A recombinant bacterium for fermentation production of D-panthenol and its application

Abstract

The present invention discloses a recombinant bacterium for fermentative production of D-panthenol and its application. The present invention relates to the field of biotechnology and provides a recombinant bacterium for fermentative production of D-panthenol, which is obtained by expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacterium; the chassis host bacterium is Escherichia coli capable of synthesizing D-pantoic acid and L-homoserine from glucose. Compared with existing chemical synthesis methods, the present invention achieves pure biosynthesis of D-panthenol from glucose, has the advantages of being environmentally friendly and low-cost, and lays a good foundation for the large-scale industrial production of D-panthenol.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant bacterium for producing D-panthenol by fermentation and an application thereof. Background Art

[0002] D-Panthenol is an alcohol derivative of pantothenic acid (vitamin B5) and is widely used in the pharmaceutical, cosmetic and food industries.

[0003] Currently, the production of D-panthenol primarily relies on chemical synthesis, but this method presents challenges such as harsh reaction conditions, significant environmental pollution, and high costs. In recent years, with the advancement of synthetic biology, the use of microbial cell factories to synthesize D-panthenol has emerged as a green and sustainable alternative. However, existing microbial D-panthenol synthesis technologies are inefficient, making them difficult to meet the demands of industrial production.

[0004] Therefore, developing a genetically engineered strain that can efficiently synthesize D-panthenol has important application value. Summary of the Invention

[0005] The purpose of the present invention is to provide a recombinant bacterium for fermenting and producing D-panthenol and its application.

[0006] In a first aspect, the present invention claims protection for a recombinant bacterium for fermentative production of D-panthenol.

[0007] The recombinant bacteria for fermentation production of D-panthenol claimed in the present invention are obtained by expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacteria;

[0008] Wherein, the chassis host bacteria is Escherichia coli which can synthesize D-pantoic acid and L-homoserine by utilizing glucose.

[0009] Furthermore, the tyrosine decarboxylase may be derived from Enterococcus faecalis V583 ( Enterococcus faecalis ) or a variant thereof, specifically (A1) or (A2):

[0010] (A1) a protein having an amino acid sequence as shown in SEQ ID No. 1;

[0011] (A2) Fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0012] Furthermore, the D-pantothenate synthase may be a D-pantothenate synthase derived from Mycobacterium tuberculosis or a variant thereof, which may be specifically as follows (B1) or (B2):

[0013] (B1) a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0014] (B2) Fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1).

[0015] The purpose of adding the protein tag, such as 6His, can be to facilitate the purification of the target protein.

[0016] Furthermore, the expression of the tyrosine decarboxylase and the D-pantothenate synthetase in the chassis host bacteria can be achieved by introducing a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthetase into the chassis host bacteria.

[0017] Furthermore, the gene encoding the tyrosine decarboxylase and the gene encoding the D-pantothenate synthetase can be introduced into the chassis host bacteria in the form of a recombinant vector.

[0018] In one embodiment of the present invention, the recombinant vector is specifically a recombinant plasmid obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pTrc99A with the mutV583ADC gene shown in SEQ ID No. 3 (i.e., the gene encoding the tyrosine decarboxylase) and the MtpanC gene shown in SEQ ID No. 4 (i.e., the gene encoding the D-pantothenate synthase).

[0019] Furthermore, the sequence of the gene encoding the tyrosine decarboxylase may be as follows (C1) or (C2):

[0020] (C1) SEQ ID No. 3;

[0021] (C2) The sequence obtained by connecting the coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No. 3.

[0022] Among them, SEQ ID No.3 encodes the amino acid sequence shown in SEQ ID No.1.

[0023] Furthermore, the sequence of the gene encoding the D-pantothenate synthase may be as follows (D1) or (D2):

[0024] (D1) SEQ ID No. 4;

[0025] (D2) The sequence obtained by connecting the coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No. 4.

[0026] Among them, SEQ ID No.4 encodes the amino acid sequence shown in SEQ ID No.2.

[0027] Furthermore, the chassis host bacteria is Escherichia coli that expresses acetolactate synthase alsS, dihydroxyacid dehydratase ilvD, α-ketoisovalerate hydroxymethyltransferase panB, ketovalerate reductase panE, and homoserine dehydrogenase thrA*, and does not express fumarate reductase frdABCD, acetate kinase ackA, lactate dehydrogenase ldhA, alcohol dehydrogenase adhE, pyruvate oxidase poxB, pyruvate formate lyase pflB, phosphotransacetylase pta, propionate kinase tdcD, 2-ketobutyrate formate lyase tdcE, methylglyoxal synthase mgsA, choline dehydrogenase betA, Toll-Pal system protein tolR, and putative PTS enzyme IIC component frwC.

[0028] Among them, the amino acid sequence of the acetolactate synthase alsS is SEQ ID No. 18, and the corresponding coding gene sequence is the reverse complementary sequence of positions 504-2215 of SEQ ID No. 15; the amino acid sequence of the dihydroxy-acid dehydratase ilvD is SEQ ID No. 19, and the corresponding coding gene sequence is positions 548-2398 of SEQ ID No. 16; the amino acid sequence of the α-ketoisovalerate hydroxymethyltransferase panB is SEQ ID No. 20, and the corresponding coding gene sequence is positions 1516-2310 of SEQ ID No. 17; the amino acid sequence of the ketovalerate reductase panE is SEQ ID No. 21, and the corresponding coding gene sequence is positions 553-1464 of SEQ ID No. 17; and the amino acid sequence of the homoserine dehydrogenase thrA* is SEQ ID No. 22, and the corresponding coding gene sequence is positions 1114-3576 of SEQ ID No. 14. The amino acid sequence of the fumarate reductase frdABCD is the sequence shown in genbank No. NP_418577.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 948666; the amino acid sequence of the acetate kinase ackA is the sequence shown in genbank No. NP_416799.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 946775; the amino acid sequence of the lactate dehydrogenase ldhA is the sequence shown in genbank No. NP_415898.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 946315; the amino acid sequence of the alcohol dehydrogenase gene adhE is the sequence shown in genbank No. NP_415757.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945837; the amino acid sequence of the pyruvate oxidase poxB is shown in GenBank No. NP_415392.1 (updated on March 9, 2022), and the corresponding encoding gene sequence is Gene ID: 946132; the amino acid sequence of the pyruvate formate lyase pflB is shown in GenBank No. NP_415423.1 (updated on March 9, 2022), and the corresponding encoding gene sequence is Gene ID: 945514; the amino acid sequence of the phosphotransacetylase pta is shown in GenBank No. NP_416800.1 (updated on March 9, 2022), and the corresponding encoding gene sequence is Gene ID: 946778; the amino acid sequence of the propionate kinase tdcD is shown in GenBank No. NP_417585.2 (updated date, 20220309), the corresponding coding gene sequence is Gene ID: 947635; the amino acid sequence of the 2-ketobutyrate formate lyase gene tdcE is the sequence shown in genbank No. YP_026205.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 947623; the amino acid sequence of the methylglyoxal synthase mgsA is the sequence shown in genbank No. NP_415483.2 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945574; the amino acid sequence of the choline dehydrogenase betA is the sequence shown in genbank No. NP_414845.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945716; the amino acid sequence of the Toll-Pal system protein tolR is shown in GenBank No. NP_415266.1 (updated on March 9, 2022), and the corresponding encoding gene sequence is Gene ID: 945328; the amino acid sequence of the putative PTS enzyme IIC component frwC is shown in GenBank No. NP_418384.1 (updated on March 9, 2022), and the corresponding encoding gene sequence is Gene ID: 948448.

