Medicine for targeting into sympathetic nerve cells as well as preparation method and application of medicine

Abstract

The invention discloses a drug for targeted entry into sympathetic nerve cells and a preparation method and application thereof.The drug takes a DNA nanoflower as a carrier, the surface of the DNA nanoflower is connected with a nucleic acid aptamer, and the interior of the DNA nanoflower wraps and is connected with CBD3 peptide; wherein the nucleic acid aptamer is matched with a receptor on the surface of a sympathetic nerve cell, and the CBD3 peptide is connected with nucleotide on the DNA nanoflower through an acid-sensitive connection unit. In an acute myocardial infarction rat model, the medicine can significantly inhibit sympathetic nerve overactivity after myocardial infarction and relieve neuroinflammation and neuropathic pain, and shows obvious reduction of ventricular arrhythmia activity; in a chronic myocardial infarction model, the medicine can improve the heart function of a rat, reduce the myocardial infarction area, reduce peripheral nerve remodeling caused by myocardial infarction and enhance the electrophysiological stability at the same time.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a drug that targets and enters sympathetic nerve cells, and a preparation method and application thereof. Background Art

[0002] Cardiac death after myocardial infarction (MI) is often the leading cause of life-threatening events, which are mainly driven by malignant ventricular arrhythmias (VAs). Overactivation of cardiac sympathetic nerves is closely related to myocardial infarction, which not only increases the incidence of malignant ventricular arrhythmias, but also promotes adverse ventricular remodeling, thus forming a vicious cycle. Studies have shown that intervention of sympathetic ganglia (SG) can improve the functional impairment caused by myocardial infarction. However, traditional clinical resection methods, such as cardiac sympathetic denervation and stellate ganglion block, may induce Horner syndrome and other severe reactions. Although methods such as gold nanorods and optogenetic systems have demonstrated the potential of controlling excessive activation of sympathetic nerve activity to protect the heart, they still face problems such as unsatisfactory biocompatibility of metal materials and easy biological toxicity in clinical application. The method of reducing CaV2.2 current and the excitability of sympathetic nerve activity through shRNA to reduce malignant ventricular arrhythmias has problems such as low gene transfection efficiency and uncertain long-term treatment effect. Summary of the invention

[0003] The present invention provides a drug that targets and enters sympathetic nerve cells, and a preparation method and application thereof, to solve the problems in the related art of low biocompatibility, high toxicity, low transfection efficiency, and uncertain long-term treatment effect of materials that inhibit excessive activation of sympathetic nerve activity.

[0004] The technical solution provided by the present invention is specifically as follows:

[0005] In the first aspect, the present invention provides a drug targeted to enter sympathetic nerve cells (hereinafter referred to as sDNF), wherein the drug uses DNA nanoflowers as carriers, the surface of the DNA nanoflowers is connected to nucleic acid aptamers, and the interior is wrapped and connected to CBD3 peptides; wherein the nucleic acid aptamers are adapted to the receptors on the surface of the sympathetic nerve cells, and the CBD3 peptides are connected to the nucleotides on the DNA nanoflowers through acid-sensitive connection units.

[0006] In conjunction with the first aspect of the present invention, in some embodiments, the receptor is an L1 cell adhesion molecule, and the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1.

[0007] In combination with the first aspect of the present invention, in some embodiments, the particle size of the drug is 300-400 nm.

[0008] In conjunction with the first aspect of the present invention, in some embodiments, the acid-sensitive linking unit is an imine bond (C=N).

[0009] In a second aspect, the present invention provides a method for preparing a drug that targets and enters sympathetic nerve cells, comprising:

[0010] The CBD3 peptide was linked to the single-stranded DNA1 using an acid-sensitive linker to obtain CBD3-DNA1;

[0011] Providing a circular DNA template; wherein DNA1 is complementary to a portion of the sequence of the circular DNA template;

[0012] The circular DNA template, dNTPs, CBD3-DNA1 and phi29 polymerase are mixed in a reaction buffer, subjected to rolling circle amplification reaction, and purified to obtain the drug targeted to enter sympathetic nerve cells as claimed in claim 1.

[0013] In conjunction with the second aspect of the present invention, in some embodiments, connecting the CBD3 peptide to the single-stranded DNA1 using an acid-sensitive linker comprises:

[0014] The N-terminal octanoic acid-arginine repeat sequence-CBD3 and CHO-DNA1 were mixed at room temperature to obtain CBD3-DNA1 after the reaction.

[0015] In combination with the second aspect of the present invention, in some embodiments, providing a circular DNA template includes: hybridizing primers P1 and P2 with T1 and T2 respectively, adding T4 DNA ligase for incubation, and obtaining a circular DNA template; wherein P1 has a nucleotide sequence as shown in SEQ ID NO.4, P2 has a nucleotide sequence as shown in SEQ ID NO.5, T1 has a nucleotide sequence as shown in SEQ ID NO.2, and T2 has a nucleotide sequence as shown in SEQ ID NO.3.

