Application of GPR146 inhibitor in preparation of medicine for treating wet age-related macular degeneration

Abstract

The invention discloses an application of a GPR146 inhibitor in preparation of a medicine for treating wet age-related macular degeneration. The invention discovers that the expression of the GPR146 in mice of a laser-induced CNV mouse model and a subretinal fibrosis model is obviously up-regulated. The GPR146 is knocked down by shRNA (short hairpin Ribonucleic Acid) in a mouse, so that CNV (Complex Number Virus), subretinal fibrosis and inflammation In an in-vitro experiment, the siRNA of the targeted GPR146 can inhibit proliferation, migration, tubulation and other in-vitro neovascularization functions of endothelial cells, and immune cell adhesion and migration through endothelial cells are reduced. In addition, the targeting GPR146 can also inhibit the endothelial cells from expressing fibrosis promoting molecules such as TGF-beta, Fibronectin (FN), alpha-SMA, Col1A, MMP9 and the like. Meanwhile, the target GPR146 can also inhibit proliferation and migration of smooth muscle cells and reduce expression of the fibrosis promoting molecules. The results show that the targeted GPR146 can significantly inhibit CNV formation, inflammation and subretinal fibrosis, and has a good treatment effect.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and specifically designs the use of a GPR146 inhibitor in the preparation of a drug for treating wet age-related macular degeneration. Background Art

[0002] Age-related macular degeneration (AMD), also known as age-related macular degeneration, is an eye degenerative disease that mainly affects the vision of people over 50 years old and is one of the main causes of irreversible blindness. It is estimated that there are about 196 million people with AMD in the world in 2020, and this number is expected to increase to 288 million by 2040, which will bring a huge burden to medical and health care. AMD is mainly divided into two forms: dry AMD and wet AMD (wAMD). wAMD is the main type of blindness in AMD patients, accounting for more than 90% of all AMD blindness cases. In wAMD, the formation of choroidal neovascularization (CNV) is a key pathological feature. The current main clinical method for treating wAMD is to inhibit the formation of choroidal neovascularization by intraocular injection of anti-VEGF antibodies or fusion proteins. This method can inhibit the proliferation of vascular endothelial cells and reduce the leakage of new blood vessels, thereby alleviating the visual impairment of some wAMD patients to a certain extent. However, with the development of the application of anti-VEGF drugs, the shortcomings and deficiencies of anti-VEGF treatment have gradually emerged. For example, anti-VEGF drugs cannot antagonize all types of neovascularization, so anti-VEGF treatment is only effective for some wAMD patients; long-term intravitreal injection of anti-VEGF drugs increases the risk of complications such as endophthalmitis, lens damage, retinal detachment, and retinal pigment epithelial tear; and anti-VEGF is difficult to solve problems such as inflammation and subretinal fibrosis. More importantly, studies have shown that after anti-VEGF treatment, about half of wAMD patients will develop subretinal fibrosis, which will cause damage to photoreceptors, retinal pigment epithelium (RPE) and choroidal capillaries, leading to irreversible vision loss. In addition, more and more studies have shown that endothelial cells can directly promote the fibrosis process through endothelial cell to myofibroblast transition (EndMT), and can also indirectly promote fibrosis by secreting various pro-fibrotic and pro-inflammatory mediators, thereby activating fibroblasts and recruiting inflammatory / immune cells, further promoting fibrosis. However, there is currently no clear pathogenic mechanism and therapeutic target for subretinal fibrosis. Therefore, how to effectively inhibit subretinal fibrosis in wAMD has become a key point in the treatment of wAMD, and it is urgent to find new targets that can effectively prevent subretinal fibrosis in wAMD.

[0003] G protein-coupled receptor 146 (GPR146) is an orphan G protein-coupled receptor. Current studies have shown that GPR146 can promote atherosclerosis and pulmonary artery remodeling; in addition, GPR146 is also associated with liver fibrosis. These studies reveal the possible role of GPR146 in fibrosis. However, the role of GPR146 in subretinal fibrosis in CNV has not been reported, and no ophthalmic drugs targeting GPR146 have entered the clinical research stage. Summary of the invention

[0004] The purpose of the present invention is to provide the use of a GPR146 inhibitor in the preparation of a drug for treating wet age-related macular degeneration.

