Adjuvant as well as preparation method and application thereof

Abstract

The invention provides a preparation method and application of a mixed adjuvant containing aluminum and manganese. The mixed adjuvant comprises an aluminum-containing compound and a manganese-containing compound. Wherein the aluminum-containing compound and the manganese-containing compound are preferably hydroxide gel of aluminum and manganese. The mixed adjuvant provided by the invention can enter a body in an injection manner, can enhance natural immune response, improve tumor killing effect and the like while jointly activating humoral immune and cellular immune response, and can be used for vaccines and immunotherapy.

Description

Technical Field

[0001] The present disclosure relates to a biological product, and in particular to an adjuvant that can be used in humans or other animals. Background Art

[0002] Vaccines are an effective means of preventing infectious diseases and treating major diseases. New vaccines such as split vaccines, recombinant subunit vaccines, anti-idiotypic antibody vaccines, nucleic acid vaccines and synthetic peptide vaccines have clear ingredients and simple structures, and have good biosafety. However, these vaccines often fail to induce effective immune responses, and adjuvants need to be added to enhance the immune response, thereby improving the protective effect of the vaccine.

[0003] Aluminum adjuvants have been used clinically for nearly a hundred years since the 1920s and are currently the most widely used vaccine adjuvant. Aluminum adjuvants can adsorb protein antigens, form antigen reservoirs at the injection site, slowly release antigens, and induce inflammatory responses, thereby increasing the activity of immune cells at the injection site and their sensitivity to antigens, thereby promoting immune responses. However, aluminum adjuvants cannot enter cells along with antigens, making them unable to play a role in the subsequent intracellular presentation of antigens. Therefore, aluminum adjuvants cannot induce Th1-type cellular immune responses, but can only induce humoral immunity. This deficiency of aluminum adjuvants limits their application in areas such as infectious disease treatment and tumor immunotherapy.

[0004] At present, the strategy to enhance the immune response of aluminum adjuvants is mainly to add immune-activating substances. Monophosphatidyl A (MPLA) is a synthetic bacterial lipopolysaccharide analogue approved for use by the FDA in 2009. It is mixed with aluminum adjuvant (AS04) for use in Cervarix, a cervical cancer vaccine for preventing human papillomavirus (HPV) infection. In addition, immunostimulants such as epidermal growth factor receptor EGFR, double-stranded polynucleoside-ε-polylysine-sulfated polysaccharide complex, and non-competitive inhibitors of indoleamine-2,3-dioxygenase are also used to mix with aluminum adjuvants.

[0005] Manganese is one of the most important essential trace elements for the human body. It can promote bone growth and development, maintain normal brain function, and maintain normal sugar metabolism and fat metabolism, playing an irreplaceable role in the human body. 2+ In cells, it can activate the cGAS-STING pathway, induce the secretion of type I interferon (IFN-I) and pro-inflammatory cytokines, and play an important role in defending against viral and intracellular bacterial infections and regulating the spontaneous anti-tumor immune response in vivo. 2+ ) is metabolized quickly after injection as an adjuvant and cannot effectively exert its adjuvant effect. The adjuvant nano-manganese (nano-Mn) that emerged as the times require overcomes this shortcoming. Manganese adjuvant can maintain Mn locally. 2+The sustained release of manganese continuously activates the cGAS-STING pathway, promotes the uptake and maturation of antigens by dendritic cells (DCs), and ultimately induces a strong Th1 cell immune response. Therefore, manganese adjuvants have been used as new adjuvants in various preventive or therapeutic vaccines.

[0006] However, as a heavy metal, manganese has a toxic effect that has affected the clinical transformation of manganese adjuvants. The main target of manganese is the central nervous system. When manganese is excessive, it will preferentially accumulate in the basal ganglia, leading to manganese poisoning. The main symptoms of manganese poisoning are mental and cognitive defects and movement disorders. Summary of the invention

[0007] The present disclosure provides a composition comprising aluminum and manganese, an immunogenic agent comprising the composition, and use of the composition and the immunogenic agent as an adjuvant in a vaccine or as an immunopotentiator.

[0008] The present disclosure provides a composition, which comprises, based on the total weight of the composition: 10% to 90%, preferably 40% to 60% of an aluminum-containing compound; and 10% to 90%, preferably 30% to 60% of a manganese-containing compound.

[0009] In some embodiments, the aluminum-containing compound comprises, for example, 10%, 20%, 30%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80% or 90% by weight of the total composition.

[0010] In some embodiments, the manganese-containing compound comprises, for example, 10%, 20%, 30%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80% or 90% by weight of the total composition.

[0011] In some embodiments, the mass ratio of aluminum to manganese in the composition is 1:5 to 5:1, preferably 1:3 to 3:1.

[0012] In some embodiments, the mass ratio of aluminum to manganese in the composition is, for example, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 3:2, 9:2. In the present disclosure, the mass ratio of aluminum to manganese in the composition refers to the mass ratio of aluminum element to manganese element in the composition.

[0013] In some embodiments, the molar ratio of aluminum to manganese in the composition is 1:3 to 10:1, preferably 2:3 to 6:1, for example 1:2, 1:3, 2:2, 2:1, 3:1, 3:2, 2:3, 3:4, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1.

[0014] In a more preferred embodiment, the molar ratio of aluminum to manganese in the composition is 3: 1, 3: 2, 3: 4, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 11: 1, 12: 1, 13: 1, 14: 1, 15: 1, 16: 1, 17: 1, 18: 1, 19: 1, 20: 1. In the present disclosure, the molar ratio of aluminum to manganese in the composition refers to the molar ratio of aluminum element to manganese element in the composition.

[0015] In some embodiments, the aluminum-containing compound is selected from any one of aluminum hydroxide, aluminum phosphate, potassium aluminum sulfate, aluminum sulfate, ammonium alum or potassium alum, or a combination of at least two thereof.

[0016] In some embodiments, the aluminum-containing compound is selected from any one of aluminum hydroxide gel, aluminum phosphate gel, potassium aluminum sulfate gel, aluminum sulfate gel, ammonium alum or potassium alum, or a combination of at least two of them, preferably any one of aluminum hydroxide gel, aluminum phosphate gel or potassium aluminum sulfate gel, or a combination of at least two of them.

[0017] In some embodiments, the manganese-containing compound is selected from a manganese salt or a manganese salt gel.

[0018] In some embodiments, the manganese-containing compound is "divalent manganese" or a "divalent manganese compound".

[0019] In some embodiments, the manganese-containing compound is manganese hydrochloride, carbonate, hydrobromide, sulfate, nitrate, phosphate, tartrate, fumarate, maleate, lactate, benzenesulfonate, pantothenate, ascorbate, or hydroxide.