[0029] In one embodiment of the present invention, the recipient Escherichia coli is obtained by performing the following modifications on Escherichia coli ATCC 9637: (a1) knocking out the coding gene of the fumarate reductase frdABCD in the genome; (a2) knocking out the coding gene of the acetate kinase ackA in the genome; (a3) ​​knocking out the coding gene of the lactate dehydrogenase ldhA in the genome; (a4) knocking out the coding gene of the alcohol dehydrogenase adhE in the genome; (a5) knocking out the coding gene of the pyruvate oxidase poxB in the genome; (a6) knocking out the coding gene of the pyruvate formate lyase pflB in the genome; (a7) knocking out the coding gene of the phosphotransacetylase pta in the genome; (a8) knocking out the coding gene of the propionate kinase tdcD in the genome; (a9) knocking out the coding gene of the 2-ketobutyrate formate lyase tdcE in the genome; (a10) knocking out the putative PTS enzyme IIC component protein frwC (amino acid sequence as shown in SEQ ID No.23) is replaced by an expression cassette containing the gene encoding homoserine dehydrogenase thrA* (amino acid sequence as shown in SEQ ID No.22) (i.e., expression cassette 1); (a11) the gene encoding methylglyoxal synthase mgsA (amino acid sequence as shown in SEQ ID No.24) in the genome is replaced by an expression cassette containing the gene encoding acetolactate synthase alsS (amino acid sequence as shown in SEQ ID No.18) (i.e., expression cassette 2); (a12) the gene encoding choline dehydrogenase betA (amino acid sequence as shown in SEQ ID No.25) in the genome is replaced by an expression cassette containing the gene encoding dihydroxy acid dehydratase ilvD (amino acid sequence as shown in SEQ ID No.19) (i.e., expression cassette 3); (a13) the gene encoding Toll-Pal system protein tolR (amino acid sequence as shown in SEQ ID No.26) in the genome is replaced by an expression cassette containing the gene encoding α-ketoisovalerate hydroxymethyltransferase panB (amino acid sequence as shown in SEQ ID No. 20) and the expression cassette (i.e., expression cassette 4) encoding the gene encoding the ketovalerate reductase panE (amino acid sequence is shown in SEQ ID No. 21).

[0030] In the expression cassette 1, the promoter that drives transcription of the gene encoding homoserine dehydrogenase thrA* is the P119 promoter. Furthermore, the expression cassette 1 comprises the P119 promoter, an RBS sequence (AAAGAGGAGAAA), and the gene encoding homoserine dehydrogenase thrA*. The sequence of the P119 promoter is shown at positions 998-1032 of SEQ ID No. 14.

[0031] In expression cassette 2, the promoter that initiates transcription of the gene encoding the acetolactate synthase alsS is the J119 promoter. Furthermore, expression cassette 2 comprises the P119 promoter, an RBS sequence (AGGAG), and the gene encoding the acetolactate synthase alsS. The sequence of the P119 promoter is shown as the reverse complement of positions 2232-2266 of SEQ ID No. 15.

[0032] In expression cassette 3, the promoter that drives transcription of the gene encoding the dihydroxy-acid dehydratase ilvD is the P119 promoter. Furthermore, expression cassette 3 comprises the P119 promoter, an RBS sequence (AGGAG), and the gene encoding the dihydroxy-acid dehydratase ilvD. The sequence of the P119 promoter is shown at positions 497-531 of SEQ ID No. 16.

[0033] In expression cassette 4, the promoter that drives transcription of the gene encoding α-ketoisovalerate hydroxymethyltransferase panB and the gene encoding ketovalerate reductase panE is the P119 promoter. Furthermore, expression cassette 4 comprises the P119 promoter, the gene encoding α-ketoisovalerate hydroxymethyltransferase panB, and the gene encoding ketovalerate reductase panE. The sequence of the P119 promoter is shown at positions 502-536 of SEQ ID No. 17.

[0034] More specifically, (a1) to (a13) can all be achieved through Crispr / cas9 technology. In a specific embodiment of the present invention, the nucleotide sequence of the targeting fragment (donor fragment) used in (a1) is shown as SEQ ID No.5; the nucleotide sequence of the targeting fragment (donor fragment) used in (a2) is shown as SEQ ID No.6; the nucleotide sequence of the targeting fragment (donor fragment) used in (a3) ​​is shown as SEQ ID No.7; the nucleotide sequence of the targeting fragment (donor fragment) used in (a4) is shown as SEQ ID No.8; the nucleotide sequence of the targeting fragment (donor fragment) used in (a5) is shown as SEQ ID No.9; the nucleotide sequence of the targeting fragment (donor fragment) used in (a6) is shown as SEQ ID No.10; the nucleotide sequence of the targeting fragment (donor fragment) used in (a7) is shown as SEQ ID No.11; the nucleotide sequence of the targeting fragment (donor fragment) used in (a8) is shown as SEQ ID No.12; the nucleotide sequence of the targeting fragment (donor fragment) used in (a9) is shown as SEQ ID No. 13; the nucleotide sequence of the targeting fragment (donor fragment) used in (a10) is shown as SEQ ID No. 14; the nucleotide sequence of the targeting fragment (donor fragment) used in (a11) is shown as SEQ ID No. 15; the nucleotide sequence of the targeting fragment (donor fragment) used in (a12) is shown as SEQ ID No. 16; the nucleotide sequence of the targeting fragment (donor fragment) used in (a13) is shown as SEQ ID No. 17.

[0035] In a second aspect, the present invention claims protection for the use of the recombinant bacteria described in the first aspect in the fermentation production of D-panthenol.

[0036] In a third aspect, the present invention claims a method for producing D-panthenol by fermentation.

[0037] The method for producing D-panthenol by fermentation claimed in the present invention may include the following steps: fermenting and culturing the recombinant bacteria described in the first aspect above in a fermentation medium containing glucose to obtain D-panthenol from the fermentation product.

