Molecular marker for detecting functional variation of wheat pre-harvest sprouting resistance gene TaVP1-3B and application of molecular marker in breeding
By developing the molecular marker VP1-3B_CDS1548, which is used to detect functional variation of the wheat ear germination gene, solved the problem of yield and quality deterioration caused by wheat ear germination, and achieved efficient screening of ear germination wheat varieties, significantly improving breeding efficiency.
Patent Information
- Application Number
- CN202411971313.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-05-06
AI Technical Summary
The germination of wheat ears leads to reduced yield and deterioration of quality, and the prior art is difficult to effectively solve this problem.
A molecular marker VP1-3B_CDS1548, which detects functional mutations of the wheat ear-resistant germination gene, was developed. Through KASP high-throughput SNP marking technology, G/A single-base mutations at 1548 bp of the CDS region of the TaVP1-3B gene in different wheat varieties were distinguished, and excellent germplasms with anti-spike germination genotypes were screened.
Through the auxiliary selection of this molecular marker, wheat varieties with ear-resistant germination characteristics were screened, which significantly improved the efficiency of wheat ear-resistant germination and breeding and reduced the harm of ear-germination.
Smart Images
Figure CN119932220A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of wheat breeding, and in particular to a method for detecting wheat ear sprout resistance genes. TaVP1-3B Molecular markers of functional variation and their applications in breeding. Background Art
[0002] Wheat is one of the three major grain crops in my country. Pre-harvest Sprouting (PHS) can lead to reduced wheat yield and deterioration of quality. It occurs in major wheat-producing areas around the world, causing losses of about US$1 billion each year, posing a serious threat to wheat production. The harm of pre-harvest sprouting to crops is mainly reflected in three aspects: first, after pre-harvest sprouting, the stored materials in the grains are continuously hydrolyzed and consumed, resulting in a decrease in bulk density and thousand-grain weight, which seriously affects crop yields; second, pre-harvest sprouting weakens the germination potential of seeds, resulting in small and weak seedlings, and even causing a serious decrease in the emergence rate, causing significant economic losses to farmers and seed operators; third, pre-harvest sprouting reduces the content of nutrients in seeds, resulting in reduced ductility, elasticity and water retention capacity of the dough, and changes in the gelatinization, gelatinization and regeneration properties of starch, which significantly affects the quality of rice noodles, noodles, cakes and bread.
[0003] Exploring ear sprout resistance genes / sites, developing functional markers for rapid and high-throughput detection of ear sprout resistance genes / sites, screening excellent germplasm with excellent ear sprout resistance genes / sites, cultivating ear sprout-resistant wheat varieties and promoting their planting are effective means to alleviate the harm caused by wheat ear sprout. TaVP1-3B It is on chromosome 3B of wheat Viviparous-1 ( VP-1 ) gene homologous to VP-1 and Arabidopsis thaliana abscisic acid-regulated genes ( Abscisic Acid Insensitive3 , ABI3 ) and plays an important regulatory role in seed dormancy. vp1 / abi3 The mutants showed weak dormancy and prone to spike sprouting, and it has been confirmed that TaVP1-3B The expression level of was positively correlated with wheat spike germination resistance. TaVP1-3B Functional variants affecting ear sprout resistance, development of high-throughput detection TaVP1-3B Molecular markers for functional variation, screening for TaVP1-3B The germplasm resources of ear sprout resistance genotypes and the improvement of wheat ear sprout resistance breeding process are of great significance for reducing the damage caused by wheat ear sprout. Summary of the invention
[0004] The present invention aims to provide a method for detecting wheat ear sprout resistance gene TaVP1-3B Molecular markers of functional variation and their applications in breeding.
[0005] The present invention protects a method for detecting wheat ear sprout resistance gene TaVP1-3B Molecular marker VP1-3B_CDS1548 for functional allele variation in CDS region, based on the anti-ear sprout gene TaVP1-3B The G / A single base mutation at 1548 bp in the CDS region was designed to distinguish TaVP1-3B The SNP at 1548 bp in the CDS region of the gene was used to detect the genotype of this SNP in different wheat varieties, among which the genotype for ear sprouting resistance was G / G, and the genotype for ear sprouting sensitivity was A / A.
