make a kit.

[0027] Furthermore, the use of the reagent for detecting the presence of the KASP marker in the localization of the daily flowering time regulatory gene GAUT of Hemerocallis plants, using the molecular markers of the present invention, can locate the daily flowering time regulatory gene GAUT of Hemerocallis plants, and the above applications can all be carried out according to conventional methods.

[0028] The present invention also protects vectors containing the above-mentioned molecular markers. The recombinant vector may be an expression vector or a cloning vector into which the molecular marker of the present invention is inserted. After obtaining the above-mentioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, the present invention also protects recombinant cells containing the recombinant vector.

[0029] Advantages of the present invention

[0030] The molecular marker KASP-GAUT has high stability and can be easily, quickly and high-throughput applied to the screening of night-flowering and day-flowering Hemerocallis plants around the world.

[0031] The present invention is the first to conduct relevant research on the daily flowering time trait of Hemerocallis plants. The daily flowering time trait of Hemerocallis plants was precisely located for the first time by using linkage analysis, whole genome association analysis, interval electronic pooling and other methods, and the daily flowering time regulatory gene of Hemerocallis plants was located in the 0.98Mb interval in the middle of chromosome 5 in the haplotype genome B. By using interval electronic pooling, a molecular marker KASP-GAUT co-segregated with the daily flowering time of Hemerocallis plants was finally associated. In 138 natural populations and the hybrid F1 population of 'Datong Huanghua'×'Lullaby', the selection efficiency of night-flowering type materials and day-flowering type materials was 100%. The development of this marker is conducive to the final cloning of the daily flowering time regulatory gene GAUT of Hemerocallis plants and the establishment of a molecular marker-assisted breeding system.

[0032] The traditional method of identifying germplasm of daily flowering time is to directly observe with naked eyes or set up a camera to record and then watch the video to determine its type, which has the disadvantages of long time consumption and high cost. These factors increase the cycle and difficulty of molecular breeding of daily flowering time of Hemerocallis plants. The molecular marker provided by the present invention is co-separated with the daily flowering time trait of Hemerocallis plants, and Hemerocallis plants with different genetic backgrounds can use the molecular marker for germplasm screening, which greatly improves the breeding efficiency of Hemerocallis plants and lays a foundation for further accurately controlling the daily flowering time of Hemerocallis plants with efficient means to accelerate the application of modern agricultural economic production. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1The floral phenotype and flowering time of Hemerocallis plants during the day; A is the night-flowering germplasm 'Datong Huanghua', and B is the day-flowering germplasm 'Lullaby'.

[0034] Figure 2 This is the preliminary positioning result of the main QTL locus of daily flowering time in Hemerocallis plants. The red dotted box indicates the preliminary positioning interval.

[0035] Figure 3 Schematic diagram of the fine positioning process of the daily flowering time regulatory gene GAUT in Hemerocallis plants, where GAUT stands for daily flowering time regulatory gene.

[0036] Figure 4 This is a fluorescence signal detection diagram of PCR amplification of the molecular marker KASP-GAUT in 310 strains of the F1 segregation population of 'Datong Huanghua'×'Lullaby'. The blue signal points are night-flowering materials of the T / T genotype; the green signal points are day-flowering materials of the T / C genotype; and the black signal points are negative controls without templates.

[0037] Figure 5 This is a fluorescence signal detection diagram of PCR amplification of molecular marker KASP-GAUT in 138 Hemerocallis plants. The blue signal points are T / T genotype night-flowering materials; the green signal points are T / C genotype day-flowering materials; the red signal points are C / C genotype day-flowering materials; and the black signal points are negative controls without templates. DETAILED DESCRIPTION

[0038] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0039] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained through commercial channels.

[0040] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0041] Biomaterials:

[0042] 'Datong Huanghua' is the main cultivated daylily variety in Datong, Shanxi. Its inner petals open at 18:00 in the evening and fully open at 22:00 at night, which is a night-flowering type; 'Lullaby' is an ornamental daylily. Its inner petals open at 24:00 at night and fully open at 9:00 in the morning, which is a day-flowering type. Both have high-depth resequencing data.

[0043] During the experiment, all germplasms were cultivated in an open field environment (37°25′38.2″N, 112°32′40.5″E) and normal fertilizer and water management was adopted. When the flowers were in full bloom, the bud development and opening process was recorded using a smart camera, and the flowering time phenotype was recorded by later observation videos.

[0044] All primer synthesis and gene sequencing work in the experiment was completed by Zhengzhou Qingke Biotechnology Co., Ltd.