[0005] Therefore, the first object of the present invention is to provide the use of GPR146 as a target in screening drugs that inhibit the angiogenesis, inflammation and fibrosis-promoting abilities of endothelial cells and smooth muscle cells.

[0006] Preferably, the drug includes but is not limited to a drug for preventing and / or treating wet age-related macular degeneration.

[0007] Preferably, the drug is a drug that downregulates the expression of GPR146.

[0008] The second object of the present invention is to provide a drug for regulating the expression of GPR146 for use in the preparation of a drug for inhibiting the angiogenesis, inflammation and fibrosis-promoting ability of endothelial cells and smooth muscle cells.

[0009] Preferably, the drug includes but is not limited to a drug for preventing and / or treating wet age-related macular degeneration.

[0010] Preferably, the drug is an inhibitor of GPR146.

[0011] Preferably, the drug comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is an inhibitor of GPR146.

[0012] Preferably, the GPR146 inhibitor includes a small molecule inhibitor targeting the GPR146 protein and a nucleotide that inhibits the expression of the GPR146 protein.

[0013] Preferably, the nucleotides that inhibit the expression of GPR146 protein include siRNA or shRNA.

[0014] Preferably, the siRNA is CCACUUCUCUACCGCUACA.

[0015] Preferably, the shRNA is CCGGGCATTATCTGGGCATCCTACACTCGAGTGTAGGATGCCCAGATAATGCTTTTTG (SEQ ID NO. 1).

[0016] The present invention also provides a drug for inhibiting the angiogenesis, inflammation and fibrosis-promoting ability of endothelial cells and smooth muscle cells, such as a drug for treating wet age-related macular degeneration, which contains a GPR146 inhibitor as an active ingredient.

[0017] Preferably, the preparation of the drug is an ophthalmic preparation. Preferably, the ophthalmic preparation includes but is not limited to eye drops, eye ointments, eye sprays, eye gels, eye patches, intraocular injections, ophthalmic microspheres, ocular implants, periocular injections and ophthalmic sustained-release preparations.

[0018] The present invention found that GPR146 was significantly upregulated in mice with laser-induced CNV mouse models and subretinal fibrosis models. Knocking down GPR146 using shRNA in mice significantly inhibited CNV, subretinal fibrosis and inflammation. In vitro experiments using siRNA targeting GPR146 can inhibit the proliferation, migration, and tube formation of endothelial cells and other in vitro neovascularization functions, and reduce immune cell adhesion and transendothelial cell migration. In addition, targeting GPR146 can also inhibit endothelial cells from expressing profibrotic molecules such as TGF-β, Fibronectin (FN), α-SMA, Col1A, and MMP9. At the same time, targeting GPR146 can also inhibit the proliferation and migration of smooth muscle cells and reduce the expression of the above-mentioned profibrotic molecules. The above results all show that targeting GPR146 can significantly inhibit CNV formation, inflammation, and subretinal fibrosis, and has a good therapeutic effect. Therefore, the present invention provides a new therapeutic target and therapeutic strategy for wAMD, which has important clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Figure 1 is a mouse CNV model experiment, where A is a qPCR experiment to detect the expression of GPR146 in the RPE-choroid complex on the 7th day (D7) of CNV modeling and the 35th day (D35) after secondary modeling; B is a qPCR experiment to detect the knockdown efficiency of shGPR146. C, D, and E are immunofluorescence detections of angiogenesis, inflammatory response, and subretinal fibrosis in the RPE-choroid complex after knockdown of GPR146 in CNV mice (markers are IB4, Iba1, α-SMA, Coll1, respectively) (n=12), (scale bar=100μm).

[0020] Figure 2The results are as follows: The knockdown of GPR146 in HREC cells can detect the angiogenesis and inflammatory functions of endothelial cells in vitro. A is the qPCR verification of the knockdown efficiency of GPR146 in HREC cells (n=4); B is the CCK8 experiment to detect the proliferation ability of HREC cells 24 hours after knockdown of GPR146 (n=4); C is the detection of the migration ability of HREC cells after knockdown of GPR146 (n=4); D is the detection of the tube formation ability of HREC cells after knockdown of GPR146 (n=4). E is the detection of the ability of THP-1 cells to adhere to endothelial cells after knockdown of GPR146 in HREC cells under the stimulation of LPS (1μg / mL) (n=3); F is the detection of the transendothelial migration ability of THP-1 cells after knockdown of GPR146 in endothelial cells under the stimulation of LPS (n=3), (scale bar=50μm).