[0020] In some embodiments, the manganese-containing compound is selected from any one or a combination of at least two of manganese phosphate, manganese carbonate, manganese hydroxide, manganese chloride, manganese nitrate or manganese sulfate.

[0021] In some embodiments, the aluminum-containing compound and the manganese-containing compound may be formulated into a composition for combined use, or may be formulated separately and then used in combination and then mixed extemporaneously before use.

[0022] In some embodiments, the composition is in the form of a mixture of an aluminum compound and a manganese compound, in the form of a hydroxide gel containing aluminum and manganese, in the form of an oil-in-water emulsion or a water-in-oil emulsion containing aluminum and manganese, or in the form of micro / nanoparticles containing aluminum and manganese.

[0023] In some embodiments, the composition further comprises a lipid or a surfactant.

[0024] In some embodiments, the composition comprising a lipid or a surfactant is in the form of particles.

[0025] In some embodiments, the composition is an immunogenic composition.

[0026] In some embodiments, the composition further comprises an aqueous phase, and the aqueous phase is any one of purified water, physiological saline for injection, phosphate buffer or citrate buffer, or a combination of at least two thereof.

[0027] In some embodiments, the pH value of the phosphate buffer or citrate buffer is 5.0 to 8.1, preferably 6.0 to 8.0. For example, the pH value of the phosphate buffer or citrate buffer is 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0 or 8.1.

[0028] In some embodiments, the composition further comprises an oil phase, which can be any oily substance that is non-toxic to the body and can be metabolized in the body, including any one of squalene, olive oil, soybean oil, corn oil, vitamin E (tocopherol), ethyl oleate, oleic acid, ethyl lactate, dimethicone, isopropyl laurate or capric triglyceride, or a combination of at least two thereof; preferably any one of squalene, olive oil or dimethicone, or a combination of at least two thereof.

[0029] In some embodiments, the composition is in the form of an oil-in-water emulsion, preferably an oil-in-water Pickering emulsion.

[0030] In some embodiments, the average particle size of the droplets in the oil-in-water emulsion is between 50 nm and 10 μm, preferably between 1 μm and 5 μm.

[0031] In some embodiments, the volume ratio of the oil-water phase in the oil-in-water emulsion is 1:100 to 1:1, preferably 1:50 to 1:2.

[0032] In some embodiments, the blended composition or the oil-in-water emulsion may contain a hydrophobic drug in its interior, and a hydrophilic drug may be added to the aqueous phase.

[0033] The hydrophobic drug includes any one of paclitaxel, all-trans retinoic acid, anastrozole or doxorubicin, or a combination of at least two thereof.

[0034] The hydrophilic drug includes any one of letrozole, interleukin or interferon, or a combination of at least two of them.

[0035] The composition disclosed herein can effectively enhance the natural immune response and the secretion of type I interferon. Type I interferon is secreted by innate immune cells, can promote the maturation and activation of dendritic cells, and enhance their antigen cross-presentation ability, thereby enhancing the specific killing of cytotoxic T cells against tumors.

[0036] In some embodiments, the composition further comprises an immunostimulatory agent.

[0037] The immunostimulant includes, but is not limited to, one or a combination of at least two of Toll-like receptor (TLR) agonists, cytokines, chemokines, cGAS-STING pathway agonists, saponins and analogs thereof.

[0038] The Toll-like receptor (TLR) agonist is selected from Toll-like receptor 4 (TLR4) agonist, Toll-like receptor 7 (TLR7) agonist, Toll-like receptor 8 (TLR8) agonist, Toll-like receptor 9 (TLR9) agonist, and Toll-like receptor 5 (TLR5) agonist.

[0039] In some embodiments, the composition further comprises any one or a combination of at least two of molecular adjuvants such as monophosphoryl lipid A (MPLA), cytosine guanine oligodeoxynucleotide (CpG ODN), imiquimod (R837), flagellin, and analogs thereof.

[0040] The cytokines include, but are not limited to, granulocyte macrophage colony stimulating factor (GM-CSF), interferons (such as interferon-α (IFN-α), interferon-β (IFN-β), interferon-γ (IFN-γ), etc.), interleukins (such as interleukin-1α (IL-1α), interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-7 (IL-7), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-18 (IL-18)), fetal liver tyrosine kinase 3 ligand (FIt3L) or tumor necrosis factor-α (TNF-α).

[0041] The cGAS-STING pathway agonist is selected from any one of cyclic dinucleotides, anthraquinones, aminobenzimidazoles, 3-imidazole-pyridazines, benzothiophenes or triazole quinoxalines, or a combination of at least two thereof.

[0042] The saponins and analogs thereof are preferably Quillaja saponin (QS-21).

[0043] The mixed adjuvant disclosed in the present invention is a new type of vaccine adjuvant, which can be used as a vaccine adjuvant or a drug carrier for immunotherapy, can induce a stronger cellular immune response, enhance the killing effect of T cells on tumor cells, and thus enhance the tumor killing effect of the vaccine.

[0044] The mixed adjuvant disclosed in the present invention is a vaccine adjuvant with better safety. After injection, the adjuvant is more concentrated in the injection site, reducing the targeting of aluminum and manganese to the brain and the aggregation of the nervous system, thereby reducing the neurotoxicity of the two metal elements aluminum and manganese. The biochemical analyzer is one of the important analytical instruments frequently used in clinical tests. It measures various biochemical indicators by analyzing blood or other body fluids. After the mixed adjuvant is injected, the various major biochemical indicators in the blood measured by the biochemical analyzer are all within the normal range, showing good biosafety.

[0045] In a second aspect, the present disclosure provides a method for preparing the composition of the first aspect, the method comprising the step of mixing an aluminum-containing compound and a manganese-containing compound.

[0046] In some embodiments, the method includes the step of dispersing and mixing the aluminum-containing compound and the manganese-containing compound in an aqueous phase. The dispersion can be performed by various methods such as oscillation, stirring, and ultrasound to achieve good dispersion in the aqueous phase.

[0047] In a third aspect, the present disclosure provides a vaccine comprising the composition of the first aspect.

[0048] In some embodiments, the vaccine further comprises an immunogen or an active fragment thereof.

[0049] In some embodiments, the vaccine further comprises pharmaceutically acceptable excipients, additives, diluents, buffers, sugars, amino acids, chelating agents, surfactants, polyols, fillers, stabilizers, lyoprotectants, solubilizers, emulsifiers, salts, adjuvants, tonicity increasing agents, delivery vehicles, and antimicrobial preservatives.

[0050] The vaccine can be used for immunization of a subject.

[0051] In a fourth aspect, the present disclosure provides use of the composition of the first aspect as an adjuvant.

[0052] The adjuvant is a vaccine adjuvant.