[0045] Experimental reagents:

[0046] The sample DNA was extracted using the magnetic bead method. The required sodium hydroxide, sodium chloride, potassium acetate, concentrated hydrochloric acid, isopropanol (analytical grade), anhydrous ethanol (analytical grade), sodium dodecyl sulfate (analytical grade), disodium ethylenediaminetetraacetic acid (analytical grade), and tris(hydroxymethylaminomethane) (analytical grade) were purchased from Bio-Toda and Solebold. The magnetic bead mother liquor (JC32001) was purchased from Jicaitai Co., Ltd. KASP MIX (HiGeo 2xProbe Mix A) was purchased from Beijing Jiacheng Biological Co., Ltd.

[0047] Experimental equipment:

[0048] In this experiment, QuantStudio 6 was used for real-time PCR fluorescence detection.

[0049] Example 1 Obtaining SNP Molecular Markers Co-segregating with Daily Flowering Time of Hemerocallis Plants

[0050] The analysis of the genes regulating the daily flowering time of Hemerocallis plants, including the identification of the daily flowering time phenotype, linkage analysis, genome-wide association analysis, selection pressure analysis and interval electronic pooling analysis, has been the first to finely locate the daily flowering time trait of Hemerocallis plants, and locate the daily flowering time regulatory gene of Hemerocallis plants in the 0.98Mb interval in the middle of chromosome 5 in the haplotype B genome. Using interval electronic pooling, a molecular marker KASP-GAUT that co-segregates with the daily flowering time regulatory gene of Hemerocallis plants was finally associated. The relevant experimental process is briefly introduced as follows.

[0051] (1) Identification of daily flowering time phenotypes of Hemerocallis plants

[0052] All Hemerocallis plant materials were managed normally, and smart cameras were set up during the flowering period to record the development process of their flower buds. Ten flowers were observed for each germplasm. In the process of flower bud opening, it was artificially divided into four stages, namely the time when the outer petals opened, the time when the inner petals opened, the time when the flower buds opened to half of the maximum flower diameter, and the time when they were fully bloomed. Among them, the time when the inner petals opened was the least affected by the environment and was used as the main phenotype in the fine positioning process. The other three agronomic traits assisted in fine positioning. The above standards were used to investigate 138 natural germplasms of Hemerocallis plants and 310 hybrid F1 population strains of 'Datong Huanghua'×'Lullaby', and the daily flowering time phenotype of each individual plant was counted ( Figure 1 ).

[0053] (2) Linkage analysis of daily flowering time traits in Hemerocallis plants

[0054] The F1 segregating population formed by the cross between 'Datong Huanghua' (flowering at night) and 'Lullaby' (flowering during the day) was used as the material to genetically locate the GAUT gene that controls the daily flowering time of Hemerocallis plants. Based on the high-density genetic map of 'Datong Huanghua'×'Lullaby' and the daily flowering time phenotype, the initial positioning results showed that the GAUT locus was located between the two bin markers Bin_26689260 and Bin_299234592 on chromosome 5. On this basis, by further developing SSR and InDel markers in the QTL interval, a linkage map of 310 F1 lines was constructed, and linkage analysis located the GAUT locus between the two InDel markers sauInD1829 and sauInD1508. The genotype and daily flowering time phenotype data of 310 F1 lines were used to screen recombinant plants, and the GAUT locus was successfully located in the approximately 6 Mb interval between sauInD1861 (201,071,752 bp) and sauInD1869 (207,007,028 bp) ( Figure 2 ).

[0055] (3) Genome-wide association analysis and selection pressure analysis of daily flowering time traits in Hemerocallis plants

[0056] A genome-wide association study (GWAS) was performed on the daily flowering time trait using 105 resequenced natural germplasms of Hemerocallis plants, and a selection pressure analysis (XP-CLR) was performed based on the Hemerocallis and Daylily populations. Combining the results of fine mapping, GWAS, and XP-CLR, the GAUT locus was finally located within the approximately 980Kb interval of 206.01Mb to 206.99Mb on chromosome 5 through linkage disequilibrium block analysis ( Figure 3 ).

[0057] (4) Interval electronic pooling analysis of daily flowering time traits of Hemerocallis plants

[0058] In this 980Kb interval, electronic pooling analysis was performed by combining the daily flowering time phenotype data of 138 natural populations of Hemerocallis plants with the genotype data of 304 SNPs. The results showed that the genotype of SNP marker SNP 206889005 was co-segregated with the daily flowering time phenotype. Through genomic data and clone sequence analysis, it was found that this SNP was related to the daily flowering time trait of Hemerocallis plants ( Figure 3 ). The above SNP location contains a gene encoding pectin synthase (polygalacturonate4-alpha-galacturonosyltransferase, GAUT) ( Figure 3 ).

[0059] The molecular marker (SNP marker SNP_206889005) co-segregated with the daily flowering time regulatory gene GAUT of Hemerocallis plants can be amplified using KASP marker, located at base position 206,889,005 on chromosome 5 in the DTHH v1.0 haplotype genome B, and obtained by 3 PCR primers.