[0016] In a third aspect, the present invention provides the use of a drug that targets and enters sympathetic nerve cells in the preparation of a drug for preventing and treating ventricular arrhythmia-related diseases.

[0017] In a fourth aspect, the present invention provides the use of a drug that targets and enters sympathetic nerve cells in the preparation of a drug for preventing and treating myocardial infarction-related diseases.

[0018] In combination with the third and fourth aspects of the present invention, in some embodiments, the dosage form of the drug is one or more of capsules, tablets, oral preparations, microcapsule preparations, and injections.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The drug provided by the present invention that targets sympathetic nerve cells can significantly inhibit excessive sympathetic nerve activation after myocardial infarction in the acute myocardial infarction rat model, reduce neuroinflammation and neuropathic pain, and show a significant reduction in ventricular arrhythmia activity; in the chronic myocardial infarction model, the drug can improve the cardiac function of rats, reduce the area of ​​myocardial infarction, and reduce peripheral nerve remodeling caused by myocardial infarction, while enhancing electrophysiological stability. The above results show that the drug provided by the present invention has a preventive and therapeutic effect on ventricular arrhythmia and ventricular remodeling after myocardial infarction. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0022] Figure 1 : Preparation of sDNF and its neuron-targeted inhibition of CaV2.2 current: (A) Schematic diagram of sDNF preparation; (B) Agarose gel electrophoresis of T1, T2, P1, P2, circular DNA (cDNA) and sDNF; (C) Fluorescence intensity of sDNF synthesized with different RCA times and template concentrations (25 and 100 nM), data are expressed as mean±SD (n=3); (D) Tyndall effect of sDNF suspension; (E) SEM and (F) TEM images of sDNF, showing the diameter distribution of sDNF, scale bar = 1 μm (E) and 100 nm (F); (G) Confocal images of SH-SY5Y cells containing sDNF with nucleic acid aptamers and (H) sDNF without nucleic acid aptamers, red, purple, green and blue represent cy3-labeled sDNF, cell membrane, phalloidin and DAPI, respectively, scale bar = 10 μm. (I) Raw curves of N-type calcium currents evoked by a 200 ms prepulse between -80 mV and +60 mV; (J) Ca2+ in the absence or presence of 10 uM sDNF 2+ Current-voltage (IV) curves of the membrane potential of the current, and the peak current density (-20 mV) under the above conditions (n=6); (K) Co-IP experiments showed that the CRMP2 immunoprecipitated complex was recovered and immunoblotted using CaV2.2 and CRMP2 antibodies, respectively, and the relative binding rate of CaV2.2 and CRMP2 under different concentrations of sDNF was obtained from the Co-IP experiment. The data are presented as mean ± standard deviation (n=3, ***P<0.05, P<0.01, ***P<0.001, ****P<0.0001); (L) Schematic diagram of the specific targeting and subsequent release of CBD3 in neuronal cells.

[0023] Figure 2 : Inhibitory effects of sDNF on CaV2.2 channel activity in sympathetic ganglia and the occurrence of AMI-induced arrhythmias: (A) Flow chart of the AMI model experiment; (B) Immunofluorescence staining of CaV2.2 (red) and CRMP2 (green) in sympathetic ganglia and relative quantification of the binding rate of CaV2.2 and CRMP2, and the nucleus was stained with DAPI (blue), scale = 20 μm; (C) Schematic diagram of rat electrocardiogram recording and representative schematic diagrams of detected VF (ventricular fibrillation), VPB (ventricular premature beats), and VT (ventricular tachycardia); (D) VF incidence in the AMI group and sDNF treatment group. (EH) VPB, non-sustained VT, and sVT in each group. (I) Schematic diagram of cardiac EPR (effective refractory period) measurement after LADO surgery; (J) Effects of sDNF on ERP in different parts of the heart before and after LADO surgery. Data are presented as mean ± SD (n = 8, ***P < 0.05, P < 0.01, ***P < 0.001, ****P < 0.0001). LVA: left ventricular apex, LVM: left ventricular mid, LVB: left ventricular base.