[0053] Compared with the prior art, the present invention has the following beneficial effects:

[0054] The aluminum-containing compound in the disclosed composition can activate Th2 humoral immune response, while the manganese-containing compound is better at activating Th1 cellular immune response. The combination of the two compounds in the same system can further enhance the immune effect of the body. The disclosure provides a new aluminum-manganese adjuvant that can enhance the body's immune response, especially an emulsion stabilized by aluminum-manganese adjuvants, which has excellent technical effects. For example, the mixed adjuvant can significantly enhance the body's natural immune response under the joint action of the two adjuvants. In terms of adaptive immune response, it can simultaneously enhance the body's humoral immunity and cellular immunity, and can achieve regulation of cellular immunity and humoral immunity. At the same time, the composition of the disclosure can effectively inhibit the growth of tumors after being mixed with antigens.

[0055] The composition disclosed in the present invention is a vaccine adjuvant with better safety. The adjuvant is more concentrated in the injection site after injection, reducing the targeting of aluminum and manganese to the brain and the aggregation of the nervous system, thereby reducing the neurotoxicity of the two metal elements aluminum and manganese. The biochemical analyzer is one of the important analytical instruments frequently used in clinical tests. It measures various biochemical indicators by analyzing blood or other body fluids. After the mixed adjuvant is injected, the various major biochemical indicators in the blood measured by the biochemical analyzer are all within the normal range, showing good biosafety. Immune regulation. At the same time, this mixed adjuvant mixed with the antigen and injected can effectively inhibit the growth of tumors.

[0056] The present disclosure combines aluminum adjuvant and manganese adjuvant for the first time to prepare a vaccine delivery system that can significantly enhance the body's immune response, and is applied to the field of vaccine adjuvant development. The addition of aluminum adjuvant can not only improve the safety of the preparation, but also can more effectively induce the body's humoral immune response; at the same time, the addition of manganese can enhance the body's natural immune response, thereby activating the cellular immune response that aluminum adjuvant is not good at, and the two work synergistically to exert a more powerful therapeutic effect. Various materials formed by aluminum and manganese can adsorb antigens as a carrier for antigen delivery, and the ratio of aluminum and manganese can be used to regulate the immune response. It can be used as a vaccine adjuvant or drug delivery system for preventive vaccines and immunotherapy. At the same time, the present disclosure provides new ideas for the design of new adjuvants.

[0057] The main immune enhancement mechanisms of aluminum manganese adjuvants in the present disclosure include:

[0058] (1) Aluminum adjuvant can first activate NLRP3 inflammasomes, promote the secretion of IL-1β, and induce monocytes to differentiate into mature dendritic cells. At the same time, the addition of manganese adjuvant also promotes the maturation of dendritic cells, which is beneficial to the cross-presentation of antigens, thereby enhancing cellular immunity; (2) The aluminum-manganese dual gel enhances the reservoir effect of the adjuvant, allowing the antigen to be released continuously at the injection site for a longer period of time; (3) The addition of aluminum adjuvant makes up for the disadvantage of the low antigen adsorption rate of manganese adjuvant and improves the antigen loading rate; (4) Aluminum adjuvant causes the antigen to be presented by MHC-Ⅱ, thereby inducing humoral immunity, while manganese adjuvant can effectively induce cellular immunity while strengthening humoral immunity. The two synergistically induce the production of antibodies and the proliferation and activation of T cells; (5) The mixed adjuvant is pH-sensitive and can continuously release Mn after entering the cell. 2+ , thereby continuously activating the cGAS-STING pathway.

[0059] Therefore, the aluminum-manganese mixed adjuvant disclosed in the present disclosure can be used as an immune adjuvant for vaccines, activating both humoral immunity and cellular immunity, and can be applied to vaccines and immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 Particle size distribution of the emulsion containing aluminum and manganese in Example 3.

[0061] Figure 2 Light microscopy of the emulsion containing aluminum and manganese in Example 3.

[0062] Figure 3 IFNβ1 gene expression in cells after treatment in Example 7.

[0063] Figure 4 IFNα1 gene expression in cells after treatment in Example 7.

[0064] Figure 5 Expression of CD80 on the cell surface after treatment in Example 7.

[0065] Figure 6 The number of IFNγ ELISpots in Example 8.

[0066] Figure 7 Tumor growth curves of the three strategies in Example 10. DETAILED DESCRIPTION

[0067] The technical solution of the present disclosure is further explained below with reference to the accompanying drawings and through specific implementation methods.

[0068] The composition of the present disclosure contains aluminum and manganese elements, and other elements include hydrogen, oxygen, phosphorus and nitrogen. The aluminum-containing compound and divalent manganese ions in the composition and immunogenic agent of the present disclosure play a major role, so these two elements are indispensable.

[0069] In the present disclosure, the ratio of the aluminum-containing compound to the manganese-containing compound can be regulated. According to different treatment conditions or treatment purposes, the ratio of the aluminum-containing compound to the manganese-containing compound can be flexibly adjusted to obtain the best effect.

[0070] The emulsion in the form of an oil-in-water emulsion disclosed herein comprises a metabolizable oil phase, an aqueous phase, an aluminum adjuvant and a manganese adjuvant. The emulsion can reduce the targeted enrichment of aluminum and manganese in the brain, has better neurological safety, and can induce a stronger immune response.

[0071] The term "manganese salt", "divalent manganese" or "manganese-containing compound" as used herein may refer to tartrate, hydrochloride, carbonate, hydrobromide, sulfate, nitrate, phosphate, fumarate, maleate, lactate, benzenesulfonate, pantothenate, ascorbate, hydroxide, etc. of divalent manganese, or any combination thereof. Preferably, the divalent manganese compound is pharmaceutically acceptable.

[0072] The term "manganese salt gel" used herein refers to a state in which divalent manganese exists in the form of a gel formed with anions. The particle size of the gel particles is generally about 1 to 100 nm.

[0073] As used herein, the term "subject" refers to animals, including warm-blooded mammals, such as humans and primates; birds; domesticated house or farm animals, such as cats, dogs, sheep, goats, cattle, horses, and pigs; laboratory animals, such as mice, rats, and guinea pigs; fish; reptiles; zoo animals and wild animals, etc.

[0074] Adjuvant: As used herein, the term "adjuvant" refers to a substance that can enhance the immune response to a target antigen or immunogen. An adjuvant is used in combination with a vaccine antigen to enhance (e.g., increase, accelerate, prolong and / or target) or modulate (e.g., convert a Th1 immune response to a Th2 response, or convert a humoral response to a cytotoxic T cell response) different types of specific immune responses to the vaccine antigen to enhance the clinical effectiveness of the vaccine.

[0075] In some embodiments, the adjuvant is capable of altering the (Th1 / Th2) immune response.

[0076] In some embodiments, the adjuvant is capable of enhancing the magnitude and durability of the immune response.