[0006] The present invention also protects a primer pair for amplifying the above molecular marker, which is a KASP high-throughput SNP marker, including 2 forward primers and 1 reverse primer; the primer sequences are as follows: VP1-3B_CDS1548-FAM: 5'GATGGATGGCAAGAGGTGTTT 3', the nucleotide sequence of which is shown in SEQ ID NO.1; VP1-3B_CDS1548-HEX: 5' GATGGATGGCAAGAGGTGTTC 3' , the nucleotide sequence of which is shown in SEQ ID NO.2.
[0007] VP1-3B_CDS1548-R: 5' CAGGCGTCGGCTTCCAAT 3', the nucleotide sequence of which is shown in SEQ ID NO.3.
[0008] The present invention also protects a detection kit containing the primer pair for identifying KASP molecular markers related to wheat ear sprout resistance traits.
[0009] The present invention also protects the use of the above primer pair or the above detection kit in molecular marker-assisted wheat ear sprout resistance selection breeding, and the specific operation is: Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; The Applied Biosystems™ QuantStudio™ 1 Plus Real-time Fluorescence Quantitative PCR System was used to perform genotyping on the amplified PCR products, and the distribution results of SNPs in wheat were collected. The judgment criteria were the color of the points and the position of the points on the horizontal or vertical axis: the signal was blue, clustered near the vertical axis and clustered together with the anti-ear sprouting control parent, and was judged to be the anti-ear sprouting genotype G / G; the signal was red, clustered together with the horizontal axis and the susceptible ear sprouting control parent, and was judged to be the susceptible ear sprouting genotype A / A.
[0010] The molecular marker VP1-3B_CDS1548 provided by the present invention can correctly distinguish the functional variation site SNP1548 that has a significant impact on the ear sprouting resistance of wheat. According to the result, marker-assisted selection is performed in combination with the ear sprouting phenotype to screen excellent germplasm containing the ear sprouting resistance site for wheat ear sprouting resistance breeding, thereby improving breeding efficiency and accelerating the wheat ear sprouting resistance breeding process. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 Anti-ear sprouting gene TaVP1-3B Identification of functional allelic variants in the CDS region; Figure 2a , Figure 2b , Figure 2c , Figure 2d This is the genotyping map of the molecular marker VP1-3B_CDS1548 in 299 wheat varieties; Figure 3a , Figure 3b , Figure 3c The results of detecting the molecular marker VP1-3B_CDS1548 in 140 wheat varieties. DETAILED DESCRIPTION
[0012] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below in conjunction with the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present invention more thoroughly understood.
[0013] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The technical scheme of the present invention is described more clearly and completely below in conjunction with specific embodiments and comparative examples.
[0014] Note: The wheat varieties (lines) used in the embodiments of the present invention are all parent groups or varieties (lines) constructed from conventional parent varieties, and can be obtained from the market or other public channels.
[0015] 1. Extraction of wheat genomic DNA 1) At the three-leaf stage of wheat, young wheat leaves were selected, numbered, and placed in corresponding 2 mL 96-well plates. They were dried using a freeze dryer and ground into powder using a high-throughput tissue grinder. 2) Add 800 μL of CTAB solution and place in a 65°C water bath for 60 minutes, shaking gently 3-5 times to fully lyse the DNA; 3) Add 800 μL of chloroform-isoamyl alcohol (volume ratio 24:1) and shake gently for 10 minutes (operate in a fume hood); 4) Centrifuge at 12000 rpm for 10 min, extract 600 μL of supernatant and place in a new 96-well plate with the corresponding serial number, add an equal volume of isopropanol and 1 / 10 volume of 3M sodium acetate to the supernatant; 5) Centrifuge at 12,000 rpm for 10 min in a high-speed refrigerated centrifuge, discard the supernatant, and wash twice with ice-cold ethanol (70%); 6) After drying until there is no ethanol smell, add 200 μL of double distilled water, dissolve completely and store in a -20℃ refrigerator.
[0016] 2. Primer Design Comparison of anti-ear sprouting genes using wheat pan-genome TaVP1-3B CDS sequence, and found allelic variation at 1548bp of CDS sequence ( Figure 1 As shown in FIG. 1 ), the KASP marker was designed using Primer Premier software: the marker primers included 2 forward primers and 1 reverse primer, which were shown in SEQ NO.1, SEQ NO.2 and SEQ NO.3 respectively.
[0017] 3. Primer Dilution and Assay Primer Mixing The three primers were diluted to 100 μM with ultrapure water and then mixed in a volume ratio of FAM: HEX: R: ultrapure water = 6:6:15:23. The mixed assay primers were stored in a -20°C refrigerator for later use.