[0024] Figure 3 : Relief of neuropathic pain and neuroinflammation after LADO surgery: (A) Facial pain expression scores after LADO surgery in different groups; (B) Schematic diagram of the paw withdrawal test using a thermal pain meter; (C) The paw withdrawal time of rats at different time points after LADO was used to reflect the pain threshold; (D) Representative images of double immunofluorescence of IBA-1 (green) and NeuN (red) in microglia in DRG and relative quantification of IBA-1 density, scale bar = 100 μm; (E) Immunofluorescence staining of IL-1β in DRG and relative quantification of IL-1β intensity, scale bar = 50 μm; (FH) Elisa method for determination of serum substance P, norepinephrine, and TNF-α levels; (I) WB experiment and (JK) relative ratio of IL-6 to TNF-α. Data are expressed as mean ± SD (n = 4 or 8, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0025] Figure 4: sDNF improves ventricular remodeling and neural remodeling in CMI rats: (A) Experimental flow of CMI model. (B) Representative images of Masson staining in different groups and statistical quantification of fibrosis area, scale bar = 2 mm, enlarged inset shows the lesion site, scale bar = 100 μm; (C) Typical images of myocardial TTC staining and statistics of infarct area, white area represents infarct area. (D) Representative echocardiograms of three groups of rats in chronic experiment. (EH) Statistics of LVEF, LVIDd, LVIDs, and LVEDV of three groups of rats. Data are expressed as mean ± SD (n = 8, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). LVEF: left ventricular ejection fraction, LVIDd: left ventricular end-diastolic diameter, LVIDs: left ventricular end-systolic diameter, LVEDV: left ventricular end-diastolic volume.

[0026] Figure 5 : In the CMI model, sDNF modulates autonomic nerve activity and enhances ventricular electrophysiological stability: (A) Immunofluorescence staining of c-fos (red) and TH (green) on sympathetic ganglia and the related quantitative analysis of c-fos intensity, and the nuclei were stained with DAPI (blue), scale bar = 20 μm. (B) Representative recordings of sympathetic ganglion neural activity after LADO surgery in three groups. Scale bar = 1 s; (C-D) Statistical analysis of the ratio of amplitude to frequency of sympathetic ganglia. (E-G) Heart rate variability in each group, including LF (low frequency part), HF (high frequency part) and LF / HF. (H) Typical electrocardiogram images of ventricular arrhythmia induced by programmed electrical stimulation; (IJ) Arrhythmia scoring and VF threshold detection; (K) Representative immunohistochemical images and quantitative data of GAP43 expression in myocardial tissue, scale bar = 50 μm, data are expressed as mean ± SD (n = 8, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0027] Figure 6 : Transcriptomic changes of myocardial tissue in each group: (A) Venn diagram of differentially expressed genes (DEGs) in control group, MI group and sDNF group; (B) Volcano plot and (C) heat map showed the up-regulation or down-regulation of DEGs before and after sDNF treatment; (D) KEGG pathway classification and (E) KEGG enrichment of myocardial infarction DEGs were changed by sDNF; (F) Expression of JAK2, PI3K, AKT2 and IL-6R in myocardial tissue after different treatments, data are expressed as mean±SD (n=4, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0028] Figure 7: Schematic diagram of neuron-targeted DNA nanoflowers for the treatment of malignant ventricular arrhythmias and cardiac remodeling. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] The term "nucleic acid aptamer" in the present invention refers to a class of single-stranded oligonucleotides screened out by "exponential enrichment ligand system evolution" technology, which can form specific structures such as stem-loop structure, quadruplex structure, etc. through intramolecular hybridization, and then specifically bind to proteins, small molecule compounds and tumor cells.

[0031] The term "DNA nanoflower" of the present invention refers to a nanoscale flower-like structure formed by DNA self-assembly technology. Its formation process is usually based on the rolling circle amplification (RCA) technology, which generates ultra-long single-stranded DNA under the action of enzymes through specific DNA templates and primers, and these single-stranded DNAs further self-assemble to form a nanoflower-like morphology with a complex three-dimensional structure.

[0032] The inventors found that the N-type voltage-gated calcium channel (CaV2.2) located in the nerve tissue determines the excitability of neurons by changing the transmembrane potential, and studies have shown that high CaV2.2 currents can be observed in the cardiac sympathetic ganglia of rats with heart failure models, and the excitability of sympathetic ganglion neurons in rats with heart failure induced by coronary artery ligation is upregulated, causing sympathetic nerve overactivation and malignant ventricular arrhythmias. These evidences indicate that CaV2.2 may be a promising target for the treatment of cardiovascular diseases.

[0033] The present invention designs a drug for inhibiting CaV2.2 channels, which is designed to target and enter sympathetic nerve cells. The drug uses DNA nanoflowers as carriers, the surface of which is connected to nucleic acid aptamers, and the interior is wrapped and connected to CBD3 peptides; wherein the nucleic acid aptamers are adapted to the receptors on the surface of sympathetic nerve cells, and the CBD3 peptides are connected to the nucleotides on the DNA nanoflowers through acid-sensitive connection units.