[0038] The recombinant bacteria can use glucose to synthesize L-homoserine and D-pantoic acid. Then, the tyrosine decarboxylase expressed by the recombinant bacteria uses L-homoserine as a substrate to synthesize 3-amino-1-propanol. Finally, the D-pantothenate synthase expressed by the recombinant bacteria uses D-pantoic acid and 3-amino-1-propanol as substrates to synthesize D-panthenol.

[0039] Furthermore, the solvent of the fermentation medium is water, and the solutes and concentrations are as follows: 4 g / L (NH4)2HPO4, 6 g / L KH2PO4, 1.8 g / L citric acid monohydrate, 2 g / L magnesium sulfate heptahydrate, 2 g / L yeast extract, 0.8 g / L lysine, 0.4 g / L threonine, 0.25 g / L methionine, 0.4 g / L isoleucine, and 20 g / L glucose monohydrate.

[0040] Furthermore, the fermentation culture conditions are as follows: pH is controlled at 6.8-7.2, dissolved oxygen is controlled at 25%-30%, residual sugar is controlled below 2 g / L, the fermentation culture time is 48 hours, and the temperature is 37°C.

[0041] In a fourth aspect, the present invention claims protection for a complete set of products consisting of the chassis host bacteria and recombinant expression vector described in the first aspect above;

[0042] The recombinant expression vector carries a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthase described in the first aspect.

[0043] In one embodiment of the present invention, the recombinant vector is specifically a recombinant plasmid obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pTrc99A with the mutV583ADC gene shown in SEQ ID No. 3 (i.e., the gene encoding the tyrosine decarboxylase) and the MtpanC gene shown in SEQ ID No. 4 (i.e., the gene encoding the D-pantothenate synthase).

[0044] In a fifth aspect, the present invention claims protection for the use of the set of products described in the fourth aspect above in the preparation of the recombinant bacteria described in the first aspect above.

[0045] In a sixth aspect, the present invention claims a method for preparing the recombinant bacteria described in the first aspect above.

[0046] The method for preparing the recombinant bacteria of the first aspect as claimed in the present invention may comprise the following steps: expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacteria to obtain the recombinant bacteria;

[0047] The chassis host bacteria is the chassis host bacteria described in the first aspect above;

[0048] The tyrosine decarboxylase is the tyrosine decarboxylase described in the first aspect above;

[0049] The D-pantothenate synthetase is the D-pantothenate synthetase described in the first aspect above.

[0050] In the method, the method for expressing the tyrosine decarboxylase and the D-pantothenate synthetase in the chassis host bacteria can be referred to the first aspect described above.

[0051] Experiments have demonstrated that the present invention's method enables direct bio-fermentation of D-panthenol. The D-panthenol-producing strain constructed in this invention can produce approximately 0.22 g / L of D-panthenol from glucose. Compared to existing chemical synthesis methods, this method achieves pure biosynthesis of D-panthenol from glucose, offering advantages such as environmental friendliness and low cost, laying a solid foundation for large-scale industrial production of D-panthenol. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 This is a schematic diagram of the principle of producing D-panthenol by fermentation of E. coli according to the present invention.

[0053] Figure 2 This is the HPLC detection spectrum of D-panthenol standard.

[0054] Figure 3 This is the HPLC detection spectrum of the D-panthenol-synthesizing strain DP13-pTrc99A-MtpanC-mutV583ADC reaction conversion product in Example 3. DETAILED DESCRIPTION

[0055] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0056] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0057] The quantitative data involved in the following examples are the mean values ​​of the results of at least three repeated experiments.

[0058] The experimental materials involved in the following examples are as follows:

[0059] D-panthenol standard: Yuanye Bio, product number S11131.

[0060] pET28a plasmid: YEASEN Biotechnology, catalog number 11905ES03.

[0061] pTrc99a plasmid: Qincheng Biotechnology, catalog number QCP0389.

[0062] pCas plasmid and pTargetF plasmid: Both are described in the reference "Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Applied Environmental Microbiology. 2015, 81(7): 2506-2514", and are available to the public from the applicant for use only in repeating the experiments of the present invention and for no other use.

[0063] Figure 1 This is a schematic diagram of the principle of D-panthenol production by Escherichia coli fermentation. Using CRISPR-Cas9 gene editing technology, the expression and activity of key enzymes in the D-pantoate and homoserine synthesis pathways (acetolactate synthase alsS, dihydroxy acid dehydratase ilvD, α-ketoisovalerate hydroxymethyltransferase panB, ketovalerate reductase panE, and homoserine dehydrogenase thrA*) were enhanced, while genes in the competing pathways (fumarate reductase frdABCD, acetate kinase ackA, lactate dehydrogenase ldhA, alcohol dehydrogenase adhE, pyruvate oxidase p-hydroxymethyltransferase) were simultaneously knocked out. The de novo synthesis of D-panthenol was achieved by co-expressing the tyrosine decarboxylase mutant S126M-N100A-E299A and the D-pantothenate synthase MtpanC in the plasmid pTrc99A.

[0064] Example 1. Construction of D-pantoic acid and L-homoserine producing strain DP13

[0065] The purpose of this example is to construct a recombinant Escherichia coli strain (designated strain DP13) capable of synthesizing D-pantoic acid and L-homoserine from glucose. The synthesized D-pantoic acid and L-homoserine serve as substrates for subsequent tyrosine decarboxylase mutants and D-pantothenate synthase to further synthesize D-panthenol.

[0066] The primer sequences involved in this example are shown in Table 1.

[0067]

[0068]

[0069] 1. The fumarate reductase frdABCD encoding gene in the genome of Escherichia coli ATCC 9637 was knocked out to obtain strain DP01

[0070] 1. Preparation of the targeting fragment ΔfrdABCD

[0071] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs frdABCD-UP-F / frdABCD-UP-R and frdABCD-DOWN-F / frdABCD-DOWN-R (for specific sequences, see Table 1) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli frdABCD gene, respectively. The upstream and downstream homology arms of the frdABCD gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔfrdABCD, and its sequence is shown in SEQ ID No. 5. Positions 1-500 of SEQ ID No. 5 represent the upstream homology arm of the frdABCD locus, and positions 501-1000 represent the downstream homology arm of the frdABCD locus.

[0072] 2. Construction of targeting plasmid pTargetF-frdABCD

[0073] Using the pTargetF plasmid as a template and pTargetF-frdABCD-F and pTargetF-frdABCD-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the frdABCD site recognition N20. After sequencing verification, it was named pTargetF-frdABCD. The nucleotide sequence of its N20 is ATGACCCAACTGGAACTGTG (positions 1-20 of SEQ ID No. 31).