[0021] Figure 3 Figure 2 is the detection of endothelial cell expression of pro-fibrotic and inflammatory factors after knocking down GPR146 in HREC cells. Figure 3 is the detection of endothelial cell expression of pro-fibrotic and inflammatory factors after knocking down GPR146 in HREC cells. A is qPCR detection of the expression of many pro-fibrotic and inflammatory factors after knocking down GPR146 (n=4). Figure 4 The results of knocking down GPR146 in HUVSMC cells show that it affects the proliferation and migration of smooth muscle cells. A is the qPCR validation of the knockdown efficiency of GPR146 in HUVSMC (n=4); B is the CCK8 assay to detect the proliferation of HUVSMC cells 24 hours after knocking down GPR146 (n=4); C is the detection of the migration ability of HUVSMC cells after knocking down GPR146 (n=4).

[0022] Figure 5 A is the detection of smooth muscle cell expression of profibrotic factors and inflammatory factors after knocking down GPR146 in HUVSMC cells. B is the qPCR detection of the expression of many profibrotic factors and inflammatory factors after knocking down GPR146 (n=4). DETAILED DESCRIPTION

[0023] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the reagents and

[0024] Unless otherwise specified, all materials were obtained through commercial channels.

[0025] Human primary retinal endothelial cells (HREC) were purchased from Biopharmaceuticals (Shanghai) Co., Ltd.

[0026] Human primary umbilical vein smooth muscle cells (HUVSMC) were purchased from Shanghai Biotechnology Co., Ltd.

[0027] Human leukemia mononuclear cells (THP-1) were purchased from Angio-proteomie.

[0028] Table 1 siRNA sequence information

[0029] Sequence (5'-3') siCTRL UUCUCCGAACGUGUCACGU siGPR146 CCACUUCUCUACCGCUACA

[0030] Table 2 shRNA sequence information

[0031] Sequence (5'-3') shCTRL CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG shGPR146 CCGGGCATTATCTGGGCATCCTACACTCGAGTGTAGGATGCCCAGATAATGCTTTTTG

[0032] Table 3 qPCR primer sequence information

[0033]

[0034]

[0035] Experimental Example 1: Knockdown of GPR146 can inhibit pathological angiogenesis and reduce inflammation and fibrosis levels in CNV model mice 1. Plasmid construction

[0036] The shRNA targeting GPR146 (shown as shGPR146 in Table 2) was designed using pLKO.1 as a vector through the sigma website. The designed sequence was synthesized by Tsingke Biotechnology and ligated to the pLKO.1 vector using T4 DNA ligase. All plasmids were transformed using DH5α and extracted using a plasmid extraction kit (TIANGEN, DP117TA).

[0037] 2. Construction of mouse choroidal GPR146 knockdown and laser-induced choroidal neovascularization (CNV) model

[0038] 1) Four laser photocoagulation spots were irradiated to the eyes of adult mice (spot size 75 μm, power 90 mW, duration 75 ms) in an area 1.5-2 mm from the optical disc diameter. Laser photocoagulation was performed at 12, 3, 6, and 9 positions, avoiding large retinal vessels.

[0039] 2) Plasmid-PEI complex containing shGPR146 (as shown in shGPR146 in Table 2) or shCTRL (as shown in shCTRL in Table 2) was injected into the vitreous cavity of mice (1 ug of plasmid was injected per eye). Two days later, the mice were killed and the eyeballs were collected, and the RPE-choroid complex was isolated and qPCR was performed to verify the knockdown efficiency.

[0040] 3) Intravitreal injection of shGPR146 or shCTRL plasmid-PEI complex (1 ug plasmid per eye) and repeated injection on the third day after CNV.

[0041] 4) Collect eyes on day 7. Fix the eyeballs in 4% PFA for 1 hour, remove the cornea, lens, crystalline lens and vitreous body, and separate the RPE-choroid complex. Wash the RPE-choroid complex with PBS and block it with 5% donkey serum, 5% BSA and 0.5% Txiton X-100 for 1 hour.