[0034] The highly dense structure of DNA nanoflowers makes it resistant to degradation by serum and nucleases, thus protecting CBD3 peptides from reaching the surface of sympathetic nerve cells safely. The stem-loop structured nucleic acid aptamers on the surface of DNA nanoflowers are compatible with the receptors on the surface of sympathetic nerve cells, allowing sDNF to adhere to the surface of sympathetic nerve cells and then be internalized by sympathetic nerve cells. The pH of the lesion site will decrease, and after internalization, the acid-sensitive linker unit will break in the endosomes and lysosomes with lower pH, and the CBD3 peptide will dissociate from the DNA nanoflower, thereby exerting the therapeutic effect of the CBD3 peptide: Axonal collapse response mediator protein 2 (CRMP2) is a protein that plays an important role in neurite growth and axon guidance, and CBD3 peptide is a peptide derived from CRMP2. CRMP2 can bind to N-type voltage-gated calcium channels (CaV2.2), and this binding can regulate the surface localization and calcium current of CaV2.2. CRMP2 increases the expression of CaV2.2 on the cell surface by interacting with the cytoplasmic ring of CaV2.2, thereby increasing the influx of calcium ions. CBD3 peptide can uncouple the binding of CRMP2 and CaV2.2, thereby reducing the surface localization and calcium current of CaV2.2, and thus reducing the probability of malignant ventricular arrhythmias.

[0035] The inventors observed that in an acute myocardial infarction model, the drug can significantly inhibit the excessive activation of sympathetic nerves after myocardial infarction, reduce neuroinflammation and neuropathic pain, and show a significant reduction in ventricular arrhythmia activity; in addition, in a chronic myocardial infarction model, the drug can improve the cardiac function of rats, reduce the area of ​​myocardial infarction, and reduce peripheral nerve remodeling caused by myocardial infarction, while enhancing electrophysiological stability.

[0036] The DNA nanoflower material provided by the present invention can be delivered to neuron cells specifically. The neuron targeting of sDNF originates from the neuron targeting nucleic acid aptamers encoded on sDNF, which selectively bind to neuron membrane receptors and promote subsequent internalization into target cells. Specifically, the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1. The nucleic acid aptamer can bind to the L1 cell adhesion molecule on the surface of most nerve cells.

[0037] Furthermore, the particle size of the sDNF provided by the present invention is 300-400 nm, which is conducive to the endocytosis of sDNF by sympathetic nerve cells.

[0038] In the embodiment of the present invention, the acid-sensitive linking unit is an imine bond, which can also be replaced by a hydrazone bond, an acetal, a cis-citrate, or a triazene. This structure is easily broken in an acidic environment, thereby achieving controlled release of the drug. The acid sensitivity of the acid-sensitive linking unit is particularly significant in the sympathetic nerve cells at the lesion site and in the endosomes and lysosomes with low pH.

[0039] The present invention provides a method for preparing a drug that targets and enters sympathetic nerve cells, comprising:

[0040] The CBD3 peptide was linked to the single-stranded DNA1 using an acid-sensitive linker to obtain CBD3-DNA1;

[0041] Providing a circular DNA template; wherein DNA1 is complementary to a portion of the sequence of the circular DNA template;

[0042] The circular DNA template, dNTPs, CBD3-DNA1, and phi29 polymerase are mixed in a reaction buffer, and a rolling circle amplification reaction is performed, and the mixture is purified to obtain a drug that targets and enters sympathetic nerve cells.

[0043] In some embodiments of the present invention, connecting the CBD3 peptide to the single-stranded DNA1 using an acid-sensitive linker comprises: mixing the N-terminal octanoic acid-arginine repeat sequence-CBD3 with CHO-DNA1 at room temperature to obtain CBD3-DNA1 after the reaction.

[0044] In some embodiments of the present invention, providing a circular DNA template includes: hybridizing primers P1 and P2 with T1 and T2 respectively, adding T4 DNA ligase and incubating to obtain a circular DNA template; wherein P1 has a nucleotide sequence as shown in SEQ ID NO.4, P2 has a nucleotide sequence as shown in SEQ ID NO.5, T1 has a nucleotide sequence as shown in SEQ ID NO.2, and T2 has a nucleotide sequence as shown in SEQ ID NO.3.

[0045] The present invention verifies its neuropathic pain relief and neuroinflammation inhibition effects in rats with myocardial infarction for the first time. Administration of sDNF to sympathetic ganglia alleviates the persistence of neuropathic pain after LADO surgery. In addition, increased expression of the PI3K / AKT pathway was found in myocardial tissue sequencing, indicating that sDNF reverses the inflammatory changes caused by myocardial infarction, revealing the potential mechanism of myocardial inflammation and neuropathic pain relief.

[0046] In the following examples, the present invention establishes a rat model of myocardial infarction by ligating the left anterior descending coronary artery, and the experimental means involved are mature technologies in the art. The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto.

[0047] The C8R8CBD3 used in the following examples was purchased from Shanghai Biotech, and its structural formula is N-terminal octanoic acid (C8)-arginine repeat sequence (R8)-ARSRLAELRGVPRGLK (CBD3). CHO-DNA1 was purchased from Shanghai Biotech.

[0048] Experimental animals and feeding

[0049] Experimental animals: All rats were housed in an SPF (20-25°C, 55±15% relative humidity, 12h / 12h light-dark cycle) environment with an acclimatization period of 7 days. Rats were anesthetized with isoflurane before sDNF injection, and electrocardiograms were recorded using Labchart software, and in vivo electrophysiological experiments were performed. All experimental procedures were performed in accordance with the guidelines established by the National Institutes of Health.

