Lipoic acid derived ceramide as well as synthesis method and application thereof

Abstract

The invention discloses lipoic acid derived ceramide as well as a synthesis method and application thereof, and relates to the technical field of biological medicines. The ceramide has a structure as shown in a general formula I or an isomer structure as shown in the general formula I; the isomer comprises an enantiomer, a diastereoisomer and a cis-trans isomer. According to the invention, lipoic acid reacts with sphingosine, phytosphingosine, dihydrosphingosine and 6-hydroxysphingosine to obtain the ceramide with a novel structure. According to the invention, the solubility of ceramide is improved by introducing a lipoic acid fragment with good solubility. The ceramide has an obvious promotion effect on the expression of catalase, and can effectively prevent the generation of free radicals, so that the ceramide has a very good antioxidant effect. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a ceramide derived from lipoic acid, a synthesis method and application thereof. Background Art

[0002] Alpha-lipoic acid, also known as 6,8-dithiooctanoic acid or lipoic acid, is a powerful antioxidant that helps cells convert glucose into energy, and can also help fight skin inflammation and stabilize blood sugar. Alpha-lipoic acid is known as a universal antioxidant because it is soluble in water and fat and can penetrate tissues such as the nervous system and heart that are mainly composed of fat and water, thus protecting them from free radical damage. Alpha-lipoic acid can also help the body increase its supply of glutathione, which is the most abundant natural antioxidant in the body and can clear free radicals from the body before they damage cells. Free radicals have been shown to damage the immune system and make the body more sensitive to infection, heart disease and cancer.

[0003] Ceramide is a class of compounds composed of long-chain sphingoid bases and fatty acids, in which the carbon chain length, unsaturation and number of hydroxyl groups of the sphingoid base part and the fatty acid part can vary. Ceramide is the main component of lipids in the extracellular matrix in the epidermis of human skin, accounting for about 50%. Together with cholesterol and saturated fatty acids, ceramide produces an impermeable protective structure to prevent excessive water evaporation and also prevent the entry of microorganisms. Due to the importance of ceramide, there is a wide demand for functional ceramides in the market. However, the existing ceramides have poor solubility in water and oil, which leads to certain difficulties in their application.

[0004] US Patent No. 20080249073A discloses a cosmetic composition comprising: a) salicylsphingoid base and / or its derivatives, and b) a dermatologically acceptable carrier, for treating and / or preventing cellular skin by increasing dermal structural proteins (collagen and fibrillin) and reducing the activity level of MMP-1. The salicylsphingoid base has the following structure:

[0005]

[0006] The salicyloyl sphingoid base derivative has the following structure:

[0007]

[0008] The patent discloses that ceramide derived from phytosphingosine and salicylic acid can not only be used to treat the skin barrier, but can also effectively treat and prevent skin diseases caused by chronological aging or photoaging. However, the patent does not study the solubility of salicylsphingosine base and its derivatives in water / oil.

[0009] Chinese patent CN115894278A discloses a ceramide derived from linolenic acid and its preparation method and application. The patent reacts long-chain linolenic acid with sphingosine and phytosphingosine to obtain a class of novel ceramide compounds, which have a significant inhibitory effect on tyrosinase and can effectively prevent the formation of melanin, thus having a good skin whitening effect and can be used in the fields of cosmetics. However, the patent does not study the solubility of ceramide derived from linolenic acid in water / oil.

[0010] In view of this, in order to solve the deficiencies of the prior art, the present invention provides a lipoic acid-derived ceramide and a synthesis method and application thereof. Summary of the invention

[0011] The purpose of the present invention is to provide a ceramide derived from lipoic acid and a synthesis method and application thereof. The present invention prepares a new type of ceramide, improves the solubility of ceramide, and enhances the biological activities of ceramide such as anti-oxidation.

[0012] To achieve the above-mentioned purpose of the invention, the technical solution of the present invention is as follows:

[0013] In one aspect, the present invention provides a lipoic acid-derived ceramide having a structure of Formula I or an isomer of Formula I:

[0014]

[0015] Among them, R 1 is a substituted or unsubstituted alkyl group;

[0016] The isomers include enantiomers, diastereomers and cis-trans isomers.

[0017] Preferably, the alkyl group is -(C 10-20 ) alkyl; said -(C 10-20 ) The alkyl group may be optionally substituted by 0-5 substituents, each of which is independently selected from -OH, -CHO, -COOH, -NH2, -NO2, a halogen atom, and a phenyl group.