[0074] 3. Genome Editing

[0075] (1) Prepare electrocompetent cells of the target strain according to the preparation method of Escherichia coli electrocompetent cells, transform the pCas9 plasmid into Escherichia coli ATCC 9637 by electroporation, spread on kanamycin (40 mg / L) resistant LB plates, and culture at 30°C to obtain transformants ATCC 9637 / pCas.

[0076] (2) The obtained Escherichia coli ATCC 9637 / pCas was inoculated into LB medium containing kanamycin and 0.2% final concentration of L-arabinose, and cultured at 30°C for 3-4 hours to prepare electrocompetent cells;

[0077] (3) The targeting fragment ΔfrdABCD (SEQ ID No. 5) prepared in step 1 and the targeting plasmid pTargetF-frdABCD constructed in step 2 were simultaneously transferred into the electroporation competent medium obtained in step (2). After recovery at 30°C for 1 hour, the cells were spread on LB plates containing kanamycin, streptomycin (100 mg / L) and 0.2% final concentration of L-arabinose, and cultured in a 30°C incubator.

[0078] (4) Perform colony PCR on single colonies grown on the screening plate using primers frdABCD-UP-F and frdABCD-DOWN-R (see Table 1) located on the chromosomes at both ends of the target gene locus. Verify the results by agarose gel electrophoresis. Select single colonies with a 1000 bp fragment and culture them in LB medium containing kanamycin and 0.5 mM IPTG (isopropyl-β-D-thiogalactopyranoside) at 30°C overnight.

[0079] (5) Use an inoculating loop to dip the overnight culture solution into three zones on an LB plate containing kanamycin, and then culture it in a 30°C incubator. After a single colony grows, streak it on an LB plate containing kanamycin and streptomycin, respectively, and then culture it in a 30°C incubator. If no colony grows on the LB plate containing streptomycin, the targeting plasmid has been eliminated.

[0080] (6) Single colonies that have eliminated the targeting plasmid were selected and streaked onto LB plates without antibiotics and cultured at 42°C overnight;

[0081] (7) The single colonies grown were spotted on LB plates containing kanamycin and antibiotics and cultured in a 37°C incubator. If no growth was observed on the LB plate containing kanamycin, the pCas9 plasmid was successfully eliminated and a recombinant strain was obtained, named DP01. The genotype of DP01 was ATCC 9637ΔfrdABCD.

[0082] 2. Knockout of the gene encoding acetate kinase ackA in the genome of Escherichia coli DP01 to obtain strain DP02

[0083] 1. Preparation of the targeting fragment ΔackA

[0084] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs ackA-UP-F / ackA-UP-R and ackA-DOWN-F / ackA-DOWN-R (see Table 1 for specific sequences) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli ackA gene, respectively. The upstream and downstream homology arms of the ackA gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was named ΔackA, and its sequence is shown in SEQ ID No. 6. Positions 1-500 of SEQ ID No. 6 represent the upstream homology arm of the ackA site, and positions 501-1000 represent the downstream homology arm of the ackA site.

[0085] 2. Construction of targeting plasmid pTargetF-ackA

[0086] Using the pTargetF plasmid as a template and pTargetF-ackA-F and pTargetF-ackA-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the ackA site recognition N20. After sequencing verification, it was named pTargetF-ackA, and the nucleotide sequence of its N20 was GGTCACCGTATCGTACACGG (positions 1-20 of SEQ ID No. 37).

[0087] 3. Genome Editing

[0088] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔackA (SEQ ID No. 6) prepared in Step 1 and the targeting plasmid pTargetF-ackA constructed in Step 2 into the DP01 strain. The detection primers are ackA-UP-F and ackA-DOWN-R (see Table 1), and the positive amplified fragment is 1000 bp. The resulting recombinant strain is designated DP02. The genotype of DP02 is ATCC 9637ΔfrdABCDΔackA.

[0089] 3. Knockout of the gene encoding lactate dehydrogenase ldhA in the genome of Escherichia coli DP02 to obtain strain DP03

[0090] 1. Preparation of the targeting fragment ΔldhA

[0091] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs ldhA-UP-F / ldhA-UP-R and ldhA-DOWN-F / ldhA-DOWN-R (for specific sequences, see Table 1) to obtain a 505-bp upstream fragment and a 504-bp downstream fragment of the E. coli ldhA gene, respectively. The upstream and downstream homology arms of the ldhA gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔldhA, and its sequence is shown in SEQ ID No. 7. Positions 1-505 of SEQ ID No. 7 represent the upstream homology arm of the ldhA locus, and positions 506-1009 represent the downstream homology arm of the ldhA locus.

[0092] 2. Construction of targeting plasmid pTargetF-ldhA

[0093] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-ldhA-F and pTargetF-ldhA-R as primers (see Table 1 for specific sequences). A 2118 bp plasmid containing the ldhA site recognition N20 was obtained. After sequencing verification, it was named pTargetF-ldhA. The nucleotide sequence of its N20 was TTTGCCATACATAGTAAAGC (positions 1-20 of SEQ ID No. 43).

[0094] 3. Genome Editing

[0095] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔldhA (SEQ ID No. 7) prepared in Step 1 and the targeting plasmid pTargetF-ldhA constructed in Step 2 into the DP02 strain. Detection primers were ldhA-UP-F and ldhA-DOWN-R (see Table 1). The positive amplified fragment was 1009 bp. The resulting recombinant strain was designated DP03. The genotype of DP03 is ATCC 9637ΔfrdABCDΔackAΔldhA.

[0096] 4. The gene encoding alcohol dehydrogenase adhE in the genome of Escherichia coli DP03 was knocked out to obtain strain DP04

[0097] 1. Preparation of the targeting fragment ΔadhE

[0098] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs adhE-UP-F / adhE-UP-R and adhE-DOWN-F / adhE-DOWN-R (for specific sequences, see Table 1) to obtain a 500-bp upstream fragment and a 501-bp downstream fragment of the E. coli adhE gene, respectively. The upstream and downstream homology arms of the adhE gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔadhE, and its sequence is shown in SEQ ID No. 8. Positions 1-500 of SEQ ID No. 8 represent the upstream homology arm of the adhE locus, and positions 501-1001 represent the downstream homology arm of the adhE locus.

[0099] 2. Construction of targeting plasmid pTargetF-adhE

[0100] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-adhE-F and pTargetF-adhE-R as primers (see Table 1 for specific sequences). A 2118 bp plasmid containing the adhE site recognition N20 was obtained. After sequencing verification, it was named pTargetF-adhE. The nucleotide sequence of its N20 was GGATCAGGTTGATGTCTGGG (positions 1-20 of SEQ ID No. 49).