[0050] Example 1: Preparation of DNA nanoflower material

[0051] CBD3-DNA1 was synthesized by Schiff's base reaction: 0.5 mL of C8-R8-CBD3 (5 mmol, Shanghai Bioengineering) and 0.5 mL of CHO-DNA (1 mmol, Shanghai Bioengineering) were mixed at room temperature and shaken slowly for 24 h. C8-R8-CBD3 and CHO-DNA1 were coupled through an imine bond. After HPLC purification, pure CBD3-DNA1 was obtained and identified by mass spectrometry. Its sequence was: N-terminal octanoic acid (C8)-arginine repeat sequence (R8)-ARSRLAELRGVPRGLK-CGCTAAGGTTGTTAGTGACTCGTGAC.

[0052] Synthesis of sDNF: First, primers P1 and P2 (4 μM) were hybridized with T1 and T2 (2 μM), respectively, wherein the 3' end of T1 and the 5' end of T2 were hybridized with P1, and the 5' end of T1 and the 3' end of T2 were hybridized with P2. The mixture was heated at 95°C for 5 minutes in a reaction buffer and slowly cooled to room temperature within 3 hours. After adding T4 DNA ligase (400 I / μL), the mixture was incubated at 16°C overnight, thermally inactivated at 65°C, and the reaction was stopped for 10 minutes to obtain a circular DNA template. The circular DNA template, dNTPs (1 mM), CBD3-DNA1 (20 μM), and phi29 polymerase (1 U·μL) were added. -1 ) were mixed in reaction buffer and reacted by rolling circle amplification (RCA) at 30°C for 4 hours, and then the reaction was terminated by heat inactivation at 65°C for 10 minutes. The reaction products were washed with nuclease-free water and centrifuged at 5000g for 10 minutes. After washing and centrifugation three times, pure sDNF was obtained, which could be stored at 4°C for subsequent in vitro and in vivo experiments.

[0053] Table 1. Sequences used to construct sDNF

[0054]

[0055] The structural formula of CHO-DNA1 is:

[0056]

[0057] Among them, base represents the base group, Oligo represents CGCTAAGGTTGTTAGTGACTCGTGAC (SEQ ID NO.7), and these 26 bases are complementary to the DNA on the DNA nanoflower.

[0058] Example 2: Construction of myocardial infarction model

[0059] The present invention uses SD rats as experimental subjects, and randomly divides all SD rats into 6 groups (acute groups: control group, AMI group, sDNF group, chronic groups: control group, CMI group, sDNF group).

[0060] Left anterior descending occlusion (LADO) method to establish myocardial infarction model: All rats involved in the experiment were anesthetized with isoflurane, followed by endotracheal intubation and assisted ventilation with a ventilator. LADO surgery was performed by opening the third or fourth intercostal space on the left side to expose the heart, cutting the pericardium, and ligating the left anterior descending coronary artery with a 6-0 suture. Changes in the ST segment and T wave in the electrocardiogram were used as criteria for evaluating the success of the establishment of the myocardial infarction model.

[0061] Rats in the AMI and CMI groups underwent LADO surgery after thoracotomy, while rats in the control group only underwent left thoracotomy without LADO surgery. Rats were divided into acute and chronic groups according to the different feeding times. The acute group underwent other experimental examinations immediately after LADO surgery, while the chronic group was fed for 4 weeks after LADO surgery before other experimental operations. In the acute group experiment, the electrocardiogram data were recorded 2 hours after the LADO surgery. In the chronic group experiment, rats undergoing LADO surgery were fed in a specific pathogen-free (SPF) environment for 4 weeks. The sDNF group underwent LADO surgery combined with sDNF intervention.

[0062] The steps of sDNF intervention are as follows: After conventional anesthesia, the rats were placed in the supine position and fixed. Then the skin was incised along the midline of the neck, and the subcutaneous tissue was directly separated. The carotid sheath can be found in the gap between the trachea and the sternocleidomastoid muscle. On the dorsal side of the bifurcation of the common carotid artery, a white, slightly transparent tissue, the so-called sympathetic ganglion (SG), was observed. Using a microsyringe, sDNF (20μM, 2μL) or an equal amount of saline was slowly injected into the sympathetic ganglia on both sides. After the injection, the needle was kept still for 5 minutes to prevent drug reflux.

[0063] Example 3: Verification of the inhibitory effect of sDNF on CaV2.2 channel function in vitro

[0064] (1) Cell culture: SH-SY5Y cells were cultured in a dish containing DMEM medium, FBS and antibiotics, and placed in an incubator at 37°C and 5% CO2 for 24 hours before patch clamp studies. Before the experiment, sDNF was added to the culture medium and incubated for 2 hours.