[0018] More preferably, the alkyl group is -C 15 alkyl.

[0019] More preferably, the -C 15The alkyl group may be optionally substituted with 0-1 substituents, wherein the substituent is -OH.

[0020] More preferably, R 1 Select one of the following structures:

[0021]

[0022] Among them, the -C 13 H 27 , -C 15 H 31 , -C 14 H 29 , -C 12 H 25 It can be a straight chain or a branched chain.

[0023] More preferably, the R 1 Select one of the following structures:

[0024]

[0025] Finally, preferably, the ceramide is one of the following structures:

[0026]

[0027] In another aspect, the present invention provides a method for synthesizing the above ceramide, comprising the following steps:

[0028]

[0029] Among them, R in compound S3 1 is a substituted or unsubstituted alkyl group.

[0030] Preferably, the synthesis method comprises the following steps:

[0031] (1) Compound S1 reacts with dichlorodiphenylmethane under Lewis acid catalysis to obtain compound S2; (2) Compound S2 reacts with compound S3 and an organic base to obtain compound I.

[0032] Further preferably, in step (1), the Lewis acid is ferrous chloride.

[0033] Further preferably, in step (2), the organic base is diisopropylethylamine.

[0034] Further preferably, in step (1) and step (2), the solvent for the reaction is dichloromethane.

[0035] More preferably, the molar ratio of the compound S1, dichlorodiphenylmethane, Lewis acid, organic base and compound S3 is 1-2.2:1-2.2:0.05-0.2:1-5:1.

[0036] In yet another aspect, the present invention provides a medical dressing comprising the above-mentioned ceramide.

[0037] Preferably, the medical dressing further comprises octyldodecanol, hexyldecanol, caprylic / capric triglyceride, tocopheryl acetate, water, glycerin, sodium hyaluronate, collagen and methylparaben.

[0038] In yet another aspect, the present invention provides a composition comprising the above-mentioned ceramide, a pharmaceutically acceptable salt thereof, a hydrate thereof or a solvate thereof.

[0039] Finally, the present invention provides the use of the above ceramide in cosmetics, skin care products, health care products, medical devices or medicines.

[0040] As used herein, "pharmaceutically acceptable salt" means a salt of one aspect of the present invention that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts formed with inorganic acids or organic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, hydroxysuccinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1, 2-ethanedisulfonic acid, 2-hydroxyethylsulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2,2,2]-oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, dodecylsulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid and muconic acid; or (2) salts formed when the acidic proton present in the parent compound is substituted.

[0041] As used herein, "hydrate" refers to a compound that is bound to water. The binding between the compound and water includes non-covalent binding.

[0042] As used herein, "solvate" means a complex formed by solute molecules or ions and solvent molecules or ions.

[0043] The "medical device" used herein refers to Class II medical devices, which refer to medical devices whose safety and effectiveness should be controlled, including dressings, wound care materials, hemostatic sponges, medical absorbent cotton, medical absorbent gauze, etc. In a specific embodiment, the Class II medical device is a medical dressing, which refers to a covering for a wound or a material placed near a wound, which has absorbency, adhesion, protection, osmotic regulation, pH regulation or pressure induction. The dressing may be in direct or indirect contact with the wound.

[0044] The beneficial effects of the present invention are:

[0045] (1) The present invention reacts lipoic acid with sphingosine, phytosphingosine, dihydrosphingosine, and 6-hydroxysphingosine to obtain a class of novel ceramide compounds.

[0046] (2) The preparation of ceramide derived from lipoic acid is more challenging than that of other types of long-chain carboxylic acids because the disulfide bonds in lipoic acid are easily oxidized to thiols, and the reaction system obtained under conventional carboxylic acid and amine condensation reaction conditions is difficult to purify. In the preparation process of the present invention, a highly active acyl chloride intermediate is prepared from tert-butyl lipoate under mild conditions, and then the corresponding ceramide is successfully obtained by docking with an alcohol compound through a one-pot method.

[0047] (3) The present invention improves the solubility of ceramide by introducing lipoic acid fragments with better solubility, making it more convenient to use in formulations. Compared with traditional ceramide NPs, ceramide derived from lipoic acid has better solubility.

[0048] (4) Lipoic acid-derived ceramide has a significant promoting effect on the expression of catalase and can effectively prevent the generation of free radicals, thus having a good antioxidant effect.

[0049] (5) Compared with traditional ceramide NPs, lipoic acid-derived ceramide can better enhance the activity of reduced glutathione and has a stronger ability to inhibit lipid peroxidation expression.