[0042] 5) RPE-choroid was incubated with Alexa Fluor 488 (1:500)-conjugated isolectin GS-IB4 and Iba1 antibody (1:400) in 1% donkey serum, 1% BSA and 0.1% Txiton X-100 at 4°C overnight.

[0043] 6) Rinse the RPE-choroid complex with PBS, incubate with secondary antibody at room temperature for 1 hour, stain the nucleus with DAPI for 5 minutes, and wash three times with PBS. Place the complex flat with the RPE side facing up.

[0044] 7) Take images using a fluorescence microscope and analyze the CNV area using an image analysis software program.

[0045] 3. Immunofluorescence Staining

[0046] 1) Fix with 4% PFA for 30 min.

[0047] 2) Wash with PBS for 5 min, three times.

[0048] 3) Block with 5% BSA, 5% donkey serum and 0.5% Triton X-100 at room temperature for 1 h.

[0049] 4) Then add IB4 antibody (1:400), Ibal antibody (1:400), α-SMA (1:400), and Coll1 (1:400) respectively, and incubate at 4°C in the dark overnight.

[0050] 5) Wash three times with PBS, 5 min each time.

[0051] 6) Add secondary antibody and incubate at room temperature for 1 hour, remove secondary antibody, and stain cell nuclei with DAPI for 5 minutes.

[0052] 7) Wash three times with PBS, 5 min each time.

[0053] 8) After sealing with anti-fluorescence quencher, observe with a fluorescence microscope and take photos for record.

[0054] 4. Experimental Results

[0055] like Figure 1As shown in the figure, we detected the expression of GPR146 7 days and 35 days after CNV modeling. The results of qPCR experiments showed that the expression of GPR146 in the CNV model was significantly upregulated compared with the control group. In response to this, we designed shRNA targeting GPR146. Then CNV modeling was performed and shRNA was injected at the same time. After 7 days, the RPE-choroidal complex was taken and immunofluorescence staining was performed using markers of endothelial cells, fibrosis, and microglia / macrophages (IB4, α-SMA, Coll1, Ibal). The staining results showed that the area of ​​new blood vessels was significantly reduced, and the area of ​​subretinal fibrosis and the enrichment of microglia / macrophages were reduced. The results show that targeting GPR146 can significantly inhibit new blood vessels, subretinal fibrosis and inflammatory response.

[0056] Example 2: Knockdown of GPR146 in endothelial cells can inhibit endothelial cell proliferation, migration, and tube formation, reduce the ability of immune cells to adhere to endothelial cells and migrate across the endothelium, and reduce the expression of profibrotic and inflammatory factors.

[0057] 1. Recovery and culture of endothelial cells (HREC)

[0058] 1) Prepare complete endothelial cell culture medium: ECM 500 mL + 5% FBS + 1% P / S + 1% ECGS, and store at 4°C.

[0059] 2) Prepare 10×PBS: 2.7g potassium dihydrogen phosphate (KH2PO4) + 14.2g disodium hydrogen phosphate (Na2HPO4) + 80g sodium chloride (NaCl) + 2.0g potassium chloride (KCl), add ddH2O to make up to 1L, mix well, and store at room temperature. When using, add ddH2O to dilute to 1×PBS, and sterilize at high temperature before use.

[0060] 3) Preheat 50 mL of culture medium or PBS in a centrifuge tube.

[0061] 4) Take out the endothelial cell (HREC) cryopreservation tube from the liquid nitrogen tank, put it into a 37°C constant temperature water bath, and thaw it quickly.

[0062] 5) Transfer the suspension to a centrifuge tube, centrifuge at 300 g for 3-5 min, and aspirate the supernatant.

[0063] 6) Resuspend the cells and transfer to a clean culture dish and culture in a CO2 incubator. After the cells adhere to the wall, change the medium every two days.

[0064] 7) Observe under a microscope and subculture when the cell clones grow and the cell density reaches more than 90%. After 2-3 generations, the cells can be used for experiments.

[0065] 2. Passaging of HRECs

[0066] 1) Rinse cells twice with 1× PBS.

[0067] 2) Add 0.05% trypsin to digest the cells. After incubating in the incubator for 1 minute, gently shake the culture dish and loose cell clones can be seen under a microscope.

