Application of porcine parainfluenza virus type 5 as expression vector

Abstract

The invention provides application of a porcine parainfluenza virus type 5 as an expression vector, and belongs to the technical field of biological vaccines. According to the invention, a PIV5 strain separated from diarrhea pigs in Jiangsu Province in China is utilized to construct PIV5 virus infectious clone. The eGFP gene is inserted into a PIV5 infectious cloned virus genome, the recombinant PIV5 virus capable of expressing the green fluorescent protein is successfully rescued, and when the eGFP gene is inserted into a P / M gene spacer region, the expression quantity is the highest, which indicates that an exogenous gene expression cassette can influence the expression level of an exogenous gene, and the P / M gene spacer region is the optimal site for inserting the exogenous gene, so that the recombinant PIV5 virus can be successfully rescued. And a solid foundation is laid for developing a vector vaccine by utilizing the swine PIV5. The porcine parainfluenza virus type 5 can be used as an expression vector to express foreign proteins, can also be used for preparing oral vaccines, and can relieve the stress reaction of pigs in the immune process.

Description

Technical Field

[0001] The present invention relates to the field of biological vaccine technology, and in particular to the application of swine parainfluenza virus type 5 as an expression vector. Background Art

[0002] Parainfluenza virus 5 (PIV5) belongs to the family Paramyxoviridae and the genus Rubulavirus. It is a single-stranded negative-sense RNA virus. The virus was first discovered in simian cells in 1956, so it is called simian virus 5. According to serological surveys, the virus is distributed worldwide and has a wide host range, including dogs, cats, hamsters, guinea pigs and cattle. PIV5 is the smallest member of the family Paramyxoviridae known to date. It is a negative-sense single-stranded RNA virus with an unsegmented genome length of 15,246 nucleotides. Starting from the 3' end, the genome encodes 8 proteins, namely nucleocapsid protein (N), V protein (V), phosphoprotein (P), matrix protein (M), fusion protein (F), small hydrophobic protein (SH), hemagglutinin neuraminidase (HN) and RNA polymerase large protein (L). As a negative-strand RNA virus, the related vaccines constructed with it as a vector have obvious advantages, such as foreign genes are not easily deleted and genes do not recombine with host DNA. Since PIV5 can be transmitted horizontally through the respiratory tract, the most common vaccine form is a nasal spray vaccine to control respiratory viral infections. Nasal spray vaccines have the characteristics of rapid onset and long-lasting protection; oral vaccines have the advantages of good immune effects, low cost, and easy vaccination. They can quickly produce an immune barrier in the intestinal mucosa and reduce the risk of virus transmission. Therefore, it is of great significance to develop a recombinant viral vector of PIV5 that can be used to prepare nasal spray or oral vaccines and increase the expression of exogenous genes. Summary of the invention

[0003] The purpose of the present invention is to provide an application of using swine parainfluenza virus type 5 as an expression vector to solve the problem that some vaccines cannot be nasally sprayed or orally and the expression amount of exogenous genes is low.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides the use of swine parainfluenza virus type 5 as an expression vector in the preparation of vaccines.

[0006] The present invention provides a set of primer combinations for cloning a full-length infectious clone of porcine PIV5, including the following primers:

[0007]

[0008] The present invention also provides a method for preparing the swine parainfluenza virus type 5 infectious clone, comprising the following steps:

[0009] S1. Extract RNA of the fifth generation PIV5-JS17 virus and obtain cDNA by reverse transcription;

[0010] The fifth generation cDNA of S2.JS17 strain was used as a template, and A-F1 and A-R1 were used as primers to amplify the A fragment, B-F2 and B-R2 were used as primers to amplify the B fragment, C-F3 and C-R3 were used as primers to amplify the C fragment, D-F4 and D-R4-1 were used as primers to amplify the D1 fragment, and D-F4 and D-R4-2 were used as primers to amplify the D2 fragment using the D1 fragment as a template; the A fragment, B fragment, C fragment and D2 fragment were inserted into the POK12 vector by fusion PCR technology to obtain the full-length plasmid POK12-JS17;

[0011] S3. Using the fifth generation cDNA of JS17 strain as a template, NF and NR were used as primers to amplify the PIV5-N gene, PF and PR were used as primers to amplify the PIV5-R gene, and LF and LR were used as primers to amplify the PIV5-L gene. The PIV5-N, P, and L genes were recombined with the pCAGGS vector to obtain the pCAGGS-N, pCAGGS-P, and pCAGGS-L auxiliary plasmids;

[0012] S4. Insert the exogenous gene into the plasmid POK12-JS17 to obtain a recombinant plasmid;

[0013] S5. Use the recombinant plasmid and the pCAGGS-N, pCAGGS-P, pCAGGS-L auxiliary plasmids and the T7 polymerase expression plasmid to rescue the virus to obtain the swine parainfluenza virus type 5 expression vector.