[0050] (6) Lipoic acid-derived ceramide has a good inhibitory effect on advanced glycation end products, thus having a good anti-glycation effect.

[0051] (7) Lipoic acid-derived ceramides can increase collagen expression and improve skin elasticity and toughness. Compared with traditional ceramide NPs, lipoic acid-derived ceramides show better ability to increase collagen content. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1The figures are comparative test results of the solubility of ceramide NP and ceramide prepared in Examples 1-4 in octyldodecanol; wherein, a is the test result picture of ceramide NP; b is the test result picture of ceramide prepared in Example 1; c is the test result picture of ceramide prepared in Example 2; d is the test result picture of ceramide prepared in Example 3; and e is the test result picture of ceramide prepared in Example 4.

[0053] Figure 2 The figures are comparative test results of the solubility of ceramide NP and ceramide prepared in Examples 1-4 in isomeric hexadecanol; wherein, a is the test result picture of ceramide NP; b is the test result picture of ceramide prepared in Example 1; c is the test result picture of ceramide prepared in Example 2; d is the test result picture of ceramide prepared in Example 3; and e is the test result picture of ceramide prepared in Example 4.

[0054] Figure 3 This is a bar graph showing the effect of ceramide prepared in Example 1 on cell proliferation activity.

[0055] Figure 4 This is a bar graph showing the effect of lipoic acid on cell proliferation activity.

[0056] Figure 5 This is a bar graph showing the effect of the ceramide prepared in Example 2 on the activity of intracellular CAT enzyme.

[0057] Figure 6 This is a bar graph showing the effect of the ceramide prepared in Example 1 on the activity of intracellular CAT enzyme.

[0058] Figure 7 This is a bar graph showing the effect of lipoic acid on intracellular CAT enzyme activity.

[0059] Figure 8 This is a bar graph showing the effect of ceramide prepared in Example 3 on intracellular GSH activity.

[0060] Fig. 9 This is a bar graph showing the effect of the ceramide prepared in Example 4 on the activity of intracellular GSH.

[0061] Fig.10 This is a bar graph showing the effect of lipoic acid on intracellular GSH activity.

[0062] Fig.11 This is a bar graph showing the effect of ceramide NP on intracellular GSH activity.

[0063] Fig.12This is a bar graph showing the results of ceramide prepared in Example 2 inhibiting lipid peroxidation expression.

[0064] Fig.13 This is a bar graph showing the results of ceramide prepared in Example 1 inhibiting lipid peroxidation expression.

[0065] Fig.14 This is a bar graph showing the results of ceramide prepared in Example 3 inhibiting lipid peroxidation expression.

[0066] Fig.15 The bar graph shows the results of ceramide NP inhibiting lipid peroxidation expression.

[0067] Fig.16 This is a bar graph showing the results of ceramide prepared in Example 2 inhibiting the formation of AGEs.

[0068] Fig.17 This is a bar graph showing the results of ceramide prepared in Example 1 inhibiting the formation of AGEs.

[0069] Fig.18 This is a bar graph showing the results of ceramide prepared in Example 4 inhibiting the formation of AGEs.

[0070] Fig.19 This is a bar chart showing the effect of ceramide prepared in Example 2 on the Col-1 content.

[0071] Fig. 20 This is a bar chart showing the effect of ceramide prepared in Example 1 on the Col-1 content.

[0072] Fig.21 This is a bar graph showing the effect of ceramide NP on Col-1 content.

[0073] Figure 3-21 One-way ANOVA was used for statistical analysis. Compared with the other concentrations, the Control group had a P value > 0.05, which was indicated by "ns", indicating no significant difference; a P value < 0.05 was indicated by "*", a P value < 0.01 was indicated by "**", a P value < 0.001 was indicated by "***", and a P value < 0.0001 was indicated by "****", indicating a significant difference. DETAILED DESCRIPTION

[0074] The following non-limiting examples can enable those skilled in the art to more fully understand the present invention, but do not limit the present invention in any way. The following content is only an exemplary description of the scope of the present invention, and those skilled in the art can make various changes and modifications to the invention of the present invention based on the disclosed content, and they should also fall within the scope of the present invention.

[0075] The present invention is further described below by way of specific examples. The various chemical reagents used in the examples of the present invention are obtained through conventional commercial channels unless otherwise specified. Unless otherwise specified, the contents described below are all weight contents. Unless otherwise specified, it is understood that the process is carried out at room temperature.