[0068] 3) Add culture medium to terminate digestion, spread the cells into a new culture dish at a ratio of 1:3, shake the cell suspension, and place the culture dish back into a 37°C CO2 incubator for culture.

[0069] 3. siRNA Transfection

[0070] 1) siRNA dissolution: centrifuge the siRNA freeze-dried powder to make the siRNA on the wall centrifuge to the bottom of the EP tube, add 250 μL RNase-free H2O to 5 nmol of siRNA freeze-dried powder in each tube to dissolve it, prepare a storage solution with a final concentration of 20 μM, divide it into 20 μL / tube, and store it at -20°C.

[0071] 2) When the cell confluence reached 80%, siRNA targeting GPR146 (siGPR146 in Table 1) or control siRNA (siCTRL in Table 1) was transfected with the transfection reagent Escort TM IV (Sigma, Cat. No. L3287) was prepared according to the ratio in Table 3 below: TM IV mixture. Escort TM IV and siRNA were mixed and gently mixed, avoiding shaking, and allowed to stand at room temperature for more than 5 minutes. The above mixture was added dropwise into the cell culture dish, and the dish was gently shaken to mix, so as to knock down the expression of GPR146.

[0072] Table 3

[0073] Petri dish siRNA (μL) Opti-MEM(μL) <![CDATA[Escort TM IV(μL)]]> 24-well plate 0.75 50 1.5 12-well plate 1.5 100 3 6-well plate 3 200 7.5 6cm 7.5 400 15

[0074] 3) Cell samples were collected 48 h after siRNA transfection and qPCR was performed to verify the knockdown efficiency, and endothelial cell function was measured 48-72 h after transfection.

[0075] 4. Cell Proliferation Assay

[0076] HREC cells were seeded in 96-well plates at 8,000 cells per well, and after adherence, siGPR146 was transfected for 24 h (see 3. siRNA transfection for specific methods). The medium was replaced with 100 μl of CCK8-ECM (ECM:CCK8=9:1) and cultured for another 4 h. The absorbance was measured at 450 nm using a BioTek EL×800 absorbance microplate reader.

[0077] 5. Endothelial Cell Migration Assay

[0078] 1) HRECs treated with siRNA for 24 h were seeded in 24-well plates.

[0079] 2) Use a 200 μL pipette tip perpendicular to the cells to scratch the cells horizontally, at least three wells per group.

[0080] 3) The cells were washed three times with ECM, induced and photographed under a microscope.

[0081] 4) Place the cells in an incubator and take photos again after 12 hours.

[0082] 6. Endothelial Cell Tube Formation Assay

[0083] 1) One day in advance, place the 96-well plate, 200ul pipette tip, and matrigel in a 4-degree refrigerator for precooling.

[0084] 2) Add 50ul of matrigel into the pre-cooled 96-well plate and incubate in the incubator for 30 minutes.

[0085] 3) HRECs treated with siRNA for 48 hours were seeded in the above well plate, the cells were placed in an incubator, and photographed after 6 hours.

[0086] 7. Cell Adhesion Assay

[0087] 1) HREC (8.0×10 4 / well) were seeded in 24-well plates.

[0088] 2) Add 1 μg / mL LPS and treat for 4 h, then wash 3 times with PBS.

[0089] 3) THP-1 (2.5×10 5 / well) cells for 30 min.

[0090] 4) AM-labeled THP-1 cells were incubated with HRECs for 2 h.

[0091] 5) Wash three times with PBS to remove non-adherent THP-1 cells.

[0092] 6) Adherent THP-1 cells from 12 randomly selected visual fields were captured using a fluorescence microscope (Zeiss, Germany) and analyzed by Image.

[0093] 8. THP-1 cell transendothelial migration assay

[0094] 1) HRECs (5.0×10 4 Cells were seeded into each upper chamber and cultured to allow the cells to adhere to the wall and form a monolayer of cells.

[0095] 2) Treat the attached THP-1 cells with 2.5 μM calcein AM for 30 min. Centrifuge to remove the culture medium, resuspend the THP-1 cells in 1640 culture medium containing 1% FBS, and place the resuspended THP-1 cells (5×10 5 / well) were added to the upper chamber.