[0014] Preferably, the exogenous gene includes eGPF.

[0015] Preferably, the insertion site of the exogenous protein is the P / M gene spacer region of the POK12-JS17 plasmid.

[0016] Preferably, in the virus rescue step, the ratio of the recombinant plasmid, the auxiliary plasmids pCAGGS-N, P, L and the T7 polymerase expression plasmid is 3:1:0.3:1.5:2.

[0017] Preferably, the amplification reaction system is 50 μL: 2 μL of JS17 strain P5 generation cDNA, 1 μL of upstream and downstream primers, 25 μL of Q5Hot Start High-Fidelity 2×MasterMix, 25 μL of H 2 O 21 μL.

[0018] Preferably, the amplification reaction procedure is: pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 1min, for 40 cycles; and final extension at 72°C for 2min.

[0019] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention uses a PIV5 strain isolated from diarrhea pigs in Jiangsu Province, China to construct a PIV5 virus infectious clone. The eGFP gene was inserted into the PIV5 infectious clone virus genome, and the recombinant PIV5 virus that can express the green fluorescent protein was successfully rescued. It was found that when the eGFP gene was inserted into the P / M gene spacer, the expression level was the highest, indicating that the exogenous gene expression cassette will affect the expression level of the exogenous gene. The P / M gene spacer is the best site for inserting exogenous genes, which lays a solid foundation for the development of vector vaccines using porcine PIV5. Using the porcine parainfluenza virus type 5 of the present invention as an expression vector, an oral vaccine can be prepared, which can reduce the stress response of pigs during the immunization process. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the isolation, culture and identification of the PIV5-JS17 strain, where A is the virus morphology under an electron microscope; B is the electrophoresis diagram after the virus genome is amplified by the whole genome primers; and C is the electrophoresis diagram of the actual sequences of the 5' and 3' ends of the virus amplified by the RACE primers.

[0021] Figure 2 The fluorescence intensities at different insertion sites of the recombinant virus and at different days after transfection of BHK-21 cells.

[0022] Figure 3 Comparison of green fluorescence intensity of viruses with different insertion sites at different infection days.

[0023] Figure 4 RT-qPCR analysis of eGFP expression at different insertion sites on different infection days. DETAILED DESCRIPTION

[0024] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0025] Example 1

[0026] 1. Virus Isolation

[0027] Intestinal samples of diarrheal piglets were collected from Jiangsu Province, China. The intestinal tissues of the piglets were ground in liquid nitrogen, and the ground samples were collected. 200 μL PBS was added to every 30 mg. After vigorous shaking, the supernatant was centrifuged at 8000g for 15 min and passed through a 0.22 μm filter (Merck Millipore). The filtrate was mixed with DMEM (Procell, China) containing 5% penicillin, gentamicin and streptomycin at a ratio of 1:3. Then it was added to a T25 culture flask containing Vero E6 monolayer cells (purchased from Shanghai Yaji Biotechnology Co., Ltd.). After 2 hours, the mixture was removed and washed twice with DMEM. DMEM containing 1% penicillin, gentamicin and streptomycin was added, cultured for 4 days, blindly passaged for 3 generations, and stored at -80°C.

[0028] Remove the cells and centrifuge at 5000g for 15 minutes at 4°C to remove cell debris. Collect the supernatant and centrifuge at 100,000g for 2.5 hours at 4°C in an ultracentrifuge. Collect the precipitate and resuspend it with 1 ml of DMEM in each tube, then centrifuge at 100,000g for 2.5 hours at 4°C through a 60% (w / v) sucrose cushion. Collect the white bands formed by virus particles at the interface of the sucrose solution, and elute the sucrose with PBS for 2.5 hours. Add the purified virus dropwise onto a copper grid, stain with phosphotungstic acid for 5 to 10 seconds, and then observe under a transmission electron microscope (Hitachi H-7650). The virus morphology is as follows: Figure 1 As shown in A.