[0101] 3. Genome Editing

[0102] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔadhE (SEQ ID No. 8) prepared in Step 1 and the targeting plasmid pTargetF-adhE constructed in Step 2 into the DP03 strain. Detection primers were adhE-UP-F and adhE-DOWN-R (see Table 1), and the positive amplified fragment was 1001 bp. The resulting recombinant strain was designated DP04. The genotype of DP04 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhE.

[0103] 5. The gene encoding pyruvate oxidase poxB in the genome of Escherichia coli DP04 was knocked out to obtain strain DP05

[0104] 1. Preparation of the targeting fragment ΔpoxB

[0105] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs poxB-UP-F / poxB-UP-R and poxB-DOWN-F / poxB-DOWN-R (see Table 1 for specific sequences) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli poxB gene, respectively. The upstream and downstream homology arms of the poxB gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔpoxB, and its sequence is shown in SEQ ID No. 9. Positions 1-500 of SEQ ID No. 9 represent the upstream homology arm of the poxB locus, and positions 501-1000 represent the downstream homology arm of the poxB locus.

[0106] 2. Construction of targeting plasmid pTargetF-poxB

[0107] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-poxB-F and pTargetF-poxB-R as primers (see Table 1 for specific sequences). A 2118 bp plasmid containing the poxB site recognition N20 was obtained. After sequencing verification, it was named pTargetF-poxB. The nucleotide sequence of its N20 was GGTGAAAATAGCGTCATCGG (positions 1-20 of SEQ ID No. 55).

[0108] 3. Genome Editing

[0109] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔpoxB (SEQ ID No. 9) prepared in Step 1 and the targeting plasmid pTargetF-poxB constructed in Step 2 into the DP04 strain. Detection primers were poxB-UP-F and poxB-DOWN-R (see Table 1), and the positive amplified fragment was 1000 bp. The resulting recombinant strain was designated DP05. The genotype of DP05 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxB.

[0110] 6. The gene encoding pyruvate formate lyase pflB was knocked out from the genome of Escherichia coli DP05 to obtain strain DP06

[0111] 1. Preparation of the targeting fragment ΔpflB

[0112] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs pflB-UP-F / pflB-UP-R and pflB-DOWN-F / pflB-DOWN-R (see Table 1 for specific sequences) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli pflB gene, respectively. The upstream and downstream homology arms of the pflB gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔpflB, and its sequence is shown in SEQ ID No. 10. Positions 1-500 of SEQ ID No. 10 represent the upstream homology arm of the pflB locus, and positions 501-1000 represent the downstream homology arm of the pflB locus.

[0113] 2. Construction of targeting plasmid pTargetF-pflB

[0114] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-pflB-F and pTargetF-pflB-R as primers (see Table 1 for specific sequences). A 2118 bp plasmid containing the pflB site recognition N20 was obtained. After sequencing verification, it was named pTargetF-pflB. The nucleotide sequence of its N20 was ACAGCCAGGTCATCTACACG (positions 1-20 of SEQ ID No. 61).

[0115] 3. Genome Editing

[0116] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔpflB (SEQ ID No. 10) prepared in Step 1 and the targeting plasmid pTargetF-pflB constructed in Step 2 into the DP05 strain. Detection primers were pflB-UP-F and pflB-DOWN-R (see Table 1), and the positive amplified fragment was 1000 bp. The resulting recombinant strain was designated DP06. The genotype of DP06 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflB.

[0117] 7. The gene encoding phosphotransacetylase pta in the genome of Escherichia coli DP06 was knocked out to obtain strain DP07

[0118] 1. Preparation of Targeting Fragment Δpta

[0119] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs pta-UP-F / pta-UP-R and pta-DOWN-F / pta-DOWN-R (see Table 1 for specific sequences) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli pta gene, respectively. The upstream and downstream homology arms of the pta gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was named Δpta, and its sequence is shown in SEQ ID No. 11. Positions 1-500 of SEQ ID No. 11 represent the upstream homology arm of the pta locus, and positions 501-1000 represent the downstream homology arm of the pta locus.

[0120] 2. Construction of targeting plasmid pTargetF-pta

[0121] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-pta-F and pTargetF-pta-R as primers (see Table 1 for the specific sequences). A 2118 bp plasmid containing the pta site recognition N20 was obtained. After sequencing verification, it was named pTargetF-pta. The nucleotide sequence of its N20 was GTAACCGCCAGTCAGCAGCA (positions 1-20 of SEQ ID No. 67).

[0122] 3. Genome Editing

[0123] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment Δpta (SEQ ID No. 11) prepared in Step 1 and the targeting plasmid pTargetF-pta constructed in Step 2 into the DP06 strain. Detection primers were pta-UP-F and pta-DOWN-R (see Table 1), and the positive amplified fragment was 1000 bp. The resulting recombinant strain was designated DP07. The genotype of DP07 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔpta.

[0124] 8. The gene encoding propionate kinase tdcD in the genome of Escherichia coli DP07 was knocked out to obtain strain DP08

[0125] 1. Preparation of the targeting fragment ΔtdcD

[0126] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs tdcD-UP-F / tdcD-UP-R and tdcD-DOWN-F / tdcD-DOWN-R (see Table 1 for specific sequences) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli tdcD gene, respectively. The upstream and downstream homology arms of the tdcD gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔtdcD, and its sequence is shown in SEQ ID No. 12. Positions 1-500 of SEQ ID No. 12 represent the upstream homology arm of the tdcD locus, and positions 501-1000 represent the downstream homology arm of the tdcD locus.

[0127] 2. Construction of targeting plasmid pTargetF-tdcD

[0128] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-tdcD-F and pTargetF-tdcD-R as primers (see Table 1 for specific sequences). A 2118 bp plasmid containing the tdcD site recognition N20 was obtained. After sequencing verification, it was named pTargetF-tdcD. The nucleotide sequence of its N20 was TTAATGTCAGGTATTGCCGA (positions 1-20 of SEQ ID No. 73).

[0129] 3. Genome Editing

[0130] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔtdcD (SEQ ID No. 12) prepared in Step 1 and the targeting plasmid pTargetF-tdcD constructed in Step 2 into the DP07 strain. Detection primers were tdcD-UP-F and tdcD-DOWN-R (see Table 1), and the positive amplified fragment was 1000 bp. The resulting recombinant strain was designated DP08. The genotype of DP08 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcD.

[0131] 9. The 2-ketobutyrate formate lyase tdcE gene was knocked out from the genome of Escherichia coli DP08 to obtain strain DP09

[0132] 1. Preparation of the targeting fragment ΔtdcE

[0133] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs tdcE-UP-F / tdcE-UP-R and tdcE-DOWN-F / tdcE-DOWN-R (see Table 1 for specific sequences) to obtain a 500-bp upstream and 500-bp downstream fragment of the E. coli tdcE gene, respectively. The upstream and downstream homology arms of the tdcE gene were ligated by Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔtdcE, and its sequence is shown in SEQ ID No. 13. Positions 1-500 of SEQ ID No. 13 represent the upstream homology arm of the tdcE locus, and positions 501-1000 represent the downstream homology arm of the tdcE locus.