[0077] In some embodiments, the adjuvant is capable of amplifying the immune response to a concurrently administered antigen or immunogen.

[0078] In some embodiments, the adjuvant is capable of inducing a strong antibody response and a T cell response.

[0079] In some embodiments, the adjuvant can be used to reduce the amount of antigen or immunogen required to elicit a desired immune response and provide protection against disease.

[0080] In some embodiments, the adjuvants can be used to reduce the number of injections required in the clinic to induce a durable immune response and provide protection against disease.

[0081] The compositions or vaccines of the present disclosure can achieve enhancement of the humoral and / or cellular immunogenicity of vaccine antigens, especially subunit vaccine antigens.

[0082] The compositions or vaccines of the present disclosure can be administered through the eye (ocular), mouth (oral), skin (transdermal), nose (nasal), lung (inhalation), rectum, vagina, oral mucosa (buccal), ear, such as by injection (e.g., intravenous (IV), subcutaneous, intratumoral, intraperitoneal, intramuscular (IM), intradermal (ID)), etc.), spray, etc.

[0083] The immunogen or antigen described in the present disclosure may be from coronavirus, HIV, influenza virus, rabies virus, classical swine fever virus, blue ear disease virus, measles virus, Ebola virus, herpes virus, arbovirus (Zika virus, Japanese encephalitis virus, forest encephalitis virus, dengue virus, hantavirus, hemorrhagic fever virus).

[0084] The immunogens or antigens of the present disclosure may also be derived from tumor cells or tumor tissues.

[0085] The vaccine disclosed herein can be a nucleic acid vaccine (DNA or RNA vaccine), a recombinant protein subunit vaccine, a recombinant viral vector vaccine, a recombinant bacterial vector vaccine, a virus-like particle vaccine, a nanoparticle vaccine, a cell vector vaccine, and the like.

[0086] The vaccine disclosed herein can be a recombinant protein vaccine, a recombinant DNA vaccine, a recombinant viral vector vaccine (e.g., an adenovirus vector, a poxvirus vector, an adeno-associated virus vector, a herpes simplex virus vector, a cytomegalovirus vector), a recombinant bacterial vector vaccine, a recombinant yeast vector vaccine, or a recombinant virus-like particle vaccine.

[0087] The vaccine of the present disclosure may be selected from a recombinant DNA vaccine, a recombinant adenovirus vector, or a combination of one or both thereof.

[0088] The present disclosure can be realized by the following examples, but is not limited by the raw materials, instruments, ratios, compositions, methods, and steps in the following examples. It should be understood that the embodiments and implementations discussed here are only for illustration, and various improvements and variations can be proposed to those familiar with the art, and these improvements and variations will be included in the spirit and scope of the present application and within the scope of the appended claims.

[0089] The raw material information of the embodiment is as follows:

[0090]

[0091]

[0092] The instruments used in the examples are as follows:

[0093]

[0094]

[0095] Example method:

[0096] 1. Characterization of properties:

[0097] Particle size and potential distribution of mixed adjuvants: The particle size and potential distribution of mixed adjuvants were measured by dynamic light scattering using Zeta potential and particle size analyzer. The specific measurement steps are: dilute the prepared mixed adjuvant 50-100 times, take 1-2 mL of the diluted mixed adjuvant and add it to the sample pool, and put it into the Zeta potential analyzer and particle size analyzer (Nano Zeta Sizer, Malvern) for measurement.

[0098] 2. RNA extraction and RT-qPCR:

[0099] Discard the supernatant of the treated bone marrow-derived dendritic cells BMDC or human leukemia monocytes THP1 and other cells and wash them twice with PBS. Then add a total of 1 ml of Trizol to the duplicate wells, blow thoroughly and then aspirate into a sterile EP tube. Add 200 μl of chloroform to each sterile EP tube, mix thoroughly and let it stand in the fume hood for 10 minutes until stratification occurs, and turn on the 4°C centrifuge for precooling. Centrifuge at 14000g for 10 minutes at 4°C, and obvious stratification will appear in the EP tube. The upper clear layer is the RNA layer. Carefully aspirate the upper layer and then add an equal volume of isopropanol, and let it stand in the fume hood for 10 minutes. Centrifuge at 14000g for 10 minutes at 4°C, discard the upper liquid, and precipitate twice with 75% alcohol. The white clumps that appear are RNA. Discard the upper alcohol layer, centrifuge at 14000g for 30s at 4℃, drain the liquid, carefully precipitate the clumps, let it stand in the fume hood for 10min to dry, then add DEPC aqueous solution, measure the concentration, and store in a -80℃ refrigerator for later use. According to the purpose of the experiment, design different RT-qPCR primers and use real-time fluorescence quantitative detection of the transcriptome level.

[0100] 3. Extraction and maturation and activation of bone marrow-derived dendritic cells:

[0101] First, prepare complete dendritic cell (DC) culture medium by adding 10% FBS (v / v), 1% streptomycin and penicillin, 10ng / mL GM-CSF and 50ng / mL IL-4 to RPMI 1640. Then, separate the leg bones of the mice and flush out the bone marrow with 3mL RPMI 1640 culture medium to obtain bone marrow cell suspension. Add red blood cell lysis buffer to lyse the red blood cells, and collect the unlysed bone marrow hematopoietic stem cells by centrifugation. Then, 1×10 6 The isolated cells were carefully inoculated into a 24-well plate at a cell concentration of . The cells were cultured at 37°C. The medium was replaced by half every other day, and the changes in cell morphology and number were observed at any time. On the 6th day, the cells were collected, which were bone marrow-derived dendritic cells.

[0102] The mixed adjuvant was co-incubated with DC cells on the 6th day for 12 hours to examine the expression of co-stimulatory molecules on the surface of DCs in different treatment groups. FITC anti-mouse CD11c (Biolegend) flow cytometry antibody and PE anti-mouse CD80 (Biolegend) flow cytometry antibody were used to co-incubate with DCs in the dark at 4°C for 25 minutes. After washing twice with stain buffer, the samples were loaded on a flow cytometer for detection, and the expression of CD80 in the CD11c-positive DC population was analyzed.

[0103] 4. Animal experiment determination:

[0104] The C57BL / 6 mice used in the experiment were provided by Vital River Company.