[0029] 2. Viral Whole Genome Amplification

[0030] Based on the morphology of the virus, it was speculated that the virus might be PIV5 virus, so further testing was performed. Whole genome primers were designed to amplify the entire genome of the virus, including the actual sequences at the 5' and 3' ends. The specific steps are as follows:

[0031] According to the instructions, RNA was extracted from 140 μL of JS17 virus culture medium using QIAamp Viral RNA Extraction Kit (QIAGEN) and eluted with 30 μL of RNase- and DNase-free water. Using JS17 virus RNA as template and oligo(dT) primers in the kit, PrimeScript TM One-step RT-PCR kit was used for RT-PCR, and the primers in Table 1 were used for amplification to obtain a fragment containing the whole genome of JS17. The reaction system was 50 μL: Prime Script 1step Enzyme Mix 2 μL, 2×1step buffer 25 μL; RNase Free d H 2O 19μL, 1μL each of upstream and downstream primers (10μM), 2μL template RNA. Place in a PCR instrument, reverse transcribe at 50℃ for 30min, inactivate reverse transcriptase / pre-denaturation at 98℃ for 5min; denature at 98℃ for 10s, anneal at 55℃ for 30s, extend at 72℃ (extend for 1min per 1kb), for a total of 40 cycles; finally, final extension at 72℃ for 10min. After the PCR reaction is completed, perform electrophoresis detection with 1% agarose gel.

[0032] Table 1 Primers used for PIV5-JS17 whole genome amplification

[0033]

[0034]

[0035] Using the cDNA of JS17 virus as a template and the RACE primers in Table 2, the 5' and 3' ends were amplified using the rapid amplification of cDNA ends (RACE) technique.

[0036] Table 2 5' / 3' RACE primers of PIV5-JS17 strain

[0037] Primer name Primer sequence (5'-3') Sequence number Target fragment length 5'GSP1 GCAGCAGGTTGGTCTGGCG SEQ ID NO:27 720bp 5'NGSP1 AAGCGATGGGAATCCCTTGC SEQ ID NO:28 360bp 3'NGSP2 GAAGCAGGACTTGGAATTCGGCATA SEQ ID NO:29 366bp 3'GSP2 ATCGTAGCAGAAGCAATTGATAAGG SEQ ID NO:30 730bp

[0038] The amplification procedure is as follows:

[0039] a. Preparation of 5'RACE and 3'RACE-Ready cDNA

[0040] (1) Take a PCR reaction tube, mix the reagents according to the following system, centrifuge briefly, and let stand at room temperature:

[0041] 5×First-StrandBuffer 2.0μL DTT(20mM) 1.0μL dNTPMix (10 mM) 1.0μL

[0042] (2) Take another PCR tube and add reagents according to the following system:

[0043] RNA 1.0-2.75μL 5' / 3'-CDSPrimerA 1μL <![CDATA[ddH 2 The]]> Make up to 3.75 μL

[0044] Mix the reagents, incubate at 72℃ for 3min, cool at 42℃ for 2min, and finally centrifuge at 14000rpm for 10sec; add 1μL SMARTer IIAoligo to each PCR tube, mix well, and centrifuge instantly.

[0045] (3) At room temperature, mix the following reagents in the following order:

[0046]

[0047] (4) Add the denatured RNA in step (2) to 5.25 μL of the mixture in step (3), with the volume of each tube being 10 μL. Use a pipette to gently mix the reagents and centrifuge briefly. Incubate at 42°C for 90 min and heat at 70°C for 10 min to terminate the reaction.

[0048] b. PCR amplification

[0049] Reagents Volume (μL) 2×PCR Premix 25 5' / 3'RACEcDNA 2.5 UPM 5 GSP1 / GSP2 1 <![CDATA[ddH 2 The]]> 16.5 Total 50

[0050] Amplification was performed according to the following program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles; and extension at 72°C for 10 min.

[0051] The electrophoresis of the amplified fragments of the whole genome amplification primers is shown in Figure 1 The actual sequences at the 5' and 3' ends are shown in B. Figure 1 As shown in C. The amplified fragments were sequenced and spliced ​​to obtain the full genome sequence of PIV5-JS17. The sequence was compared with the full genome sequences of other PIV5 strains published in GenBank. The comparison results showed that a new PIV5 strain was isolated, which did not cause Vero E6 cell pathology in vitro. The GenBank accession number of the full genome sequence of the strain is OR888917.1.