[0134] 2. Construction of targeting plasmid pTargetF-tdcE

[0135] PCR amplification was performed using the pTargetF plasmid as a template and pTargetF-tdcE-F and pTargetF-tdcE-R as primers (see Table 1 for specific sequences). A 2118 bp plasmid containing the tdcE site recognition N20 was obtained. After sequencing verification, it was named pTargetF-tdcE. The nucleotide sequence of its N20 was TGATGCCATACAGCGCTACG (positions 1-20 of SEQ ID No. 79).

[0136] 3. Genome Editing

[0137] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔtdcE (SEQ ID No. 13) prepared in Step 1 and the targeting plasmid pTargetF-tdcE constructed in Step 2 into the DP08 strain. Detection primers were tdcE-UP-F and tdcE-DOWN-R (see Table 1), and the positive amplified fragment was 1000 bp. The resulting recombinant strain was designated DP09. The genotype of DP09 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcE.

[0138] 10. The strain DP10 was obtained by replacing the gene encoding the putative PTS enzyme IIC component frwC in the genome of Escherichia coli DP09 with an expression cassette containing the gene encoding the homoserine dehydrogenase thrA*.

[0139] 1. Preparation of the targeting fragment ΔfrwC::P119-thrA*

[0140] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs thrA*-F / thrA*-R, frwC-UP-F / frwC-UP-R, and frwC-DOWN-F / frwC-DOWN-R (see Table 1 for specific sequences). A 997-bp fragment upstream of the frwC gene, an expression cassette for the E. coli homoserine dehydrogenase gene thrA* (containing the P119 promoter, RBS sequence (AAAGAGGAGAAA), and thrA* gene expression sequence), and a 1002-bp fragment downstream of the frwC gene were generated, respectively. The thrA* expression cassette was ligated to the upstream and downstream homology arms of the frwC locus on the genome using Gibson sequencing to construct the targeting fragment. The resulting targeting fragment was designated ΔfrwC::P119-thrA*, and its sequence is shown in SEQ ID No. 14. Positions 1-997 of SEQ ID No. 14 are the upstream homology arm of the frwC site, positions 998-1032 are the P119 promoter sequence, positions 1114-3576 are the thrA* gene sequence, and positions 3577-4578 are the downstream homology arm of the frwC site.

[0141] 2. Construction of targeting plasmid pTargetF-frwC

[0142] PCR amplification was performed using pTargetF as a template and pTargetF-frwC-F and pTargetF-frwC-R as primers (see Table 1 for details). A 2118 bp plasmid containing the frwC site recognition N20 was obtained. After sequencing verification, it was named pTargetF-frwC. The nucleotide sequence of its N20 was CCGGTTTATCGCAAGTTATG (positions 1-20 of SEQ ID No. 87).

[0143] 3. Genome Editing

[0144] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔfrwC::P119-thrA* (SEQ ID No. 14) prepared in Step 1 and the targeting plasmid pTargetF-frwC constructed in Step 2 into the DP09 strain. Detection primers were frwC-UP-F and frwC-DOWN-R (see Table 1). The positive amplified fragment was 4578 bp. The resulting recombinant strain was designated DP10. The genotype of DP10 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*.

[0145] 11. The gene encoding methylglyoxal synthase mgsA in the genome of Escherichia coli DP10 was replaced with an expression cassette containing the gene encoding acetolactate synthase alsS to obtain strain DP11.

[0146] 1. Preparation of the targeting fragment ΔmgsA::P119-alsS

[0147] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using the primer pairs alsS-F / alsS-R, mgsA-UP-F / mgsA-UP-R, and mgsA-DOWN-F / mgsA-DOWN-R (see Table 1 for specific sequences). A 502-bp fragment upstream of the mgsA gene, an expression cassette for the E. coli-derived acetolactate synthase gene (containing the P119 promoter, RBS sequence (AGGAG), and alsS gene expression sequence), and a 503-bp fragment downstream of the mgsA gene were generated, respectively. The alsS expression cassette was ligated to the upstream and downstream homology arms of the mgsA locus on the genome using Gibson ligation to construct the targeting fragment. The resulting targeting fragment was designated ΔmgsA::P119-alsS, and its sequence is shown in SEQ ID No. 15. Positions 1-502 of SEQ ID No. 15 are the upstream homology arm of the mgsA site, positions 2232-2266 are the reverse complementary sequence of the P119 promoter sequence, positions 504-2215 are the reverse complementary sequence of the alsS gene sequence, and positions 2267-2769 are the downstream homology arm of the mgsA site.

[0148] 2. Construction of targeting plasmid pTargetF-mgsA

[0149] PCR amplification was performed using pTargetF as a template and pTargetF-mgsA-F and pTargetF-mgsA-R as primers (see Table 1 for details) to obtain a 2118 bp plasmid containing the mgsA site recognition N20. After sequencing verification, it was named pTargetF-mgsA, and the nucleotide sequence of its N20 was ACAAATGCTGATGAGCTGGG (positions 1-20 of SEQ ID No. 95).

[0150] 3. Genome Editing

[0151] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔmgsA::P119-alsS (SEQ ID No. 15) prepared in Step 1 and the targeting plasmid pTargetF-mgsA constructed in Step 2 into the DP10 strain. Detection primers were mgsA-UP-F and mgsA-DOWN-R (see Table 1). The positive amplified fragment was 2769 bp. The resulting recombinant strain was designated DP11. The genotype of DP11 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*ΔmgsA::P119-alsS.

[0152] 12. The gene encoding choline dehydrogenase betA in the genome of Escherichia coli DP11 was replaced with an expression cassette containing the gene encoding dihydroxy acid dehydratase ilvD to obtain strain DP12

[0153] 1. Preparation of the targeting fragment ΔbetA::P119-ilvD

[0154] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification using the primer pairs ilvD-F / ilvD-R, betA-UP-F / betA-UP-R, and betA-DOWN-F / betA-DOWN-R (see Table 1 for specific sequences) yielded a 496-bp fragment upstream of the betA gene, an expression cassette for the E. coli-derived dihydroxyacid dehydratase gene ilvD (containing the P119 promoter, RBS sequence (AGGAG), and ilvD gene expression sequence), and a 546-bp fragment downstream of the betA gene. The ilvD expression cassette was ligated to the upstream and downstream homology arms of the betA locus on the genome using Gibson sequencing to construct the targeting fragment. The resulting targeting fragment was designated ΔbetA::P119-ilvD, and its sequence is shown in SEQ ID No. 16. Positions 1-496 of SEQ ID No. 16 are the upstream homology arm of the betA site, positions 497-531 are the P119 promoter sequence, positions 548-2398 are the ilvD gene sequence, and positions 2399-2944 are the downstream homology arm of the betA site.