[0076] Example 1

[0077] The one-pot method for preparing sphingosine lipoate is as follows:

[0078]

[0079] Compound thioctic acid tert-butyl ester (50mmol), dichlorodiphenylmethane (55mmol), ferrous chloride (0.05mmol), dichloromethane 150mL, add in 250mL round-bottom flask, stir 1h at room temperature, then sphingosine (47.5mmol) and diisopropylethylamine (DIPEA) (75mmol) add in reaction system, continue to stir 1-3h at room temperature until thin layer chromatography (TLC) monitors sphingosine base reaction completely. Post-treatment: add saturated sodium bicarbonate aqueous solution to quench. Separate organic layer, dry, filter and vacuum concentrate. The residue thus obtained is purified by silica gel column to obtain thioctic acid sphingosine, 65% yield.

[0080] 1 H NMR(400MHz, CDCl3) δ6.40(d,J=7.5Hz,1H),5.82-5.70(m,1H),5.50(ddt,J=15.4,6.3,1.5Hz,1H),4.27( t,J=4.9Hz,1H),3.95-3.83(m,2H),3.67(dd,J=11.1,3.3Hz,1H),3.61-3.50(m,1H),3.33(s,2H),3.22-3 .04(m,2H),2.51-2.38(m,1H),2.23(t,J=7.4Hz,2H),2.03(q,J=7.1Hz,2H),1.90(dd,J=13.0,6.7Hz,1H) ,1.67(td,J=9.0,3.7Hz,4H), 1.46(td,J=8.6,4.5Hz,2H), 1.25(d,J=4.1Hz,22H), 0.86(t,J=6.7Hz,3H).

[0081] Example 2

[0082] The one-pot method for preparing lipoic acid phytosphingosine is as follows:

[0083]

[0084] Compound t-butyl thioctic acid (50mmol), dichlorodiphenylmethane (55mmol), ferrous chloride (0.05mmol), dichloromethane 150mL, added in 250mL round-bottom flask, stirred at room temperature for 1h, then phytosphingosine (47.5mmol) and DIPEA (75mmol) were added to the reaction system, and stirring was continued for 1-3h at room temperature until TLC monitoring sphingosine base reaction was complete. Post-treatment: quenched by adding saturated sodium bicarbonate aqueous solution. Separate organic layer, dry, filter and vacuum concentrate. The residue thus obtained was purified by silica gel column to obtain thioctic acid phytosphingosine, 68% yield.

[0085] 1 H NMR(400MHz,Chloroform-d)δ6.50(d,J=7.7Hz,1H),4.17(ddt,J=8.2,5.7,2.7Hz,1H),4 .07-3.83(m,2H),3.75(dd,J=11.5,5.6Hz,1H),3.61(tdd,J=14.6,12.4,10.8,4.6Hz,3H) ,3.29-3.05(m,2H),2.49(dq,J=12.5,6.3Hz,1H),2.27(t,J=7.4Hz,2H),2.00-1.80(m,2 H), 1.71 (tt, J = 13.4, 5.5Hz, 5H), 1.60-1.41 (m, 4H), 1.28 (s, 22H), 0.90 (t, J = 6.7Hz, 3H).

[0086] Example 3

[0087] The one-pot method for preparing lipoic acid dihydrosphingosine is as follows:

[0088]

[0089] Compound thioctic acid tert-butyl ester (50mmol), dichlorodiphenylmethane (55mmol), ferrous chloride (0.05mmol), dichloromethane 150mL, add in 250mL round-bottom flask, stir 1h at room temperature, then dihydrosphingosine (47.5mmol) and DIPEA (75mmol) add in reaction system, continue to stir 1-3h at room temperature until TLC monitors sphingoid base reaction is complete. Post-treatment: add saturated sodium bicarbonate aqueous solution to quench. Separate organic layer, dry, filter and vacuum concentrate. The residue thus obtained is purified by silica gel column to obtain thioctic acid dihydrosphingosine, 70% yield.

[0090] 1H NMR (400MHz, CDCl3) δ6.68-5.88(m,1H),4.56-3.46(m,4H),3.16(dddd,J=17.9,13.3,11.0,6.2Hz,2H),2.81(s,1H),2.65-2.41(m, 1H), 2.36 (t, J = 7.4Hz, 1H), 2.24 (dt, J = 11.4, 7.4Hz, 2H), 1.80-1.60 (m, 4H), 1.60-1.39 (m, 5H), 1.27 (s, 21H), 0.89 (t, J = 6.8Hz, 3H).