[0052] 3. Construction of reverse genetics system

[0053] In order to construct the reverse genetic system of PIV5-JS17, the viral genome was divided into 4 fragments, which covered the 4 fragments of the full length of the PIV5-JS17 genome. The primers are shown in Table 3. The 5th generation cDNA of JS17 strain was used as a template, A-F1 and A-R1 were used as primers to amplify the A fragment, B-F2 and B-R2 were used as primers to amplify the B fragment, C-F3 and C-R3 were used as primers to amplify the C fragment, D-F4 and D-R4-1 were used as primers to amplify the D1 fragment, and then the gel recovery product of the D1 fragment was used as a template, and D-F4 and D-R4-2 were used as primers to amplify the D2 fragment. PCR amplification was performed using Q5 Hot Start High-Fidelity 2×MasterMix produced by NEB. The reaction system is shown in Table 3:

[0054] Table 3 Reaction system

[0055] Reagents Volume (μL) JS17 strain P5 cDNA 2 Upstream primer (10pmol / μL) 1 Downstream primer (10pmol / μL) 1 Q5HotStartHigh-Fidelity2×MasterMix 25 Nuclease-FreeWater 21 Total 50

[0056] The reaction procedure was: 98°C pre-denaturation for 30s; 98°C denaturation for 10s, 60°C annealing for 30s, 72°C extension for 1min, 40 cycles; and 72°C final extension for 2min. After the PCR reaction, the product was analyzed by 1% agarose gel electrophoresis. Then, using the seamless cloning kit (D7010S Seamless Cloning Kit), these fragments were inserted into the POK12 vector (purchased from Addgene official website) using fusion PCR technology to obtain the full-length plasmid POK12-JS17.

[0057] Table 4 Primers for whole genome segment cloning

[0058]

[0059]

[0060] PIV5 is a negative-strand RNA virus that requires the viral RNA-dependent RNA polymerase (RdRp) complex to assist transcription and translation. Therefore, three eukaryotic expression auxiliary plasmids pCAGGS-N, pCAGGS-P, and pCAGGS-L were constructed. The specific method is as follows:

[0061] The PIV5-JS17 virus was subcultured to the fifth generation, and the PIV5-N, P, and L genes and the T7 RNA polymerase gene were amplified by PCR. The fifth-generation cDNA of the JS17 strain was used as a template. The PCR reaction system and procedure were as above. The primers used are shown in Table 5. According to the instructions of ClonExpress Ultra One Step Cloning KitV2 (Nanjing Novogene Biotech Co., Ltd.), the PCR product was homologously recombined with the PCAGGS vector to construct three auxiliary plasmids pCAGGS-N, pCAGGS-P, and pCAGGS-L. The T7 polymerase expression plasmid (pCAGCS-T7opt) was purchased from the Addgene official website.

[0062] Table 5 Primers for auxiliary plasmid construction

[0063] Primer name Primer sequence (5'-3') Sequence number NF ttccagattacgctgaattcATGTCATCCGTGCTTAAAGCATATG SEQ ID NO:40 NR ccatcgatgagctcgaattcCTAGATGTCAAGATCACCCAGT SEQ ID NO:41 PF ttccagattacgctgaattcATGGATCCCACTGATCTGAGCT SEQ ID NO:42 PR ccatcgatgagctcgaattcTCAAATTGCACTGCGGATGATTG SEQ ID NO:43 LF ttccagattacgctgaattcATGGCTGGGTCTCGGGAG SEQ ID NO:44 LR ccatcgatgagctcgaattcTTAGATTTCCTCGCCATCGATC SEQ ID NO:45

[0064] Using the primers listed in Table 6, pEGFP-N1 vector (purchased from Beijing Biolab Technology Co., Ltd.) was used as a template to PCR amplify the eGFP exogenous gene expression cassette. The PCR system and reaction procedure were as above. The PCR product was homologously recombined with the POK12-JS17 vector using ClonExpress Ultra OneStep Cloning KitV2 (Nanjing Novogene Biotechnology Co., Ltd.), and then the eGFP exogenous gene expression cassette was inserted into the intergenic regions N / P, P / M, M / F, F / SH, SH / HN, and HN / L, respectively. Six plasmids with different insertion sites were constructed: JS17-NPGFP, JS17-PMGFP, JS17-MFGFP, JS17-FSHHGFP, JS17-SHHNGFP, and JS16-HNLGFP.