[0105] (1) Elispot assay to determine IFN-γ levels in mouse spleen cells:

[0106] The mice were randomly divided into groups, with each group containing more than 6 mice for the experiment. The mice were grouped and immunized according to the specific instructions of the embodiment. After 28 days, the spleen cells of the mice were cultured and the spleen cells were cultured at 1×10 6 The concentration of each well is plated in a 96-well plate, and the stimulating antigen is added; the 96-well plate is placed in a cell culture incubator and incubated for 48 hours. Pour the cells and culture medium in the wells, add 200μL / well of ice-cold deionized water, and incubate in an ice bath at 4°C for 10 minutes. After that, wash the well plate and add biotin-labeled detection antibody according to the product instructions of IFN-γmouse ELISPOT kit (Thermo-fisher) and place it at room temperature for 2 hours. Then add enzyme-labeled avidin to the well plate and incubate at room temperature for 1 hour. After washing the well plate, add the color development solution and let it stand at room temperature for 5-15 minutes. After the spots grow to the appropriate size, wash them twice with deionized water to terminate the color development process. Subsequently, blue-black spots can be observed at the bottom of the well plate, and the results are 10 6 The determination was based on the number of spots produced in each spleen cell.

[0107] (2) Enzyme-linked immunosorbent assay (ELISA) was used to measure the antibody level in mouse serum:

[0108] First, mice were randomly divided into groups, and each group used more than 6 mice for the experiment. The mice were grouped and immunized according to the specific instructions of the embodiment. The blood collected from the mouse orbit was placed at room temperature for 4 hours, and then centrifuged at a speed of 10000g for 10 minutes to collect the upper serum. Then a certain concentration of antigen was added to a 96-well plate and left to stand at 4°C for 12 hours to coat the antigen. After the coating was completed, it was washed with 1×PBST washing solution and the 96-well plate was blocked with PBST dissolved with bovine serum albumin. After 2 hours, serum was added and diluted to a suitable multiple. After incubation at 37°C for 30 minutes, a secondary antibody labeled with horseradish peroxidase (HRP) was added. After incubation at 37°C for 30 minutes, a color developing solution was added to react in the dark for 10-20 minutes. Then, a stop solution was added to stop the reaction. Finally, the absorbance value was determined using an ELISA instrument. The wells without serum were negative control groups, and the wells with absorbance greater than twice that of the negative control group were positive wells. The dilution corresponding to the positive wells with the maximum dilution was the antibody titer of the sample.

[0109] (3) Evaluation of tumor immune effect:

[0110] The mice were randomly divided into groups, and each group had more than 6 mice for the experiment. The mice were grouped, tumor-inoculated, and immunized according to the specific instructions of the embodiment. The mice were injected with tumor cells subcutaneously. The growth of the tumor was monitored, and the length and width of the tumor were measured with a vernier caliper every other day. The tumor volume was calculated according to the formula length×width×width / 2.

[0111] Example 1. Preparation of aluminum-manganese mixed adjuvant

[0112] This example is the preparation of aluminum-manganese mixed adjuvant.

[0113] First, the aluminum-containing compound and the manganese-containing compound were added to the aqueous phase in proportion using a pipette, and then dispersed evenly by water bath sonication for 5 minutes. The pH value of the aqueous phase was 7.4. Then, the mixture was incubated at room temperature for 30 minutes to allow the two to be completely combined, thereby obtaining an aluminum-manganese mixed adjuvant (Table 1).

[0114] Table 1

[0115] Aluminum compounds Manganese compounds Aluminum:Manganese (w / w) Aluminum:Manganese (molar ratio) Aluminum Hydroxide Gel Manganese phosphate 1:3 2:3 Aluminum Hydroxide Gel Manganese phosphate 1:1 2:1 Aluminum Hydroxide Gel Manganese phosphate 3:1 6:1 Aluminum Hydroxide Gel Manganese phosphate 5:1 10:1 Aluminum phosphate gel Manganese phosphate 1:2 1:1 Aluminum phosphate gel Manganese phosphate 3:2 3:1 Aluminum phosphate gel Manganese phosphate 9:2 9:1 Aluminum phosphate gel Manganese phosphate 15:2 15:1 Potassium aluminum sulfate gel Manganese phosphate 1:1 2:1 Potassium aluminum sulfate gel Manganese phosphate 6:1 12:1 Potassium aluminum sulfate gel Manganese phosphate 18:1 36:1 Potassium aluminum sulfate gel Manganese phosphate 30:1 60:1

[0116] (The above mass ratio and molar ratio refer to the elemental mass and molar ratio of aluminum and manganese.)

[0117] Example 2. Screening of the optimal ratio of aluminum-manganese mixed adjuvants

[0118] The mass of manganese adjuvant was kept constant, while the mass of aluminum adjuvant was changed. Aluminum adjuvant (aluminum hydroxide gel) and manganese adjuvant (manganese phosphate salt) were prepared into aluminum-manganese mixed adjuvants according to different mass ratios (1:3, 1:1, 3:1, 5:1), and incubated with OVA protein at room temperature for 1 hour. 2×10 6 The mice were immunized twice on days 7 and 14 with a PBS suspension of B16 / OVA cells. The tumor volume was measured on day 20.

[0119] Table 2

[0120]

[0121]

[0122] (The above mass ratio refers to the elemental mass ratio of aluminum and manganese.)

[0123] The results are shown in Table 2. The mass ratio of aluminum to manganese has a great influence on the tumor immune effect. When the mass ratio of aluminum to manganese is less than 1:1, it has a significant inhibitory effect on tumor growth. When it is equal to 1:1, it has the best anti-tumor effect, and the tumor volume is the smallest (375.2±102.5mm 3); When the mass ratio of aluminum to manganese is greater than 1:1, the anti-tumor effect of the mixed adjuvant is weakened, and this anti-tumor effect is weakened as the amount of aluminum adjuvant increases. This may be because the increase in aluminum adjuvant leads to a decrease in the expression of co-stimulatory factors, which leads to a weakening of the effect of the mixed adjuvant. In summary, we determined that the optimal aluminum-manganese mass ratio of the aluminum-manganese mixed adjuvant is 1:1, and the aluminum-manganese mixed adjuvant of this ratio has the best anti-tumor effect. Examples 4, 7-11 are all completed using the optimal aluminum-manganese adjuvant mass ratio.

[0124] Example 3. Preparation of oil-in-water Pickering emulsion containing aluminum and manganese

[0125] First, take 300 μL of the mixed aluminum-manganese adjuvant as described in Table 3 and add it to 650 μL of citric acid-citrate buffer solution. Ultrasonicate for 1 minute to disperse it evenly to obtain an aqueous suspension dispersed with the mixed aluminum-manganese adjuvant. Use a pipette to draw 50 μL of squalene and add it to the bottom of the centrifuge tube, then add 950 μL of the mixed aqueous suspension, and use ultrasonic (100 W, 2 min, ultrasonic for 4 seconds and stop for 4 seconds) emulsification method to prepare an oil-in-water emulsion. The droplets are well dispersed and spherical and regular. The average particle size of the droplets with the optimal aluminum-manganese adjuvant mass ratio is 2.8 μm. The particle size distribution diagram is shown in Figure 1 As shown, the light microscopy image of the emulsion is Figure 2 shown.