[0096] 3) 1640 medium containing 10% FBS, 50 ng / mL CCL2, and 1 μg / ml LPS was added to the lower chamber.

[0097] 4) After 12 hours, the THP-1 cells that migrated in the lower chamber were transferred to new wells and treated with 150 ng / mL phorbol 12-myristate 13-acetate (PMA) for 12 hours to allow the THP-1 cells to adhere to the wall. Twelve randomly selected areas were captured using a fluorescence microscope and analyzed by Image.

[0098] 9. Cell RNA extraction, reverse cDNA and qRT-PCR

[0099] 1) Take cells grown to 80% density, discard the culture medium, wash once with PBS, add 600 μL Trizol to lyse the cells, and transfer to a 1.5 mL centrifuge tube.

[0100] 2) Add 120 μL of chloroform, shake vigorously for 20 seconds, let stand for 5 minutes, and centrifuge at 4°C for 15 minutes, 15,000 rpm.

[0101] 3) Pipette the supernatant into a new centrifuge tube, but avoid the middle layer; add pre-cooled isopropanol to the supernatant at a ratio of 1:1, mix well, let stand at -20℃ for 20 minutes, and centrifuge at 4℃ for 15 minutes at 12000rpm.

[0102] 4) Discard the supernatant and add 500 μL of 75% pre-cooled ethanol.

[0103] 5) Centrifuge at 4℃ for 5 min, discard the supernatant, add 500μL 95% pre-cooled ethanol, centrifuge at 4℃ for 5 min, discard the supernatant, invert the centrifuge tube on clean absorbent paper, wait until the white precipitate at the bottom of the tube becomes transparent, add 20μL DEPC H2O, and invert directly or store at -20℃.

[0104] 6) The concentration of the obtained total RNA was measured using an ELISA reader, and 2 μg of total RNA for each sample was reversed and cDNA was synthesized using the FastKing RT kit with DNase (TIANGEN).

[0105] 7) Using the synthesized cDNA as a template, the gene expression level was detected on an ABI QuantStudio 6Flex device (Life Technologies) PCR instrument according to the SYBR Green (ROCHE) kit;

[0106] 8) Using ACTIN as the internal reference gene, the expression of each gene was calculated using the delta-delta Ct method. The primer sequences of each gene were obtained from the Primer bank website, as shown in Table 3.

[0107] 10. Experimental Results

[0108] 1) If Figure 2 As shown in the figure, we designed siRNA targeting GPR146 and knocked down the expression of GPR146 in HREC cells. The CCK8 experiment was used to detect the effect of GPR146 on the proliferation of endothelial cells. The results showed that knocking down GPR146 could significantly inhibit the proliferation of endothelial cells ( Figure 2 B). The effect of GPR146 on endothelial cell migration was detected by scratch assay. The results showed that knocking down GPR146 could inhibit endothelial cell migration ( Figure 2 C); Endothelial cell tube formation assay was used to detect the effect of GPR146 on the ability of endothelial cells to form tubes in vitro. The results showed that knocking down GPR146 could inhibit the ability of endothelial cells to form tubes in vitro ( Figure 2 D). These results suggest the effect of GPR146 on angiogenesis. To detect the effect of GPR146 on inflammatory response in endothelial cells, we performed leukocyte adhesion and leukocyte transendothelial migration experiments. HRECs with knockdown of GPR146 were seeded in 24-well plates, treated with LPS for 4 hours, and then calcein-labeled THP-1 cells were incubated with HRECs for 2 hours and then observed under a microscope. It was found that after knockdown of GPR146 in endothelial cells, the ability of HREC cells to adhere to immune cells decreased ( Figure 2 E). HREC cells with GPR146 knockdown were inoculated in the upper chamber, and THP-1 cells treated with calcein were inoculated in the upper chamber under the stimulation of LPS and low serum concentration culture conditions. The lower chamber was cultured with normal serum concentration. After 12 hours, PMA was added to the lower chamber to make THP-1 cells adhere to the wall and photographed. The results showed that the ability of immune cells to migrate across the endothelium was weakened after knocking down GPR146 in endothelial cells ( Figure 2 F).