[0155] 2. Construction of targeting plasmid pTargetF-betA

[0156] PCR amplification was performed using pTargetF as a template and pTargetF-betA-F and pTargetF-betA-R as primers (see Table 1 for details). A 2118 bp plasmid containing the betA site recognition N20 was obtained. After sequencing verification, it was named pTargetF-betA. The nucleotide sequence of its N20 was AAAGCCAGCATCATGAATAC (positions 1-20 of SEQ ID No. 103).

[0157] 3. Genome Editing

[0158] Proceed as described in Step 1-3. Simultaneously transform the targeting fragment ΔbetA::P119-ilvD (SEQ ID No. 16) prepared in Step 1 and the targeting plasmid pTargetF-betA constructed in Step 2 into the DP11 strain. Detection primers were betA-UP-F and betA-DOWN-R (see Table 1), and the positive amplified fragment was 2944 bp. The resulting recombinant strain was designated DP12. The genotype of DP12 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*ΔmgsA::P119-alsSΔbetA::P119-ilvD.

[0159] 13. The strain DP13 was obtained by replacing the gene encoding the Tol-Pal system protein tolR in the genome of Escherichia coli DP12 with an expression cassette containing the genes encoding α-ketoisovalerate hydroxymethyltransferase panB and ketopantothenate reductase panE

[0160] 1. Preparation of the targeting fragment ΔtolR::P119-panB / panE

[0161] Using the genome of laboratory-collected Escherichia coli strain ATCC 9637 as a template, PCR amplification was performed using primer pairs panB-F / panB-R, panE-F / panE-R, tolR-UP-F / tolR-UP-R, and tolR-DOWN-F / tolR-DOWN-R (see Table 1 for specific sequences). A 501-bp fragment upstream of the tolR gene, a panB / ketopantothenate reductase gene expression cassette (containing the P119 promoter, RBS sequence (AGGAG), and panB / panE gene expression sequences) capable of expressing the E. coli-derived α-ketoisovalerate hydroxymethyltransferase in E. coli, and a 503-bp fragment downstream of the tolR gene were generated, respectively. The panB / panE expression cassette was ligated to the upstream and downstream homology arms of the tolR locus on the genome using Gibson sequencing to construct the targeting fragment. The resulting targeting fragment was designated ΔtolR::P119-panB and panE, and its sequence is shown in SEQ ID No. 17. Positions 1-501 of SEQ ID No. 17 are the upstream homology arms of the tolR site, positions 502-536 are the P119 promoter sequence, positions 553-1464 are the panE gene sequence, positions 1516-2310 are the panB gene sequence, and positions 2311-2813 are the downstream homology arms of the tolR site.

[0162] 2. Construction of targeting plasmid pTargetF-tolR

[0163] PCR amplification was performed using pTargetF as a template and pTargetF-tolR-F and pTargetF-tolR-R as primers (see Table 1 for details). A 2118 bp plasmid containing the tolR site recognition N20 was obtained. After sequencing verification, it was named pTargetF-tolR. The nucleotide sequence of its N20 was TGGTATTGGTCAGTACACCG (positions 1-20 of SEQ ID No. 113).

[0164] 3. Genome Editing

[0165] Proceed as described in Step 1-3. The targeting fragments ΔtolR::P119-panB and panE (SEQ ID No. 17) prepared in Step 1 and the targeting plasmid pTargetF-tolR constructed in Step 2 were simultaneously transformed into the DP12 strain. The detection primers were tolR-UP-F and tolR-DOWN-R (see Table 1). The positive amplified fragment was 2813 bp. The resulting recombinant strain was designated DP13. The genotype of DP13 is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*ΔmgsA::P119-alsSΔbetA::P119-ilvDΔtolR::P119-panB and panE.

[0166] Example 2: Construction of a D-panthenol-producing strain

[0167] 1. Construction of recombinant plasmid

[0168] 1. Construction of recombinant plasmid pET28a-MtpanC

[0169] The D-pantothenate synthase in this example is derived from Mycobacterium tuberculosis and is hereinafter abbreviated as MtpanC.

[0170] The amino acid sequence of MtpanC is shown in SEQ ID No. 2. The MtpanC gene fragment (SEQ ID No. 4) is derived from Mycobacterium tuberculosis ( Mycobacterium tuberculosis ) genome, with EcoRI and HindIII double restriction sites at both ends of the MtpanC gene fragment. The gene fragment MtpanC, which had been double-digested by EcoRI and HindIII, was then ligated with the expression vector pET28a, which had been double-digested by the same enzymes, at 16°C overnight with the action of T4 DNA ligase (product of Takara) to obtain the ligation solution MtpanC.

[0171] The ligation solution, MtpanC, was transformed into DH5α competent cells (product of Beijing Qingke Biotechnology Co., Ltd.) and sequenced to generate the positive recombinant plasmid pET28a-MtpanC. The structure of the recombinant plasmid pET28a-MtpanC is described as follows: The recombinant plasmid pET28A-MtpanC was generated by replacing the small fragment between the EcoRI and HindIII restriction sites of the expression vector pET28a with the MtpanC gene fragment shown in SEQ ID No. 4.

[0172] 2. Construction of recombinant plasmid pET28a-mutV583ADC

[0173] The tyrosine decarboxylase mutant in the embodiment of the present invention is derived from Enterococcus faecalis V583 ( Enterococcus faecalis The amino acid sequence of the mutated V583ADC (hereinafter referred to as mutV583ADC) is shown in SEQ ID No. 1.

[0174] The mutV583ADC gene fragment (SEQ ID No. 3) is derived from Enterococcus faecalis V583 ( Enterococcus faecalis ) genome and mutated, with SpeI and EcoRI double-digestion sites at both ends of the mutV583ADC gene fragment. MutV583ADC was then double-digested with SpeI and EcoRI and ligated with the similarly double-digested expression vector pET28a using T4 DNA ligase (Takara) at 16°C overnight to obtain the ligation solution mutV583ADC.

[0175] The ligation solution, mutV583ADC, was transformed into DH5α competent cells (product of Beijing Qingke Biotechnology Co., Ltd.) and sequenced to generate the positive recombinant plasmid pET28a-mutV583ADC. The structure of the recombinant plasmid pET28A-mutV583ADC is described as follows: The recombinant plasmid is obtained by replacing the small fragment between the EcoRI and HindIII restriction sites of the expression vector pET28a with the mutV583ADC gene fragment shown in SEQ ID No. 3.