[0126] Table 3 shows the particle sizes of emulsion droplets prepared from different aluminum-containing compounds and manganese-containing compounds at different mass ratios.

[0127] Replaceable buffers in the preparation of water-in-oil Pickering emulsions containing aluminum and manganese include purified water, normal saline for injection, and PBS buffer, and replaceable oil phases include olive oil, soybean oil, corn oil, oleic acid, and ethyl lactate.

[0128] Table 3

[0129]

[0130]

[0131] (The above mass ratio refers to the elemental mass ratio of aluminum and manganese.)

[0132] Example 4. Evaluation of the immune effect of oil-in-water Pickering emulsion containing aluminum and manganese

[0133] Subcutaneous orthotopic melanoma model: 6-8 week old wild-type C57BL / 6 mice were injected subcutaneously in the inguinal region with 5 × 10 5The mice were injected with aluminum-manganese mixed adjuvant and water-in-oil Pickering emulsion containing aluminum and manganese on days 7 and 14, respectively. On day 20, the tumor volume of the mice was measured.

[0134] Table 4

[0135] Experimental groups <![CDATA[Tumor volume (mm 3 )]]> Aluminum-manganese mixed adjuvant (1:1) 561.3±133.5 Aluminum manganese Pickering emulsion (1:3) 508.7±143.6 Aluminum manganese Pickering emulsion (1:1) 398.0±78.6 Aluminum manganese Pickering emulsion (3:1) 1025.8±203.5 Aluminum manganese Pickering emulsion (5:1) 1642.4±223.3 Untreated group 2156.4±213.8

[0136] (The ratios shown in the table refer to the elemental mass ratios of aluminum and manganese.)

[0137] As shown in Table 4, the anti-tumor effect of the B16 / OVA tumor volume in the Pickering emulsion group was better than that in the aluminum-manganese mixed adjuvant group, indicating that the aluminum-manganese mixed adjuvant further enhanced the anti-tumor ability after being prepared into an emulsion.

[0138] Example 5. Preparation of aluminum and manganese hydroxide gel

[0139] First, a 50 μM / L MnCl2 solution and a 50 μM / L AlCl3 solution were mixed, and then an ammonia solution with a concentration of 300 μM / L was prepared. Excess ammonia solution was dripped into the MnCl2 and AlCl3 mixed solution at a rate of 10 mL / h using a syringe propulsion pump under stirring with a magnetic stirrer (500 rpm); then the mixture was dispensed into centrifuge tubes, deionized water was added into the centrifuge tubes and mixed thoroughly, and the mixture was centrifuged at 5000 g for 10 min, the supernatant was discarded, and deionized water was added into the centrifuge tubes for washing twice, and finally the mixture was resuspended with PBS buffer. The prepared solution was the hydroxide gel of aluminum and manganese.

[0140] Solutions that can replace ammonia water in the preparation process of aluminum and manganese hydroxide gel include Na2HPO4 solution and (NH4)2HPO4 solution, and replaceable buffers include purified water, normal saline for injection, and citric acid buffer.

[0141] Example 6. Preparation of liposome nanoparticles containing aluminum and manganese

[0142] First, a cyclohexane / nonoxynol mixed solvent was prepared as the oil phase. Then, a 200 μM / L MnCl2 solution was mixed with a 200 μM / L AlCl3 solution, and the mixed solution was added dropwise to 15 ml of the oil phase under ultrasound, and the mixture was allowed to stand for 5 min to obtain an aluminum-manganese microemulsion. A 25 mM / L Na2HPO4 aqueous solution was added dropwise to 15 ml of the oil phase under ultrasound, and then a 2,3-dioleoyl-propyl-trimethylamine (DOPA) solution was added, ultrasound was applied for 20 s, and HPO4 was obtained after standing for 5 min. 2- Microemulsion; Pour aluminum manganese microemulsion into HPO4 2-In the microemulsion, let it stand for 30 minutes after mixing; then divide it into two special centrifuge tubes, add 15ml of anhydrous ethanol to each tube and fully dissolve it for 5 minutes; centrifuge it at 15000g for 20 minutes, discard the supernatant oil phase, and then add ethanol to the centrifuge tube to wash twice. Then add 3ml of chloroform to the centrifuge tube and transfer it to a round-bottom flask.

[0143] DOPE, cholesterol and DSPE-PEG2000 were added to the chloroform solution to make the final concentrations of the three 8mM / L, 10mM / L and 3mM / L, respectively. The prepared chloroform solution was added to a round-bottom flask, and the chloroform was fully rotary evaporated in a 37°C water bath to form a film, which was then vacuum dried overnight. Double distilled water was added and sonicated at 50°C for 5 minutes to ultrasonically dissolve all liposome membranes into the solution. The prepared solution is liposome nanoparticles containing manganese and aluminum.

[0144] Example 7. Effect of aluminum-manganese mixed adjuvant on natural immune response at the cellular level

[0145] This example is to detect the natural immune response effect of aluminum-manganese mixed adjuvant on the cellular level after stimulating bone marrow-derived dendritic cells.

[0146] (1) Expression of type I interferon-related genes after stimulation with aluminum-manganese mixed adjuvant:

[0147] Aluminum hydroxide adjuvant (10 μL / well), manganese phosphate adjuvant (10 μL / well) and mixed adjuvant of aluminum hydroxide and manganese phosphate (10 μL / well) were added to 24-well plates for culturing BMDCs, and co-cultured for 12 h at 37 ° C and 5% CO2. Subsequently, BMDCs were collected, total RNA in the cells was extracted, and RT-qPCR was used to detect the expression of type I interferon genes such as IFNβ1 and IFNα1 in BMDCs. Among them, the forward and reverse primer sequences of IFNβ1 are: CACAGCCCTCTCCATCAACT (SEQ ID NO: 1); TCCCACGTCAATCTTTCCTC (SEQ ID NO: 2); the forward and reverse primer sequences of IFNα1 are GGATGTGACCTTCCTCAGACTC (SEQ ID NO: 3); ACCTTCTCCTGCGGGAATCCAA (SEQ ID NO: 4).

[0148] The experimental results showed that the expression of IFNβ1 and IFNα1 in BMDCs stimulated by aluminum adjuvant or manganese adjuvant was low, while the level of type I interferon-related genes induced by aluminum-manganese mixed adjuvant was significantly higher than that of aluminum adjuvant or manganese adjuvant ( Figure 3 , Figure 4 ), indicating that the aluminum-manganese mixed adjuvant can significantly induce the production of type I interferon and promote the natural immune response of cells.