[0091] Example 4

[0092] The one-pot method for preparing lipoic acid-6-hydroxysphingosine is as follows:

[0093]

[0094] Compound t-butyl thioctic acid (50mmol), dichlorodiphenylmethane (55mmol), ferrous chloride (0.05mmol), dichloromethane 150mL, add in 250mL round-bottom flask, stir 1h at room temperature, then 6-hydroxysphingosine (47.5mmol) and DIPEA (75mmol) add in reaction system, continue stirring 1-3h at room temperature until TLC monitors sphingosine base reaction is complete. Post-treatment: add saturated sodium bicarbonate aqueous solution to quench. Separate organic layer, dry, filter and vacuum concentrate. The residue thus obtained is purified by silica gel column to obtain thioctic acid-6-hydroxysphingosine, 60% yield.

[0095] 1 H NMR(400MHz, CDCl3) δ6.48(d,J=7.6Hz,1H),5.92-5.76(m,1H),5.50-5.47(m,1H),4.24(t,J =4.8Hz,1H),3.91-3.85(m,3H),3.62(dd,J=11.2,3.2Hz,1H),3.66-3.52(m,1H),3.31(s,2H ),3.25-3.08(m,2H),2.55-2.37(m,1H),2.06(q,J=7.2Hz,2H),1.94(dd,J=13.0,6.7Hz,1H) ,1.62-1.56(m,4H),1.44(td,J=8.4,4.6Hz,2H),1.25-1.17(m,22H),0.89(t,J=6.7Hz,3H).

[0096] Example 5

[0097] A Class II medical dressing (liquid type) is prepared in the following steps:

[0098] First, 1 part of lipoic acid phytosphingosine and 10 parts of oils (3 parts of octyldodecanol, 2 parts of hexyldecanol, 4 parts of caprylic / capric triglyceride, 1 part of tocopherol acetate) are heated and dissolved uniformly at 90-100° C., then emulsified, high-pressure homogenized, cooled, mixed with 80 parts of purified water, 11 parts of glycerol, 0.1 parts of sodium hyaluronate, 0.2 parts of collagen, and 0.1 parts of methylparaben, and finally sterilized to prepare a medical dressing (liquid type) containing lipoic acid phytosphingosine, wherein the above parts are all parts by weight.

[0099] Results

[0100] 1. Comparison of the solubility of ceramide NP and ceramide prepared in Examples 1-4

[0101] Octyldodecanol and isomeric hexadecyl alcohol, which are commonly used in cosmetic formulation systems, were selected as test solvents to compare the solubility of ceramide NP and the ceramide prepared in Examples 1 to 4. 0.1 g of the sample was weighed and added to 9.9 g of solvent to prepare a 1% sample solution, and 0.2 g of the sample was weighed and added to 9.8 g of solvent to prepare a 2% sample solution, and the solubility was tested at 25°C and 50°C, respectively.

[0102] Table 1 Comparative test results of solubility in octyl dodecanol

[0103] sample 1％(25℃) 1％(50℃) 2％(50℃) Ceramide NP Very slightly soluble Slightly soluble Slightly soluble Example 1 Slightly soluble Dissolve Dissolve Example 2 Dissolve Dissolve Dissolve Example 3 Slightly soluble Dissolve Dissolve Example 4 Dissolve Dissolve Dissolve

[0104] Table 2 Comparative test results of solubility in isomeric hexadecanol

[0105] sample 1％(25℃) 1％(50℃) 2％(50℃) Ceramide NP Very slightly soluble Slightly soluble Slightly soluble Example 1 Slightly soluble Dissolve Dissolve Example 2 Dissolve Dissolve Dissolve Example 3 Slightly soluble Dissolve Dissolve Example 4 Dissolve Dissolve Dissolve

[0106] The results are shown in Tables 1-2 and Figure 1-2 As shown, the ceramide obtained by introducing lipoic acid fragments exhibits better solubility than traditional ceramide NPs, which is conducive to high-content addition applications in formulations.

[0107] 2. MTT assay to detect the effects of compounds on cell proliferation

[0108] Human keratinocytes HaCaT cells were cultured at 1×10 4 The cells were seeded at a density of 100 μL / well in a 96-well plate and incubated overnight in an incubator. After 24 hours, the supernatant was discarded, and 100 μL of samples (ceramide and lipoic acid prepared in Example 1) or blank DMEM medium diluted with DMEM medium was added (three groups were set in parallel for each concentration), and the medium was removed after further incubation for 24 hours. 100 μL of MTT was added to each well, and the absorbance at 450 nm was measured to calculate the cell survival rate = A给药孔 / A 空白孔 ×100%.