[0176] The positive recombinant plasmid pET28a-mutV583ADC was transformed into the expression host bacteria Escherichia coli BL21 (DE3) (Beijing Qingke Biotechnology Co., Ltd.) to obtain the prokaryotic expression strain pET28a-mutV583ADC-BL21 (DE3).

[0177] 3. Construction of recombinant plasmid pTrc99A-MtpanC-mutV583ADC

[0178] The MtpanC and mutV583ADC gene fragments were amplified by PCR using pET28a-MtpanC and pET28a-mutV583ADC as templates, respectively. The ligated fragments were then ligated into the pTrc99A vector using the Goldgate kit. The ligated products were transformed into DH5α competent cells (Beijing Qingke Biotechnology Co., Ltd.) and verified by sequencing to generate the positive recombinant plasmid pTrc99A-MtpanC-mutV583ADC. The structure of the recombinant plasmid pTrc99A-MtpanC-mutV583ADC is described as follows: The fragment between the EcoRI and HindIII restriction sites of the expression vector pTrc99A was replaced with the DNA fragment obtained by ligating the mutV583ADC gene fragment shown in SEQ ID No. 3 and the MtpanC gene fragment shown in SEQ ID No. 4 end-to-end.

[0179] 2. Obtaining recombinant E. coli DP13-pTrc99A-MtpanC-mutV583 ADC

[0180] The recombinant plasmid pTrc99A-MtpanC-mutV583ADC was transformed into the Escherichia coli DP13 constructed in Example 1 to obtain the recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC.

[0181] Example 3: Fermentation production of D-panthenol by recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC

[0182] A single colony of the recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC constructed in Example 2 was inoculated into LB medium and cultured overnight at 37°C. A 1% (volume percentage) inoculum of the overnight culture was inoculated into 100 mL of LB liquid medium containing 50 μg / mL gentamicin and incubated at 37°C for 8 hours. The resulting seed solution was inoculated into 2 L of fermentation medium at a 5% (volume percentage) inoculum and fermented in a 5 L fermentor for 48 hours. The fermentation medium composition was as follows: 4 g / L (NH₄)₂HPO₄, 6 g / L KH₂PO₄, 1.8 g / L citric acid monohydrate, 2 g / L magnesium sulfate heptahydrate, 2 g / L yeast extract, 0.8 g / L lysine, 0.4 g / L threonine, 0.25 g / L methionine, 0.4 g / L isoleucine, and 20 g / L glucose monohydrate, dissolved in ultrapure water. The pH is controlled at 6.8-7.2, the dissolved oxygen is controlled at 25%-30%, and the residual sugar is controlled below 2g / L.

[0183] D-panthenol production was determined using an Agilent 1260 Series high-performance liquid chromatography (Agilent Technologies, Santa Clara, CA, USA) equipped with an Agilent extended-C18 5.0 μm (4.6 × 250 mm) column. The column temperature was 25°C. Mobile phase A consisted of 20 mM KH2PO4 (pH 3.0) in water and mobile phase B was acetonitrile, with an A:B ratio (volume ratio) of 10:90, and a flow rate of 0.8 mL / min. The fermentation broth was filtered through a 0.22 μm polyethersulfone (PES) filter and then sampled for detection. Absorbance at 215 nm was measured using a diode array detector (DAD). A regression curve was constructed using a D-panthenol standard to plot peak area against concentration.

[0184] Fermentation results such as Figure 2 and Figure 3 The recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC produced 0.22 g / L of D-panthenol after 48 hours of high-density fermentation.

[0185] The above results indicate that the present invention achieves pure biosynthesis of D-panthenol from glucose.

[0186] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A recombinant bacterium for fermentation production of D-panthenol, characterized by: The recombinant bacteria are obtained by expressing tyrosine decarboxylase and D-pantothenate synthase in the chassis host bacteria; The chassis host bacteria is Escherichia coli that can synthesize D-pantoic acid and L-homoserine using glucose; The tyrosine decarboxylase is as follows (A1) or (A2): (A1) a protein having an amino acid sequence as shown in SEQ ID No. 1; (A2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); The D-pantothenate synthase is as follows (B1) or (B2): (B1) a protein having an amino acid sequence as shown in SEQ ID No. 2; (B2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1); The chassis host bacteria is Escherichia coli that expresses acetolactate synthase alsS, dihydroxy acid dehydratase ilvD, α-ketoisovalerate hydroxymethyltransferase panB, ketovalerate reductase panE, and homoserine dehydrogenase thrA*, and does not express fumarate reductase frdABCD, acetate kinase ackA, lactate dehydrogenase ldhA, alcohol dehydrogenase adhE, pyruvate oxidase poxB, pyruvate formate lyase pflB, phosphotransacetylase pta, propionate kinase tdcD, 2-ketobutyrate formate lyase tdcE, methylglyoxal synthase mgsA, choline dehydrogenase betA, Toll-Pal system protein tolR, and putative PTS enzyme IIC component frwC.

2. The recombinant bacterium according to claim 1, characterized in that: The expression of the tyrosine decarboxylase and the D-pantothenate synthetase in the chassis host bacteria is achieved by introducing a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthetase into the chassis host bacteria.

3. The recombinant bacterium according to claim 2, characterized in that: The sequence of the gene encoding the tyrosine decarboxylase is as follows (C1) or (C2): (C1) SEQ ID No. 3; (C2) a sequence obtained by connecting a coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No. 3; and / or The sequence of the gene encoding the D-pantothenate synthase is as follows (D1) or (D2): (D1) SEQ ID No. 4; (D2) The sequence obtained by connecting the coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No.

4.

4. Use of the recombinant bacterium according to any one of claims 1 to 3 in the fermentative production of D-panthenol.

5. A method for producing D-panthenol by fermentation, comprising the steps of: fermenting and culturing the recombinant bacterium according to any one of claims 1 to 3 in a fermentation medium containing glucose, and obtaining D-panthenol from the fermentation product.

6. A complete product consisting of the chassis host bacteria and recombinant expression vector as claimed in claim 1; The recombinant expression vector carries a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthase described in claim 1 or 3.

7. Use of the complete set of products according to claim 6 in the preparation of the recombinant bacteria according to any one of claims 1 to 3.

8. A method for preparing the recombinant bacterium according to any one of claims 1 to 3, comprising the steps of: expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacterium to obtain the recombinant bacterium; The chassis host bacteria is the chassis host bacteria described in any one of claims 1-3; The tyrosine decarboxylase is the tyrosine decarboxylase according to any one of claims 1 to 3; The D-pantothenate synthetase is the D-pantothenate synthetase described in any one of claims 1-3.

Images