[0149] (2) Effects of aluminum-manganese mixed adjuvants on dendritic cell activation

[0150] Aluminum adjuvant, manganese adjuvant and aluminum-manganese mixed adjuvant were added to the 24-well plate for culturing BMDCs, and co-cultured for 12 hours at 37° C. and 5% CO 2. Subsequently, BMDCs were collected, transferred to 1.5 mL, and flow cytometry was performed according to the example method.

[0151] The experimental results showed that the expression of CD80 in CD11c-positive cells of BMDCs stimulated with aluminum adjuvant or manganese adjuvant alone was low, while the expression of CD80 in BMDCs stimulated with aluminum-manganese mixed adjuvant was significantly higher than that of aluminum adjuvant or manganese adjuvant alone. Figure 5 The mean fluorescence intensity of CD11c and CD80 double positive BMDCs is shown in Figure 1. The results show that the aluminum-manganese mixed adjuvant can promote the maturation and activation of dendritic cells, thereby promoting the subsequent intracellular antigen presentation.

[0152] Example 8. Effect of spleen cell response of aluminum-manganese mixed adjuvant

[0153] This example is to evaluate the immune response effect of immune cells in the spleen of mice after they were vaccinated twice with an aluminum-manganese mixed adjuvant vaccine with OVA as the antigen.

[0154] Table 5

[0155]

[0156] First, aluminum hydroxide adjuvant, manganese phosphate adjuvant and aluminum-manganese mixed adjuvant were mixed with OVA antigen in a ratio of 4:1, and incubated at room temperature for 1 hour to obtain vaccines with three different adjuvants.

[0157] C57BL / 6 mice aged 6-8 weeks were randomly selected, with 6 mice in each group, and 100 μL of the experimental group described in Table 5 was injected into the hind leg muscle of the mice. The mice were immunized once every two weeks, for a total of two immunizations. The mice were humanely killed on the 28th day after the first injection, and the spleen cells of the mice were extracted for detection.

[0158] The experimental results showed that after two immunizations, the ratio of IFN-γ secreting cells in spleen cells was significantly increased by the aluminum-manganese mixed adjuvant compared with the simple aluminum adjuvant or manganese adjuvant ( Figure 6 ), which shows that the aluminum-manganese mixed adjuvant can effectively stimulate spleen cells to secrete IFN-γ, thereby enhancing the killing ability of T cells and the body's cellular immune response.

[0159] Example 9. Immune effect of aluminum-manganese mixed adjuvant in tumor therapeutic vaccine

[0160] This example uses the aluminum-manganese mixed adjuvant vaccine with OVA as the antigen prepared in Example 8 to detect the immune effect of the aluminum-manganese mixed adjuvant in various tumor models.

[0161] (1) Immune effects of aluminum-manganese mixed adjuvants in subcutaneous tumors

[0162] 2 × 10 6 The mice were immunized twice on days 7 and 14 according to the groups shown in Table 5. The tumor volume was measured on day 20.

[0163] Table 6

[0164] Experimental groups <![CDATA[Tumor volume (mm 3 )]]> Aluminum adjuvant 1823.7±124.9 Double dose aluminum adjuvant 1913.6±251.3 Manganese adjuvant 1272.9±74.7 Double dose manganese adjuvant 986.6±161.0 Aluminum-manganese mixed adjuvant 657.5±43.8 Untreated group 2058.4±109.3

[0165] As shown in Table 6, the tumor volume of the aluminum-manganese mixed adjuvant group was the smallest (657.5±43.8mm 3 ), indicating that it has the best tumor inhibition effect. The addition of aluminum adjuvant significantly improves the anti-tumor ability of the mixed adjuvant. And after doubling the dose of aluminum adjuvant or manganese adjuvant, the anti-tumor effect is still not as good as the single dose of aluminum-manganese mixed adjuvant, which shows that a small amount of aluminum-manganese mixed adjuvant can exert a strong anti-tumor effect.

[0166] (2) Immune effects of aluminum-manganese mixed adjuvants in in situ tumors

[0167] Subcutaneous orthotopic melanoma model: 6-8 week old wild-type C57BL / 6 mice were injected subcutaneously in the inguinal region with 5 × 10 5 The mice were immunized twice on days 7 and 14 according to the groups shown in Table 5. On day 20, the tumor volume of the mice was measured.

[0168] Table 7

[0169] Experimental groups <![CDATA[Tumor volume (mm 3 )]]> Aluminum adjuvant 2063.1±224.2 Manganese adjuvant 1035.9±123.8 Aluminum-manganese mixed adjuvant 432.6±43.8 Untreated group 2376.2±189.3

[0170] As shown in Table 7, the tumor volume of B16 was similar to that of the subcutaneous tumor model. The tumor volume of the aluminum-manganese mixed adjuvant group was the smallest (432.6±43.8mm 3 ), the aluminum-manganese mixed adjuvant prepared by the addition of aluminum adjuvant induced strong tumor immunity.

[0171] Example 10. Effect of the immunization strategy of aluminum-manganese mixed adjuvant on the immune effect

[0172] This example is to explore the effects of different immunization strategies of aluminum-manganese mixed adjuvants on tumor immunity.

[0173] Table 8

[0174]

[0175] C57BL / 6 mice aged 6-8 weeks were randomly selected, with 8 mice in each group. The mice were subcutaneously injected with EG7 / OVA lymphoma cells (2×10 6 / mouse). Subsequently, 100 μL of the experimental group described in Table 5 was injected into the hind leg muscle of the tumor-bearing mice according to the immunization strategy shown in Table 8. The tumor volume of the mice was measured and recorded every other day, and the tumor growth curve was drawn.

[0176] like Figure 7 As shown, the growth rate of tumors in the second immune strategy group was significantly slower than that of the other two immune strategies, showing the best tumor inhibition effect. This is mainly due to the multiple inoculations in a short period of time due to the immune strategy, which enables the body's cytotoxic T cells to kill a large number of tumor cells in the early stages of tumor growth, thereby reducing the gene drift phenomenon in the tumor and enabling antigen-specific cytotoxic T cells to kill tumor cells more efficiently.

[0177] Example 11. Safety of aluminum-manganese mixed adjuvant

[0178] This example is a biosafety evaluation of an aluminum-manganese mixed adjuvant.

[0179] (1) Evaluation of biochemical parameters in serum of mice immunized with aluminum-manganese mixed adjuvant

[0180] Four groups of adjuvants, including aluminum adjuvant, manganese adjuvant, aluminum-manganese mixed adjuvant and Pickering emulsion, were injected intramuscularly into mice twice at intervals of 14 days. 14 days after the second immunization, blood was collected from the eye sockets and various indicators in the serum were characterized by a biochemical analyzer. As shown in Table 9, the three groups of adjuvants had no significant differences from the normal group in indicators such as liver function (alkaline phosphatase, alkaline phosphatase, ALP; alanine aminotransferase, ALT; aspartate aminotransferase, Aspartate aminotransferase, AST), renal function (blood urea nitrogen, blood urea nitrogen, BUN), and myocardial function (lactate dehydrogenase, lactate dehydrogenase, LDH), indicating that the aluminum-manganese adjuvant has good biosafety.