[0060] The forward and reverse primer sequences of the primer pair for amplifying the molecular marker are respectively:

[0061] Allele-specific forward primer 1:

[0062] KASP-GAUT-a: 5'-GAAGGTGACCAAGTTCATGCTGCGCTTAACCATAGCATATTACCTT-3' (SEQ ID NO. 3);

[0063] Allele-specific forward primer 2:

[0064] KASP-GAUT-b: 5'-GAAGGTCGGAGTCAACGGATTGCGCTTAACCATAGCATATTA CCTC-3' (SEQ ID NO. 4);

[0065] Universal reverse primer:

[0066] KASP-GAUT-c: 5'-CTCCTAGGAAATTTTCTTTCTTCCAGAG-3' (SEQ ID NO. 5).

[0067] (5) Validation of co-segregation of KASP-GAUT in the population

[0068] In order to verify the linkage relationship between SNP marker SNP 206889005 and the daily flowering time trait of Hemerocallis plants, the KASP marker KASP-GAUT was used to perform population co-segregation verification in 310 F1 population progeny lines of the hybridization of 'Datong Huanghua'×'Lullaby'. The results showed that the night-flowering type had a consistent blue fluorescence signal, and the day-flowering type had a consistent green fluorescence signal ( Figure 4 ), the marker co-segregates with the daily flowering time trait of Hemerocallis plants.

[0069] Example 2 Identification of daily flowering time types of Hemerocallis plants using the above molecular markers

[0070] The molecular markers of the present invention were used to identify the daily flowering time types of 138 natural germplasm materials of Hemerocallis plants. The specific information of the germplasm materials used, the daily flowering time of each material and the genotype identification results corresponding to the SNP_206889005 site are shown in Tables 1 and 2:

[0071] Table 1 Daily flowering time of natural germplasm of Hemerocallis plants from China and the genotype corresponding to the SNP_206889005 locus

[0072]

[0073]

[0074]

[0075] Note: The inner valve opening time is 12:00 am at noon as the zero point, and the conventional time points are converted into numerical values.

[0076] Table 2 Daily flowering time of natural germplasm of Hemerocallis plants from abroad and the genotype corresponding to the SNP_206889005 locus

[0077]

[0078]

[0079] Note: The inner valve opening time is 12:00 am at noon as the zero point, and the conventional time points are converted into numerical values.

[0080] (1) DNA extraction from leaves of Hemerocallis plants

[0081] The magnetic bead method was used to extract DNA from the leaves of Hemerocallis plants, and the nucleic acid concentration and purity of the DNA samples were determined. The concentration of the DNA working solution should be no less than 50 ng / μl, and the purity OD260 / 280 value should be between 1.8 and 2.0. Specifically:

[0082] Take 0.1g of fresh leaves in a 2ml centrifuge tube and add two steel beads. Grind the liquid nitrogen frozen sample in a tissue disruptor at 20 times / s, add 800μl × SDS, and place in a 65℃ water bath for 1h and invert twice during the process. Add 300μl of 3M potassium acetate, mix on a shaker for 20min, centrifuge at 12000rpm / min for 20min, aspirate 800μl of supernatant into a new 2ml centrifuge tube, add 800μl of magnetic bead isopropanol, invert and mix, let stand until the magnetic beads precipitate, invert again, use a magnetic stand to adsorb the magnetic beads and discard the supernatant. Add 400μl of 75% ethanol to wash, invert and mix, adsorb the magnetic beads on the magnetic stand, remove the supernatant and dry. Add 100μl of TE buffer and 2‰ of RNase, and let stand at 4℃ for 4h to dissolve. Use NanoDrop Spectrometer to determine DNA concentration and purity. Use 1% agarose gel electrophoresis to detect DNA integrity. The DNA concentration was diluted to 50 ng / μl and stored at -20°C for later use.

[0083] (1) PCR amplification of DNA from Hemerocallis plant samples

[0084] Primer selection:

[0085] KASP-GAUT-a: 5'-GAAGGTGACCAAGTTCATGCTGCGCTTAACCATAGCATATTACCTT-3' (SEQ ID NO. 3);

[0086] KASP-GAUT-b: 5'-GAAGGTCGGAGTCAACGGATTGCGCTTAACCATAGCATATTACCTC-3' (SEQ ID NO. 4);

[0087] KASP-GAUT-c: 5'-CTCCTAGGAAATTTTCTTTCTTCCAGAG-3' (SEQ ID NO. 5).

[0088] The primer was synthesized by Zhengzhou Qingke Biotechnology Co., Ltd. and diluted to 10 μM for use.