[0065] (2) Patch clamp experiments: Patch clamp studies were performed using HEK293 cells transfected with the CACNA1B (CaV2.2) plasmid (miaolingbio, P55029). Transfected cells were identified using mCherry encoded by the plasmid. Briefly, CACNA1B was transiently transfected using FuGENE 6 (Roche Diagnostics, Indianapolis, Indiana). Cells were cultured in poly-lysine-coated glass slides in DMEM medium, FBS, and antibiotics, and incubated in a 5% CO2 incubator at 37°C for 24 hours before patch clamp studies. Before recording experiments, sDNF was added to the culture medium and incubated for 2 hours. All cells were recorded in a bath solution of 140 mM NaCl, 3 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM HEPES and 10 mM glucose (pH: 7.3, adjusted with KOH; mOsm: 290-300). Na channel blocker TTX 1 μM, K channel blocker TEA-Cl 50 μM, 4-AP 20 μM were added to the bath solution. The circulation system was maintained at ~33 °C by a temperature control system. Cells with good activity were selected for whole-cell patch clamp recording under a microscope. Borosilicate glass electrodes (BF150-86-10; Sutter Instrument) were plotted by a P97 plotter (Sutter Instrument), and the impedance was guaranteed to be between 3 and 5 MΩ. Then, the electrode solution (mM): 135CsMeSO3, 10HEPS, 0.5EGTA, 4Mg-ATP, 0.4Na2-GTP, 10Na2-phosphocreatine (pH: 7.2, adjusted with CsOH; mOsm: 290-300) was injected for recording cells. After the whole cell structure was established, the cells were allowed to stabilize for 10 minutes before measuring the current. A specific voltage clamp protocol for evaluating channel activation and fast inactivation was used. Calcium channel currents were elicited by depolarizing pulses from -80 to +60 mV in 20 mV increments with a holding potential of -60 mV. The peak current (I Ca , P), and divide by the obtained battery capacitance to obtain I Ca density (pA / pF). Ca , P normalized to the driving force and the maximum I Ca, and the relationship between normalized conductance and Vm was plotted to determine the activation characteristics from the I / V relationship. Cellular electrophysiological recordings were performed using a Multiclamp 700B amplifier (Molecular Devices) and a Digi-data 1440A digital-to-analog converter (Molecular Devices). Signals were low-pass filtered at 10 kHz and digitized at 10 kHz (MICRO3 1401, Cambridge Electronic Design). Data collection and analysis were performed using Clampfit 10.6 software (Cambridge Electronic Design).

[0066] Under different membrane potential stimulations, the peak current generated by the sDNF group was 34.0% lower than that of the control group ( Figure 1 I and 1J), indicating that sDNF has an effect on Ca 2+ The peak current density statistics are consistent with the above results, and sDNF exhibits an inhibitory effect on N-type Ca 2+ The inhibition of the channel and the successful delivery of CBD3. The co-immunoprecipitation (COIP) experiment was further used to detect whether sDNF would affect the interaction between CaV2.2 and CRMP2. First, the CRMP2 antibody was combined with CRMP2 to form an immune complex, and then its immunoprecipitation complex was used for immunoblotting. The inhibitory effect of physiological saline (as a control) on the CaV2.2 interaction was almost unchanged, while the inhibitory effect of sDNF at a concentration of 1μM was 31.0% and the inhibitory effect at a concentration of 10μM was 72.3%, showing a dose-dependent ( Figure 1 K), and CRMP2 expression was almost unaffected. These results indicate that the interference of sDNF on CRMP2 and CaV2.2 leads to a decrease in the surface transport of calcium current ( Figure 1 K and 1L).

[0067] Example 4: Verification of sDNF targeting to neurons

[0068] To visualize selective targeting and intracellular distribution, Cy3-labeled sDNF with or without aptamers was co-cultured with SH-SY5Y cells and U87 cells. If red fluorescence was observed in SH-SY5Y cells from sDNF with aptamers, and almost no red fluorescence was detected in SH-SY5Y cells from sDNF with or without aptamers, and U87 cells did not bind to Cy3-labeled sDNF, it was proved that sDNF was targeted to neurons. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) images showed that after 24 hours of incubation, it was observed whether sDNF was distributed inside and on the surface of cells, indicating that they were internalized by cells and had a stable morphology.

[0069] like Figure 1As shown in G and 1H, the red fluorescence of sDNF with nucleic acid aptamers was clearly visible in SH-SY5Y cells, while sDNF without nucleic acid aptamers was almost undetectable in SH-SY5Y cells. The significant granular fluorescence indicated that the fluorescence emission originated from the structurally intact sDNF rather than the dissociated Cy3 chains. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) images revealed that after 24 hours of incubation, sDNF was distributed inside or on the surface of cells, confirming that it was internalized by cells and maintained a stable morphology.