[0109] 2) If Figure 3 As shown, to further understand the effects of GPR146 on endothelial cell inflammation and fibrosis, we knocked down GPR146 in endothelial cells HREC and detected the expression of many molecules related to fibrosis and inflammation. The results showed that knocking down GPR146 significantly inhibited the expression of endothelial cells in profibrotic molecules and inflammatory factors, indicating that GPR146 has a strong regulatory effect on the profibrotic and inflammatory functions of endothelial cells ( Figure 3 ).

[0110] Example 3: Knockdown of GPR146 in smooth muscle cells can inhibit smooth muscle cell proliferation and migration and inhibit the expression of profibrotic and inflammatory factors.

[0111] 1. Recovery and culture of smooth muscle cells (HUVSMC)

[0112] 1) Prepare smooth muscle cell complete culture medium: SMCM 500 mL + 5% FBS + 1% P / S + 1% SMCGS, and store at 4° C. Other operations are similar to those for endothelial cells (HREC), see above for details.

[0113] 2. Smooth muscle cell migration (transwell method)

[0114] 1) HUVSMCs treated with siGPR146 for 24 h were transferred to the upper chamber of the transwell at a density of 5 w cells per well and cultured with a medium containing 1% FBS.

[0115] 2) Add culture medium containing 10 ng / ml PDGF-BB + 5% FBS to the lower chamber to attract HUVSMC migration.

[0116] 3) After 12-24 hours of migration, the transwell was removed and fixed with 4% PFA for 15 minutes, washed three times with PBS, stained with crystal violet solution for 3-5 minutes, and the excess crystal violet was washed away with water.

[0117] 4) Gently wipe away the unmigrated cells in the upper chamber of the transwell with a cotton swab, exposing only the migrated cells, and take photos and count them under white light.

[0118] 3. Experimental results

[0119] 1) If Figure 4 As shown in the figure, we designed siRNA targeting GPR146 and knocked down the expression of GPR146 in HUVSMC cells. The CCK8 experiment was used to detect the effect of GPR146 on the proliferation of smooth muscle cells. The results showed that knocking down GPR146 could significantly inhibit the proliferation of smooth muscle cells ( Figure 4B). The effect of GPR146 on the migration of smooth muscle cells was detected by transwell migration assay. The results showed that knocking down GPR146 could inhibit the migration of smooth muscle cells ( Figure 4 C).

[0120] 2) If Figure 5 As shown, to further understand the effects of GPR146 on smooth muscle cell inflammation and fibrosis. After knocking down GPR146 in smooth muscle cells HREC, we detected the expression of many molecules related to fibrosis and inflammation. The results showed that knocking down GPR146 significantly inhibited the expression of profibrotic molecules and inflammatory factors in smooth muscle cells, indicating that GPR146 has a strong regulatory effect on the profibrotic and inflammatory functions of smooth muscle cells ( Figure 5 ).

[0121] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Application of GPR146 as a target in screening drugs that inhibit angiogenesis, inflammation and profibrosis in endothelial cells and smooth muscle cells.

2. The use according to claim 1, characterized in that: The drugs include but are not limited to drugs for preventing and / or treating wet age-related macular degeneration.

3. The use according to claim 1 or 2, characterized in that: The drug is a drug that downregulates the expression of GPR146.

4. The use of drugs that regulate the expression of GPR146 in the preparation of drugs that inhibit the angiogenesis, inflammation and profibrosis of endothelial cells and smooth muscle cells.

5. The use according to claim 4, characterized in that: The drugs include but are not limited to drugs for preventing and / or treating wet age-related macular degeneration.

6. The use according to claim 4 or 5, characterized in that: The drug is an inhibitor of GPR146.

7. The use according to claim 4, characterized in that: The medicine comprises a pharmaceutically acceptable carrier and an effective amount of active ingredients, wherein the active ingredients are inhibitors of GPR146.

8. The use according to claim 7, characterized in that: The GPR146 inhibitors include small molecule inhibitors targeting the GPR146 protein and nucleotides that inhibit the expression of the GPR146 protein.

9. The use according to claim 8, characterized in that: The nucleotide that inhibits the expression of GPR146 protein is siRNA or shRNA.

10. The use according to claim 9, characterized in that: The siRNA is CCACUUCUCUACCGCUACA; the shRNA is CCGGGCATTATCTGGGCATCCTACACTCGAGTGTAGGATGCCCAGATAATGCTTTTTG.

Images