[0109] Table 3 Test results of lipoic acid sphingosine and lipoic acid on cell proliferation activity (HaCaT cells)

[0110]

[0111] The results are shown in Table 3. Figure 3-4 As shown, the ceramide prepared in Example 1 has no toxic side effects on human keratinocytes within a concentration range of 500 mg / L, showing good biosafety. At high concentrations (250 mg / L and 500 mg / L), the ceramide prepared in Example 1 shows better safety to human keratinocytes than lipoic acid.

[0112] 3. Detection of intracellular CAT enzyme activity

[0113] HFF-1 cells were cultured at 1×10 6 The cells were seeded in a 6-well plate at a density of 100 μL / well and incubated overnight in a 5% CO2, 37°C incubator. After 24 hours, the supernatant was discarded, and 100 μL of a medium containing samples (ceramide and lipoic acid prepared in Example 1-2) of different concentrations was added. The blank control group was a DMEM medium without drugs. After 24 hours of administration, the model group, the positive control group (0.5 mM VC), and the experimental group were incubated with 8 mM / L H2O2 for 2 hours, with 3 replicates in each group. After incubation for 4 hours, the total protein was extracted, the cells were lysed, and the supernatant was taken. The protein concentration was tested with a BCA protein concentration determination kit, and the CAT (catalase) activity was tested. Antioxidant enzymes such as CAT can remove free radicals and reactive oxygen species produced by the body. As age increases, the activity of antioxidant enzymes decreases, which can lead to excess free radicals and reactive oxygen species, causing the body to gradually age.

[0114] The results are as follows Figure 5-7 As shown, the relative activity of CAT in the blank control group was set to 1.03, the activity of CAT in the model group was 0.38, and the activity of the positive control group was 0.75. At the concentrations of 3.91 mg / L, 7.81 mg / L, and 15.62 mg / L, the CAT activity of the ceramide prepared in Example 2 was 0.69, 0.58, and 0.78, the CAT activity of the ceramide prepared in Example 1 was 0.65, 0.89, and 1.04, and the CAT activity of lipoic acid was 0.56, 0.61, and 0.62. The results show that the ceramide prepared in Examples 1-2 can increase CAT expression, thereby inhibiting the overexpression of free radicals in cells, and the higher the sample concentration, the more significant the improvement of CAT activity, and the more obvious the inhibition of overexpressed free radicals in cells. Compared with lipoic acid, the ceramide prepared in Examples 1-2 has a more obvious effect on improving CAT activity.

[0115] 4. Intracellular GSH activity detection

[0116] The cells were seeded in a 6-well plate and placed in an incubator until the cells were fused to about 80%; the old culture medium was discarded, and the sample (ceramide, lipoic acid, ceramide NP prepared in Example 3-4) solution was diluted with DMEM culture medium, 1 mL of sample solution of different concentrations was added to each well, and 1 mL of DMEM culture medium was added to the control group and the model group respectively, and placed in an incubator for 24 hours; after 24 hours, the old culture medium was discarded, and 0.5-0.8 mM H2O2 was stimulated for 3 hours according to the cell density (the H2O2 concentration was determined according to the density and state of the cells), 1 mL was added to each well, and 1 mL of DMEM culture medium was added to the control group; after 3 hours of oxidative stimulation, the old culture medium was discarded, and the cells were washed 3 times with PBS, 350 mL of PBS was added to each well, and the cells were scraped off with a scraper, vortexed and ultrasonicated (vortexed once for 30 seconds, ultrasonicated for 5 minutes, and ice bags were added during ultrasonication to prevent the water bath temperature from being too high), centrifuged at 7000 r / min for 5 minutes, and the supernatant was taken; the experiment was carried out according to the instructions of the trace reduced glutathione (GSH) assay kit.