[0070] Experimental Example 5: Verification of the inhibitory effect of sDNF on sympathetic activity

[0071] (1) Neural activity recording: Tungsten-coated microelectrodes were connected to sympathetic ganglia and inserted into the Powerlab 26T system (AD Instruments, Australia) for neural activity recording. Key parameters for neural activity recording include amplitude and frequency. Neural activity was recorded at baseline and after myocardial infarction in the acute group, while it was recorded 4 weeks after LADO surgery in the chronic group. All data were analyzed in the Labchart system (AD Instruments, Australia).

[0072] (2) HRV (heart rate variability) refers to the frequency variability of heartbeat intervals, which is used to reflect the activity state of the autonomic nervous system. The rat electrocardiogram was collected using the Powerlab data acquisition system, and the data were analyzed using Labchart software. Among them, LF (low frequency) reflects the sympathetic nerve tension (0.25-0.75 Hz), HF (high frequency) reflects the parasympathetic nerve tension (0.75-2.5 Hz), and the LF / HF ratio reflects the balance state of the autonomic nervous system.

[0073] Given that the frequency and amplitude of sympathetic ganglia are key parameters for assessing cardiac sympathetic nerve activity, we recorded their changes at different time points. Myocardial infarction can enhance the frequency and amplitude of sympathetic ganglion nerve activity in rats, while sDNF can inhibit its activity. Compared with the control group, LF and LF / HF in the myocardial infarction group increased with the decrease of HF, indicating that the sympathetic nerve activity in the myocardial infarction group was higher. After sDNF treatment, LF and LF / HF were lower than those in the AMI group, while HF was equivalent to that in the control group. The above results indicate that sDNF can effectively inhibit the excessive activation of sympathetic nerves induced by CaV2.2 channels and promote the rebalance of autonomic nerves.

[0074] Example 6: Verification of the inhibitory effect of sDNF on the occurrence of malignant ventricular arrhythmias induced by AMI

[0075] (1) The present invention studies the regulatory effect of sDNF on malignant ventricular arrhythmias by intervening in the sympathetic nerves. After intraganglionic injection of sDNF, an AMI model was established by the above-mentioned LADO surgery, and the electrocardiogram (ECG) was continuously recorded 30 minutes after myocardial infarction, including ventricular fibrillation (VF), ventricular premature beats (VPB) and ventricular tachycardia (VT).

[0076] (2) Ventricular effective refractory period (ERP) is an important indicator for measuring ventricular electrophysiological stability and is closely related to the occurrence of malignant ventricular arrhythmias. The present invention analyzes the ERP of the left ventricular apex (LVA), left ventricular middle (LVM) and left ventricular base (LVB). To evaluate ERP, the present invention places multiple stimulation electrodes at the left ventricular apex (LVA), middle (LVM) and base (LVB). ERP is defined as the maximum S1-S2 interval that does not trigger ventricular capture. The S1 interval is set to 140ms, and S2 stimulation is performed after several consecutive S1 stimulations. Each S1-S2 stimulation interval is gradually shortened from 120ms to 10ms. The longest S1-S2 interval that does not cause the ventricle to be captured by electrical stimulation is the ERP.

[0077] like Figure 2 As shown in EG, microinjection of sDNF into the sympathetic ganglia reduced the frequency of VPB by 70.1%, the number and duration of nsVT by approximately 69.4% and 77.3%, respectively, and the incidence of sVT was 70.4% lower than that in the AMI group. We analyzed the ERP at the left ventricular apex (LVA), left ventricular midsection (LVM), and left ventricular base (LVB). The results showed that myocardial infarction shortened the ERP at all three sites compared with the control group, and injection of sDNF into the sympathetic ganglia improved this change ( Figure 2 I). In addition, the inducibility of malignant ventricular arrhythmias by programmed electrophysiological stimulation (PES) was evaluated. The myocardial infarction group developed severe arrhythmias compared with the control group, and sDNF reduced the inducibility of malignant ventricular arrhythmias. These findings suggest that sDNF inhibits CaV2.2 channel-induced sympathetic overactivation and promotes autonomic rebalance, which is critical for cardioprotection, which may help prevent heart failure or sudden cardiac death.

[0078] Example 7: Verification of the inhibitory effect of sDNF on neuropathic pain caused by LADO surgery

[0079] (1) By evaluating the changes in facial expressions of rats with or without sDNF treatment, the rats were scored for pain based on changes in facial expressions in five aspects, including eye socket tightening, nose bulge, cheek protrusion, ear position, and whisker changes, after they were fully awake after surgery, in order to observe the effects of different intervention measures on pain expression.

[0080] (2) Since pathological pain can be reflected by changes in pain thresholds under thermal stimulation, in order to accurately monitor pain in real time, the present invention uses a thermal pain meter to record the activities of postoperative rats and records the length of time from when mice enter the thermal stimulator to when they start licking their paws, so as to evaluate their sensitivity to pain and reflect their pain threshold.

[0081] The study showed that LADO surgery induced thermal hypersensitivity to pain in rats and lowered the pain threshold of rats, while sDNF treatment administered to the sympathetic ganglia improved the pain expression scores of rats after LADO surgery and continued to reduce pain hypersensitivity for up to 10 hours.