[0065] Table 6 Primers used for eGFP insertion into different sites

[0066]

[0067]

[0068] Among them, the six plasmids JS17-NPGFP, JS17-PMGFP, JS17-MFGFP, JS17-FSHHGFP, JS17-SHHNGFP, and JS17-HNLGFP are plasmids expressing the whole genome of rPIV5-JS17 with the eGFP exogenous gene inserted. The insertion sites of the eGFP exogenous gene are different in the six plasmids;

[0069] pCAGGS-N, pCAGGS-P, pCAGGS-L, and T7 polymerase expression plasmid (pCAGCS-T7opt) are helper plasmids.

[0070] 4. Construction and rescue of recombinant viruses at different insertion sites

[0071] The BHK-21 cells in good growth state were evenly spread in a 12-well plate in DMEM medium containing 10% serum. When the cell fusion rate reached 90%, the rPIV5-JS17 whole genome plasmid and auxiliary plasmid were co-transfected into BHK-21 cells using the JetOPTIMUS transfection kit (Polyplus). The specific operation is: the rPIV5-JS17 whole genome plasmid and pCAGGS-N, pCAGGS-P, pCAGGS-L and T7 polymerase expression plasmid (pCAGCS-T7opt) were mixed with JetOPTIMUS buffer. The amount of each plasmid is shown in Table 7:

[0072] Table 7 Amount of each plasmid

[0073] Plasmids Dosage rPIV5-JS17 full genome plasmid 1.5 μg pCAGGS-N 0.5 μg pCAGGS-P 0.15 μg pCAGGS-L 0.75 μg pCAGCS-T7op 1 μg

[0074] After mixing the above plasmids in JetOPTIMUS buffer, add 2.9 μL jetOPTIMUS-DNA transfection reagent, mix well, incubate at room temperature for 10 min, and then add to a 12-well plate. Incubate at 37°C, 5% CO 2 The cells were cultured at -80°C, half of the culture medium was replaced on the 4th day after transfection, and the cultures were collected on the 7th day and stored at -80°C.

[0075] 5. Quantitative Evaluation of eGFP Fluorescence Intensity

[0076] Different strains of rPIV5-JS17 virus were selected to infect Vero E6 cells (MOI = 1). The fluorescence was observed and recorded using an inverted fluorescence microscope EVOS FLAuto 2 (Thermo Fisher Scientific) at 1 day, 3 days, and 5 days after infection to ensure that the background setting remained consistent throughout the process. The fluorescence intensity of eGFP was analyzed using EvosnAnalysis software. The results are shown in Figure 2. Figure 3 shown. Figure 3 It showed that at 1, 3, and 5 dpi, there was no obvious cytopathic effect (CPE), but EGFP fluorescence gradually increased. Fluorescence microscopy observed that the JS17-PMGFP fluorescence was brightest at 7 dpi, and all six viruses emitted green fluorescence, indicating that the plasmids encoding the full genome of rPIV5-JS17 successfully produced progeny viruses expressing eGFP.

[0077] At the same time, the EGFP fluorescence intensity was digitized by EvosnAnalysis software. The order of fluorescence intensity is as follows:

[0078] At 1dpi:

[0079] JS17-PMGFP>JS17-MFGFP>JS17-NPGFP>JS17-SHHNGFP>JS18-FSHG FP>JS17-HNLGFP;

[0080] At 3dpi:

[0081] JS17-PMGFP>JS17-NPGFP>JS17-SHNGFP>JS16-FSHGFP>JS17-MFGF P>JS18-HNLGFP;

[0082] At 5dpi:

[0083] JS17-PMGFP>JS17-NPGFP>JS17-FSHHGFP>JS17-SHHNGFP>JS16-MF GFP>JS18-HNLGFP.

[0084] Combination Figure 3 The statistical results of fluorescence by EvosnAnalysis software showed that the fluorescence of JS17-PMGFP was brightest at 1, 3, and 5 dpi, indicating that the intergenic region between P / M genes is most conducive to the expression of exogenous genes.