[0018] 4. PCR Amplification The PCR amplification system was prepared with the following ratios: 5 μL DNA template, 5 μL 2× Master Mix (LGC group UK) and 0.14 μL KASP primer mixture (synthesized by Shanghai Sangon Biotechnology Co., Ltd.).
[0019] The KASP marker PCR amplification procedure is: 1) 94°C for 15 min; 2) 94℃ 20s; 3) 65℃-57℃ for 1 min; Step 2) ~ Step 3) 10 cycles, each cycle at -0.8℃; 4) 94℃ 20s; 5) 57°C for 1 min, step 4) to step 5) for 30 cycles; 6) Store at 4℃.
[0020] V. Results Analysis The amplified PCR products were genotyped using the Applied Biosystems™ QuantStudio™ 1 Plus Real-time Fluorescence Quantitative PCR System, and the distribution results of SNPs in wheat were collected (as shown in Figure 2). The judgment criteria were the color of the points and the position of the points clustered on the horizontal or vertical axis: the signal was blue, clustered near the vertical axis and clustered together with the anti-ear sprout control parent, and was judged to be the anti-ear sprout genotype G / G; the signal was red, clustered together with the horizontal axis and the susceptible ear sprout control parent, and was judged to be the susceptible ear sprout genotype A / A.
[0021] 6. Anti-ear sprouting gene TaVP1-3B / Verification of the effect of molecular marker VP1-3B_CDS1548 in wheat ear sprout resistance breeding The molecular markers provided by the present invention were used to detect 297 wheat varieties, and 187 wheat varieties with ear sprout resistance genotypes (genotype G / G) and 110 wheat varieties with ear sprout sensitivity genotypes (genotype A / A) were obtained. The ear germination rate of wheat varieties containing the ear sprout resistance genotype was significantly lower than that of wheat varieties containing the ear sprout sensitivity genotype, indicating that the ear sprout resistance gene TaVP1-3B The CDS region functional variation SNP1548 has a significant effect on wheat ear sprout resistance (see Figure 3). Based on the results and combined with the ear sprout phenotype, marker-assisted selection was performed to screen for excellent germplasm containing ear sprout resistance loci for wheat ear sprout resistance breeding, improve breeding efficiency, and accelerate the wheat ear sprout resistance breeding process.
[0022] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.
Claims
1. A method for detecting wheat ear sprout resistance gene TaVP1-3B Molecular markers of functional variation, characterized in that Anti-ear sprouting gene TaVP1-3B The G / A single base mutation at 1548 bp in the CDS region was designed to distinguish TaVP1-3B The SNP at 1548 bp in the CDS region of the gene was used to detect the genotype of this SNP in different wheat varieties, among which the genotype for ear sprouting resistance was G / G, and the genotype for ear sprouting sensitivity was A / A.
2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The molecular marker is a high-throughput KASP marker, including 2 forward primers and 1 reverse primer; the primer sequences are as follows: VP1-3B_CDS1548-FAM: 5'GATGGATGGCAAGAGGTGTTT 3', the nucleotide sequence of which is shown in SEQ ID NO.1; VP1-3B_CDS1548-HEX: 5'GATGGATGGCAAGAGGTGTTC 3', the nucleotide sequence of which is shown in SEQ ID NO.2; VP1-3B_CDS1548-R: 5' CAGGCGTCGGCTTCCAAT 3', the nucleotide sequence of which is shown in SEQ ID NO.
3.
3. A detection kit containing the primer pair according to claim 2 for identifying KASP molecular markers related to wheat ear sprout resistance traits.
4. Use of the primer pair according to claim 2 or the detection kit according to claim 3 in molecular marker-assisted wheat ear sprout resistance selection breeding.
5. The use according to claim 5, characterized in that: The specific operations are: Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; The amplified PCR products were genotyped using the Applied Biosystems™ QuantStudio™ 1 Plus Real-time Fluorescence Quantitative PCR System, and the distribution results of SNPs in wheat were collected. The judgment criteria were the color of the points and the position of the points on the horizontal or vertical axis: the signal was blue, clustered near the vertical axis and clustered together with the anti-ear sprout control parent, and was judged to be the anti-ear sprout genotype G / G; The signal is red, clustered with the horizontal axis and the susceptible ear germination control parent, and determined to be the susceptible ear germination genotype A / A.