[0082] Example 8: Verification of the effect of sDNF on improving ventricular remodeling and cardiac function in CMI rats

[0083] (1) The CMI model was established by performing LADO surgery on rats and feeding them for 4 weeks after surgery;

[0084] (2) After 4 weeks of LADO treatment, high-resolution echocardiography was used to detect changes in ventricular structure and cardiac function in rats. The main measurement indicators included left ventricular ejection fraction (LVEF), left ventricular end-diastolic diameter (LVIDd), left ventricular end-systolic diameter (LVIDs), and left ventricular end-diastolic volume (LVEDV);

[0085] (3) Measurement of myocardial infarction area: The heart was frozen and cut into 1 mm thick slices, which were incubated in 1% 2,3,5-triphenyltetrazolyl chloride (TTC) solution at 37°C for 30 min. After fixation with 4% paraformaldehyde, the ischemic (white) and non-ischemic (red) areas were observed.

[0086] like Figure 5 As shown in C, the myocardial infarction area in the sDNF group was reduced compared with the CMI group. Combined with the reduced fibrotic scar, this indicates that sDNF treatment inhibited the development of adverse cardiac remodeling, demonstrating the therapeutic effect of sDNF on myocardial repair in vivo. Cardiac function was evaluated by echocardiography on day 28 after treatment, showing that cardiac contractile function was improved after sDNF administration ( Figure 4 D). The left ventricular ejection fraction (LVEF) level of rats in the sDNF group was 80.8%, while that in the CMI group was 56.9% ( Figure 4 E). Figure 5 As shown in FH, cardiac indices including left ventricular fractional shortening (LVFS) such as left ventricular end-diastolic diameter (LVIDd) and left ventricular end-systolic diameter (LVIDs) all showed that sDNF improved cardiac function after myocardial infarction ( Figure 4 FH).

[0087] The above description is only a specific embodiment of the present invention, so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but should conform to the widest scope consistent with the principles and novel features invented herein.

Claims

1. A drug that targets sympathetic nerve cells, characterized in that: The drug uses DNA nanoflowers as carriers, the surface of the DNA nanoflowers is connected to nucleic acid aptamers, and the interior is wrapped and connected to CBD3 peptides; wherein the nucleic acid aptamers are compatible with receptors on the surface of sympathetic nerve cells, and the CBD3 peptides are connected to nucleotides on the DNA nanoflowers through acid-sensitive connection units.

2. The drug targeting sympathetic nerve cells according to claim 1, characterized in that: The receptor is L1 cell adhesion molecule, and the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.

1.

3. The drug targeting sympathetic nerve cells according to claim 1, characterized in that: The particle size of the drug is 300-400 nm.

4. The drug targeting sympathetic nerve cells according to claim 1, characterized in that: The acid-sensitive linking unit is an imine bond.

5. A method for preparing the drug targeting sympathetic nerve cells according to claim 1, characterized in that: include: The CBD3 peptide was linked to the single-stranded DNA1 using an acid-sensitive linker to obtain CBD3-DNA1; Providing a circular DNA template; wherein DNA1 is complementary to a portion of the sequence of the circular DNA template; The circular DNA template, dNTPs, CBD3-DNA1 and phi29 polymerase are mixed in a reaction buffer, subjected to rolling circle amplification reaction, and purified to obtain the drug targeted to enter sympathetic nerve cells as claimed in claim 1.

6. The method for preparing a drug that targets sympathetic nerve cells according to claim 5, characterized in that: The method of connecting the CBD3 peptide to the single-stranded DNA1 using an acid-sensitive linker unit comprises: The N-terminal octanoic acid-arginine repeat sequence-CBD3 and CHO-DNA1 were mixed at room temperature to obtain CBD3-DNA1 after the reaction.

7. The method for preparing a drug that targets sympathetic nerve cells according to claim 5, characterized in that: Providing a circular DNA template includes: hybridizing primers P1 and P2 with T1 and T2 respectively, adding T4 DNA ligase for incubation, and obtaining a circular DNA template; wherein P1 has a nucleotide sequence as shown in SEQ ID NO.4, P2 has a nucleotide sequence as shown in SEQ ID NO.5, T1 has a nucleotide sequence as shown in SEQ ID NO.2, and T2 has a nucleotide sequence as shown in SEQ ID NO.

3.

8. Use of the drug targeted to enter sympathetic nerve cells according to claim 1 in the preparation of drugs for preventing and treating diseases related to ventricular arrhythmia.

9. Use of the drug targeted to enter sympathetic nerve cells according to claim 1 in the preparation of drugs for preventing and treating myocardial infarction-related diseases.

10. The use according to claim 8 or 9, characterized in that: The dosage form of the drug is one or more of capsules, tablets, oral preparations, microcapsule preparations, and injections.

Images