[0117] The results are as follows Figure 8-11 As shown, the relative activity of GSH in the blank control group was set to 100.50, the activity of GSH in the model group was 52.79%, the activity in the positive control group was 90.80%, and at the concentrations of 3.91 mg / L, 7.81 mg / L, and 15.62 mg / L, the GSH activity of ceramide prepared in Example 3 was 49.09%, 60.24%, and 78.94%, the GSH activity of ceramide prepared in Example 4 was 55.92%, 70.98%, and 77.77%, the GSH activity of lipoic acid was 65.05%, 75.84%, and 79.04%, and the GSH activity of ceramide NP was 22.21%, 36.17%, and 42.05%. The results show that the ceramide and lipoic acid prepared in Examples 3-4 can both enhance the activity of GSH. At a concentration of 15.62 mg / L, the three compounds have similar effects on enhancing the activity of GSH, while the effect of ceramide NP on enhancing the activity of GSH is far less significant than that of ceramide prepared in Examples 3-4.

[0118] 5. Anti-lipid peroxidation expression detection

[0119] Lipid peroxidation is the process of free radical oxidation of biological membranes after enhanced oxygen stress, which changes the fluidity and permeability of cell membranes, and ultimately leads to changes in cell structure and function. The TBARS method measures lipid peroxidation expression based on the thiobarbituric acid reactant generated by the reaction of lipid peroxides with thiobarbituric acid (TBA).

[0120] Dissolve 3g of lecithin in 300mL PBS (10mmol / L, pH 7.4); add 75g of trichloroacetic acid (TCA), 1.875g of TBA, and 10.5mL of concentrated HCl (mass fraction of 36%) into 500mL of pure water at once and mix well; add 1mL of lecithin, 1mL of FeSO4 solution (400μmol / L), and 1mL of ascorbic acid solution (400μmol / L) into a centrifuge tube in sequence, and then add 1mL of sample solution (ceramide and ceramide NP prepared in Example 1-3) of different concentrations respectively; after mixing well, place in a constant temperature water bath (37°C) in a dark place for 60min; then add 2mL of TCA-TBA-HCl mixed solution and place in a water bath at 90-100°C for 15min; cool rapidly at 4000r / min, and take the supernatant to measure the absorbance at 535nm. Inhibition rate (%) = [(A 空白 -A 样品 ) / A 空白 ]×100%.

[0121] The results are as follows Figure 12-15 As shown, the blank control group was set to 0.00, the model group was set to 52.95%, and at the concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the lipid peroxidation inhibition rate of the ceramide prepared in Example 2 was 20.47%, 29.05%, and 40.23%, the lipid peroxidation inhibition rate of the ceramide prepared in Example 1 was 19.57%, 36.41%, and 43.16%, the lipid peroxidation inhibition rate of the ceramide prepared in Example 3 was 19.16%, 31.64%, and 41.09%, and the lipid peroxidation inhibition rate of ceramide NP was 10.42%, 17.02%, and 22.47%. The results show that the ceramides prepared in Examples 1-3 can all significantly inhibit the expression of lipid peroxidation, while the inhibitory ability of ceramide NP on lipid peroxidation expression is far less significant than that of the ceramide prepared in Examples 1-3.

[0122] 6. Anti-glycation detection

[0123] Glycation is the process in which reducing sugars react with terminal amino groups on macromolecules such as proteins, nucleic acids, and lipids to eventually generate irreversible advanced glycation end products (AGEs). AGEs not only promote the production of a large number of free radicals and trigger inflammatory responses, but also destroy skin homeostasis, cause skin dullness, and promote skin aging.

[0124] Under aseptic conditions, 4 mL of bovine serum albumin solution and glucose solution sterilized with a sterilization film were added to a sterile bottle. After mixing evenly, 4 mL of samples of different concentrations (ceramide prepared in Example 1, Example 2, and Example 4) and phosphate buffer were added, and incubated at 37°C in the dark for 10 days. Aminoguanidine was used instead of the sample as a positive control group, and phosphoric acid was used instead of the sample as a blank control group. The AGEs content was determined on the 10th day of the reaction. Each group was tested three times in parallel.

[0125] The AGEs test method is: take 3 mL of glycosylated material and measure the fluorescence value F of the glycosylation end product at an excitation wavelength of 340 nm and an emission wavelength of 420 nm. s (represents the content of total fluorescent AGEs); the fluorescence value measured by phosphoric acid solution is F0.

[0126] Calculate the inhibition rate = (F0-F s ) / F0×100%

[0127] The results are as follows Figure 16-18 As shown, the AGEs content of the blank control group was set to 0.00, and the AGEs content of the model group was set to 76.80%. At the concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the AGEs inhibition rates of the ceramide prepared in Example 2 were 20.73%, 26.23%, 29.31%, and 40.49%, the AGEs inhibition rates of the ceramide prepared in Example 1 were 23.59%, 31.17%, 38.04%, and 48.48%, and the AGEs inhibition rates of the ceramide prepared in Example 4 were 25.20%, 31.66%, 39.96%, and 45.58%. The ceramides prepared in Example 1, Example 2, and Example 4 all have good anti-glycation effects.