[0089] PCR amplification system:

[0090] KASP MIX 1.5 μl, ddH2O 1.5 μl, DNA 3.0 μl (50 ng / μl), primer mixture 3 μl.

[0091] PCR system addition process:

[0092] Forward primer 1, forward primer 2, reverse primer and ddH2O were prepared in the ratio of 2:2:5:248 to form a primer working solution; 3 μl DNA template was added to the PCR plate and dried at 65°C; 3 μl primer working solution was added again and dried at 65°C; finally, 1.5 μl KASP MIX and 1.5 μl ddH2O were added to complete the PCR system.

[0093] PCR reaction procedure:

[0094] Touchdown PCR was used: pre-denaturation at 94°C for 10 min; denaturation at 95°C for 20 s; annealing at 61-55°C for 40 s, 10 cycles, with a decrease of 0.6°C in each cycle; denaturation at 95°C for 20 s, annealing at 55°C for 40 s, 51 cycles; fluorescence recording at 35°C for 30 s.

[0095] (2) Fluorescence detection of PCR samples of Hemerocallis plants

[0096] QuantStudio 6 was used to perform fluorescence detection on PCR products, and the results showed that:

[0097] KASP-GAUT showed T / T homozygous genotype in 62 night-flowering germplasm materials, and the fluorescent signal was displayed in blue.

[0098] Among the 76 germplasm materials of KASP-GAUT that flowered during the day, 27 showed T / C heterozygous genotypes, with the fluorescent signal displayed in green; and 49 showed C / C homozygous genotypes, with the fluorescent signal displayed in red.

[0099] Therefore, the daily flowering time phenotypes of the above 138 germplasm materials are consistent with the KASP genotype identification results, indicating that the auxiliary selection rate of the KASP marker of the present invention for the flowering time type of the natural population of Hemerocallis is 100%. Therefore, in practical application, for the molecular marker KASP-GAUT, if the PCR product is a characteristic sequence of 57 bp (sequence as shown in SEQ ID NO.1) or a blue fluorescent signal, the material to be tested is a night-flowering Hemerocallis plant variety; if the PCR product is a characteristic sequence of 57 bp (sequence as shown in SEQ ID NO.2) or a green or red fluorescent signal, the variety is a day-flowering Hemerocallis plant ( Figure 5 ). By analyzing the amplified characteristic sequence or fluorescent signal, the daily flowering time type of the material can be determined.

[0100] In summary, the molecular markers screened in the present invention can be used for auxiliary screening of daily flowering time types of Hemerocallis plants, laying a foundation for molecular marker-assisted breeding of daily flowering time traits and accelerating the molecular breeding process of daily flowering time traits of Hemerocallis plants.

[0101] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker co-segregating with a gene regulating daily flowering time in Hemerocallis plants, characterized in that: The molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2, and the primer pair for amplifying the molecular marker consists of two allele-specific forward primer sequences shown in SEQ ID NO.3 and SEQ ID NO.4, and a universal reverse primer sequence shown in SEQ ID NO.

5.

2. The molecular marker co-segregating with the daily flowering time regulating gene of Hemerocallis plants according to claim 1, characterized in that: The molecular marker is a KASP marker.

3. Use of the molecular marker co-segregated with the daily flowering time regulating gene of Hemerocallis plants according to claim 1 in identifying or assisting in identifying the daily flowering time type of Hemerocallis plants, characterized in that: The flowering time type includes a night-flowering type or a day-flowering type.

4. A method for determining the daily flowering time trait / variety of Hemerocallis plants, characterized in that: The determination method comprises the following steps: (1) extracting genomic DNA of the Hemerocallis plant to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and sequencing or fluorescent quantitative PCR detection of the PCR amplification product; (3) Determine based on the sequencing result or fluorescence signal of step (2), the specific criteria are: If the PCR amplification product is a characteristic band with a length of 57 bp as shown in SEQ ID NO.1, or the fluorescent signal is a blue punctuation fluorescent signal of the homozygous genotype T / T, then the Hemerocallis plant material to be tested is a night-flowering trait / variety; if the PCR amplification product is a characteristic band with a length of 57 bp as shown in SEQ ID NO.2, or the fluorescent signal is a red punctuation fluorescent signal of the homozygous genotype C / C and a green punctuation fluorescent signal of the heterozygous genotype T / C, then the Hemerocallis plant material to be tested is a daytime flowering trait / variety.

5. A kit for identifying the daily flowering time trait of Hemerocallis plants, characterized in that: Comprising the primer pair described in claim 1.

6. Use of a reagent for detecting the presence of a KASP marker in localizing the GAUT gene regulating the daily flowering time of Hemerocallis plants, characterized in that: The primer pair for amplifying the molecular marker consists of two allele-specific forward primer sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, and a universal reverse primer sequence as shown in SEQ ID NO.5.

Images