[0085] 6. Detection of exogenous gene expression by fluorescent quantitative PCR (RT-qPCR)

[0086] Vero E6 cells were infected with rPIV5-JS17 virus (MOI = 1) with different insertion sites. The specific steps were as follows: cells were plated in 24-well plates. After the cells grew into a monolayer, the virus solution was diluted to 500 μL with DMEM culture medium containing 2% serum and added to the 24-well plate. RNA was extracted according to the instructions of the RNA extraction kit (Simply P Total RNA Extraction Kit, BioFlux) 1 day, 3 days and 5 days after virus infection (dpi). PrimeScript TM First-strand cDNA synthesis kit (TAKARA) was used for reverse transcription into cDNA. TB Green Premix Ex Taq TM Tli RNaseH Plus ROX plus (TAKARA) was used in QuantStudio TM 5 Real-time quantitative PCR instrument was used for qPCR, and the primers used were for eGFP and GAPDH. The specific information is shown in Table 8. The expression level of eGFP was standardized based on the expression of GAPDH. -ΔΔCt The relative gene expression was calculated by Figure 4 shown.

[0087] Table 8 Fluorescence quantitative PCR primers

[0088] Primer name Sequence (5'-3') Sequence number eGFP-F CAGGAGCGCACCATCTTCTT SEQ ID NO:58 eGFP-R CGATGCCCTTCAGCTCGAT SEQ ID NO:59 GAPDH-F TCGGAGTCAACGGATTTGGT SEQ ID NO:60 GAPDH-R ACATGTAAACCATGTAGTTGAGGT SEQ ID NO:61

[0089] Figure 4 The results showed that at 1, 3, and 5 dpi, the expression of exogenous EGFP in JS17-PMGFP was the highest among all rPIV5-JS17 virus samples, indicating that the P / M gene spacer is the best site for inserting exogenous genes.

[0090] It can be seen from the above examples that the present invention provides an application of using swine parainfluenza virus type 5 as an expression vector. Using the swine parainfluenza virus type 5 prepared by the present invention as an expression vector, oral and nasal spray vaccines can be constructed.

[0091] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of swine parainfluenza virus type 5 as an expression vector in vaccine preparation.

2. A primer combination for full-length infectious clone of porcine PIV5, including the following primers:

3. A method for preparing an infectious clone of swine parainfluenza virus type 5, characterized in that: The following steps are included: S1. Extract RNA of the fifth generation PIV5-JS17 virus and obtain cDNA by reverse transcription; The fifth generation cDNA of S2.JS17 strain was used as a template, and A-F1 and A-R1 were used as primers to amplify the A fragment, B-F2 and B-R2 were used as primers to amplify the B fragment, C-F3 and C-R3 were used as primers to amplify the C fragment, D-F4 and D-R4-1 were used as primers to amplify the D1 fragment, and D-F4 and D-R4-2 were used as primers to amplify the D2 fragment using the D1 fragment as a template; the A fragment, B fragment, C fragment and D2 fragment were inserted into the POK12 vector by fusion PCR technology to obtain the full-length plasmid POK12-JS17; S3. Using the fifth generation cDNA of JS17 strain as a template, NF and NR were used as primers to amplify the PIV5-N gene, PF and PR were used as primers to amplify the PIV5-R gene, and LF and LR were used as primers to amplify the PIV5-L gene. The PIV5-N, P, and L genes were homologously recombined with the pCAGGS vector to obtain the pCAGGS-N, pCAGGS-P, and pCAGGS-L auxiliary plasmids; S4. Insert the exogenous gene into the plasmid POK12-JS17 to obtain a recombinant plasmid; S5. Use the recombinant plasmid and the pCAGGS-N, pCAGGS-P, pCAGGS-L auxiliary plasmids and the T7 polymerase expression plasmid to rescue the virus to obtain the swine parainfluenza virus type 5 expression vector.

4. The preparation method according to claim 3, characterized in that: The exogenous gene includes eGFP protein.

5. The preparation method according to claim 4, characterized in that: The insertion site of the exogenous protein is the P / M gene spacer of the POK12-JS17 plasmid.

6. The preparation method according to claim 5, characterized in that: The ratio of the recombinant plasmid, the auxiliary plasmid pCAGGS-N, P, L and the T7 polymerase expression plasmid in the virus rescue step is: 3:1:0.3:1.5:

2.

7. The preparation method according to claim 6, characterized in that: The amplification reaction system is 50 μL: 2 μL of JS17 strain P5 generation cDNA, 1 μL of upstream and downstream primers, 25 μL of Q5 Hot Start High-Fidelity 2×MasterMix, and 1 μL of H2O2.

8. The preparation method according to claim 7, characterized in that: The amplification reaction procedure is: pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 1min, 40 cycles; and final extension at 72°C for 2min.

Images