[0181] Table 9

[0182]

[0183] (2) Evaluation of neurotoxicity in mice immunized with aluminum-manganese mixed adjuvant

[0184] In order to evaluate the neurotoxicity of mixed immune adjuvants and their emulsions, four groups of aluminum adjuvants, manganese adjuvants, aluminum-manganese mixed adjuvants and Pickering emulsions were intraperitoneally injected into mice. On the second day after injection, the mice were humanely killed, the mouse brains were extracted, weighed, and digested with nitric acid. The concentration of Mn in the brain was detected using inductively coupled plasma mass spectrometry (ICP-MS).

[0185] As shown in Table 10, compared with manganese adjuvant, the concentration of aluminum-manganese mixed adjuvant and its emulsion in the mouse brain after injection was significantly lower than that of the simple manganese adjuvant group, and there was no significant difference compared with the normal group, indicating that the aluminum-manganese mixed adjuvant or emulsion reduced the targeting of Mn to the brain after injection, and this new aluminum-manganese mixed adjuvant has good neurological safety.

[0186] Table 10

[0187] Experimental groups Mn concentration in brain (mg / kg) Normal group 0.32±0.03 Manganese adjuvant 0.62±0.05 Aluminum-manganese mixed adjuvant 0.45±0.07 Pickering Lotion 0.33±0.05

Claims

1. A composition, characterized in that The composition comprises 10% to 90% of the aluminum-containing compound and 10% to 90% of the manganese-containing compound, based on the total weight of the composition.

2. The composition according to claim 1, characterized in that The aluminum-containing compound accounts for 40% to 60% of the total weight of the composition; and / or the manganese-containing compound accounts for 30% to 60% of the total weight of the composition.

3. The composition according to claim 1, characterized in that In the composition, the mass ratio of aluminum to manganese is 1:5 to 5:1, preferably 1:3 to 3:1, and the molar ratio of aluminum to manganese is 1:3 to 10:1, preferably 2:3 to 6:

1.

4. The composition according to claim 1, characterized in that The aluminum-containing compound is selected from any one of aluminum hydroxide, aluminum phosphate, potassium aluminum sulfate, aluminum sulfate, ammonium alum or potassium alum, or a combination of at least two thereof. Preferably, the aluminum-containing compound is selected from any one of aluminum hydroxide gel, aluminum phosphate gel, potassium aluminum sulfate gel, aluminum sulfate gel, ammonium alum or potassium alum, or a combination of at least two thereof. More preferably, the aluminum-containing compound is selected from any one of aluminum hydroxide gel, aluminum phosphate gel or potassium aluminum sulfate gel, or a combination of at least two thereof.

5. The composition according to claim 1, characterized in that The manganese-containing compound is selected from manganese salts or manganese salt gels, Preferably, the manganese-containing compound is a divalent manganese compound. More preferably, the manganese-containing compound is manganese hydrochloride, carbonate, hydrobromide, sulfate, nitrate, phosphate, tartrate, fumarate, maleate, lactate, benzenesulfonate, pantothenate, ascorbate or hydroxide.

6. The composition according to claim 1, characterized in that The aluminum-containing compound and the manganese-containing compound are used in combination in the form of a composition, or are separately formulated and then used in combination and mixed before use.

7. The composition according to claim 1, characterized in that The composition is in the form of a blended composition of an aluminum compound and a manganese compound, in the form of a hydroxide gel containing aluminum and manganese, in the form of an oil-in-water emulsion containing aluminum and manganese, in the form of an oil-in-water emulsion containing aluminum and manganese, or in the form of micron / nano particles containing aluminum and manganese. Preferably, the blend composition or the oil-in-water emulsion may contain a hydrophobic drug, and a hydrophilic drug may be added to the aqueous phase. More preferably, the hydrophobic drug includes any one of paclitaxel, all-trans retinoic acid, anastrozole or doxorubicin or a combination of at least two thereof, and / or the hydrophilic drug includes any one of letrozole, interleukin or interferon or a combination of at least two thereof.

8. The composition according to claim 1, characterized in that The composition further comprises a lipid or a surfactant, and preferably, the composition is in the form of particles.

9. The composition according to claim 1, characterized in that The composition further comprises an aqueous phase, Preferably, the aqueous phase is any one of purified water, water for injection, phosphate buffer or citrate buffer, or a combination of at least two thereof. More preferably, the pH value of the phosphate buffer or citrate buffer is 5.0 to 8.1, preferably 6.0 to 8.

0.

10. The composition according to claim 1, characterized in that The composition further comprises an oil phase, Preferably, the oil phase includes any one of squalene, olive oil, soybean oil, corn oil, vitamin E, ethyl oleate, oleic acid, ethyl lactate, dimethicone, isopropyl laurate or capric triglyceride, or a combination of at least two of them; more preferably, any one of squalene, olive oil or dimethicone, or a combination of at least two of them.

11. The composition according to claim 9 or 10, characterized in that The composition is in the form of an oil-in-water emulsion or a water-in-oil emulsion, preferably an oil-in-water Pickering emulsion. Preferably, the average particle size of the droplets in the oil-in-water emulsion is between 50 nm and 10 μm. Preferably, the volume ratio of the oil-water phase in the oil-in-water emulsion is 1:100 to 1:

1.

12. The composition according to claim 1, characterized in that The composition is an immunogenic composition, Preferably, the composition further comprises an immunostimulant, More preferably, the immunostimulant comprises one or a combination of at least two of Toll-like receptor agonists, cytokines, chemokines, cGAS-STING pathway agonists, saponins and analogs thereof.

13. A method for preparing the composition according to any one of claims 1 to 12, characterized in that The method comprises the step of mixing an aluminum-containing compound and a manganese-containing compound.

14. The method according to claim 13, characterized in that The method comprises the steps of dispersing and mixing the aluminum-containing compound and the manganese-containing compound in an aqueous phase, Preferably, the dispersion is carried out by shaking, stirring or ultrasound.

15. A vaccine, characterized in that The vaccine comprises the composition of any one of claims 1 to 12, Preferably, the vaccine further comprises an immunogen or an active fragment thereof, More preferably, the vaccine further comprises pharmaceutically acceptable excipients, additives, diluents, buffers, sugars, amino acids, chelating agents, surfactants, polyols, fillers, stabilizers, lyoprotectants, solubilizers, emulsifiers, salts, adjuvants, tonicity increasing agents, delivery vehicles, and antimicrobial preservatives.

16. Use of the composition of any one of claims 1 to 12 as an adjuvant.

Images