[0128] 7. Collagen Col-1 activity detection

[0129] HFF-1 cells were cultured at 1×10 6 The cells were seeded at a density of 100 μL / well in a 6-well plate and incubated overnight in a 5% CO2, 37°C incubator. After 24 hours, the supernatant was discarded, and 100 μL of a medium containing samples (ceramide and ceramide NP prepared in Example 1-2) of different concentrations was added. The blank control group was a DMEM medium without drugs, and 0.025 mM EGCG was used as a positive control. After 24 hours of administration, three replicates were collected in each group, and the expression of Col-1 was detected using a Col-1 kit, total RNA was extracted, and RNA was reverse transcribed into cDNA, and quantitatively analyzed using a fluorescent quantitative PCR instrument.

[0130] Primer sequences:

[0131] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0132] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0133] The results are as follows Figure 19-21 As shown, the relative expression of Col-1 mRNA in the blank control group was set to 99.70%, and the expression of the positive control group was 129.50%. At the concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the relative expression of Col-1 of ceramide prepared in Example 2 was 94.02%, 100.30%, 108.70%, and 114.50%; the relative expression of Col-1 of ceramide prepared in Example 1 was 99.13%, 106.10%, 115.10%, and 121.30%; the relative expression of Col-1 of ceramide NP was 96.35%, 101.00%, 101.70%, and 108.10%.

[0134] The content of collagen Col-1 is closely related to the elasticity and toughness of the skin. The ceramide and ceramide NP prepared in Example 1-2 can both increase the expression of Col-1 and improve the elasticity and toughness of the skin. The dose dependence is obvious. The higher the concentration of the ceramide prepared in Example 1-2, the more significant the improvement of the Col-1 content, and the more significant the improvement of the elasticity and toughness of the skin; among them, the ceramide prepared in Example 1-2 has a significantly better effect on improving the Col-1 content than ceramide NP.

[0135] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A ceramide derived from lipoic acid, characterized in that A compound having the structure of general formula I or the structure of an isomer of general formula I: Among them, R 1 is a substituted or unsubstituted alkyl group; The isomers include enantiomers, diastereomers and cis-trans isomers.

2. The ceramide according to claim 1, characterized in that The alkyl group is -(C 10-20 ) alkyl; said -(C 10-20 ) The alkyl group may be optionally substituted by 0-5 substituents, each of which is independently selected from -OH, -CHO, -COOH, -NH2, -NO2, a halogen atom, and a phenyl group.

3. The ceramide according to claim 2, characterized in that The alkyl group is -C 15 Alkyl; the -C 15 The alkyl group may be optionally substituted with 0-1 substituents, wherein the substituent is -OH.

4. The ceramide according to claim 3, characterized in that R 1 Select one of the following structures: Among them, the -C 13 H 27 , -C 15 H 31 , -C 14 H 29 , -C 12 H 25 Is a straight chain or a branched chain; Preferably, the R 1 Select one of the following structures: Further preferably, the ceramide is one of the following structures:

5. The method for synthesizing ceramide according to any one of claims 1 to 4, characterized in that: The following steps are involved: Among them, R in compound S3 1 is a substituted or unsubstituted alkyl group.

6. The synthesis method according to claim 5, characterized in that The following steps are involved: (1) Compound S1 and dichlorodiphenylmethane react under Lewis acid catalysis to obtain compound S2; (2) Compound S2 reacts with compound S3 and an organic base to obtain compound I.

7. The synthesis method according to claim 6, characterized in that In step (1), the Lewis acid is ferrous chloride; In step (2), the organic base is diisopropylethylamine; In step (1) and step (2), the solvent for the reaction is dichloromethane.

8. The synthesis method according to claim 6, characterized in that The molar ratio of the compound S1, dichlorodiphenylmethane, Lewis acid, organic base and compound S3 is 1-2.2:1-2.2:0.05-0.2:1-5:

1.

9. A medical dressing, characterized in that: The medical dressing comprises the ceramide according to any one of claims 1 to 4.

10. A composition, characterized in that The composition comprises the ceramide according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, or a solvate thereof.

11. Use of the ceramide according to any one of claims 1 to 4 in cosmetics, skin care products, health products, medical devices or medicines.

Images