Curcumin compound synthetase CsPKS1, gene and application

Abstract

The invention relates to the technical field of biology, and discloses curcumin compound synthetase CsPKS1, a gene and application, the curcumin compound synthetase is marked as CsPKS1, and the amino acid sequence of the curcumin compound synthetase is shown as SEQ ID NO.1. The coding gene is marked as CsPKS-1, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO. 2. According to the invention, a pYES2: CsPKS-1 yeast protein expression plasmid is taken as a carrier, Saccharomyces cerevisiae BY4741 is taken as a host, heterologous expression of the curcumin compound synthetase CsPKS1 is realized, and three curcumin compounds, namely curcumin, dihydrocurcumin and tetrahydrocurcumin, can be simultaneously generated by recombinant bacteria. The gene has important significance on production and application of curcumin compounds, and meanwhile, acquisition of the gene lays a foundation for research on heterologous directional synthesis of curcumin compounds.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a curcumin compound synthase CsPKS1, a gene and an application thereof. Background Art

[0002] Curcuminoids are a rare class of diketone compounds in plants. They exist in the tubers or rhizomes of plants in the Zingiberaceae and Araceae families. They are the main active ingredients in plants such as turmeric. They are widely used in the food industry and in the development of new drugs because of their antioxidant and anti-cancer pharmacological activities. Due to their different benzene ring side chain substituents, curcuminoids can be further divided into curcumin, demethoxycurcumin, bisdemethoxycurcumin, etc.

[0003] In the pharmaceutical field, curcumin has a good therapeutic effect on type II diabetes. Curcumin can also inhibit the viral activity of human immunodeficiency virus and has anti-AIDS effects. Curcumin is effective in treating cancer, rheumatism, inflammatory eye diseases, intestinal diseases, oral cancer and leukoplakia, and has high safety and significant efficacy. Among natural curcumin compounds, curcumin has higher activity in anti-oxidation and DNA repair than demethoxycurcumin and bisdemethoxycurcumin, and is the most important component for exerting drug efficacy.

[0004] The biosynthesis of curcumin by enzyme catalysis has certain advantages, such as mild reaction conditions, high selectivity, and high product specificity. The first condition for enzyme catalysis is the acquisition of high-quality biocatalysts. Curcumin synthase (CURS) can catalyze the in vitro production of curcuminoids from cinnamyl diketoacetylcysteamine (a mimetic of coenzyme A ester) and feruloyl-CoA. Therefore, the study of cloning and expression of high-quality curcumin synthase genes is helpful for the biosynthesis of curcumin, and can also further utilize metabolic engineering or biosynthesis-related technologies for the cell factory production of curcumin. Summary of the invention

[0005] The purpose of the present invention is to provide a curcuminoid compound synthase CsPKS1, a gene and an application thereof, and to carry out the biosynthesis of curcumin by an enzyme catalysis method.

[0006] To achieve the above object, the present invention provides the following technical solutions: The present invention provides a curcuminoids synthase CsPKS1, and the amino acid sequence of the curcuminoids synthase CsPKS1 is shown in SEQ ID NO.1.

[0007] The present invention also provides a gene encoding a curcuminoid compound synthase CsPKS1, the encoding gene is denoted as CsPKS-1, and the nucleotide sequence thereof is shown in SEQ ID NO.2.

[0008] Finally, the present invention also provides an application of a curcuminoid compound synthase CsPKS1 in the preparation of curcumin and its derivatives.

[0009] Furthermore, in the process of preparing curcumin and its derivatives, the following primer sequences are designed to amplify the target gene: At4CL CDS-F:TTAAGAGCTCAGATTCACAAACCGTT At4CL CDS-R:CGACGATAAGATGGCTCCACAAG ClDCS CDS-F:AAGACCTCGAGATGGAAGCCAAC ClDCS CDS-F: ACCAAGCTTTATCAGTTCAATCTACA pYES2-NTB-F:CAGCTGTAATACGACTCACTATAGG pYES2-NTB-R:AGGGTTAGGGATAGGCTTACCTTCG.

[0010] Furthermore, in the process of preparing curcumin and its derivatives, the recombinant plasmid pESC-LEU:At4CL-ClDCS and the recombinant plasmid pYES2-NTB: Cs PKS-1, the recombinant plasmid pESC-LEU:At4CL-ClDCS contains genes encoding Arabidopsis 4-coumaroyl CoA ligase and curcuminone-CoA synthetase, galactose-inducible PGal 1, 10, and leucine and uracil auxotrophic screening tags; the recombinant plasmid pYES2-NTB: Cs PKS-1 contains genes encoding curcuminoids, galactose-inducible PGal 1 and 10, and leucine and uracil nutritional deficiency screening tags.

[0011] Based on the above technical solution, the embodiments of the present invention can at least produce the following technical effects: The invention provides a curcuminoid compound synthase CsPKS1, which uses pYES2:CsPKS-1 yeast protein expression plasmid as a vector and Saccharomyces cerevisiae BY4741 as a host to achieve heterologous expression of the curcuminoid compound synthase CsPKS1, and the recombinant bacteria can simultaneously generate three curcuminoid compounds, namely, curcumin, dihydrocurcumin and tetrahydrocurcumin. The invention is of great significance to the production and application of curcuminoid compounds, and the acquisition of the gene lays a foundation for the research on heterologous directional synthesis of curcuminoid compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying creative work.

[0013] Figure 1 is a standard curve diagram of curcumin of Example 3 of the present invention; Figure 2 is a standard curve diagram of dihydrocurcumin of Example 3 of the present invention; Figure 3 is a standard curve diagram of tetrahydrocurcumin of Example 3 of the present invention; Figure 4 is a curcumin retention time diagram of Example 3 of the present invention; Figure 5 is a retention time diagram of dihydrocurcumin in Example 3 of the present invention; Figure 6 It is a retention time diagram of tetrahydrocurcumin of Example 3 of the present invention. DETAILED DESCRIPTION

[0014] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0015] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0016] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0017] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0018] The curcuminoid synthase gene in the present invention is derived from Sichuan Curcuma aromatica. The plant samples were collected from the Curcuma aromatica base in Zhoudu Village, Jinqiao Town, Shuangliu District, Chengdu City, Sichuan Province.

[0019] Freshly collected tubers of Sichuan Curcuma acuminata were used for RNA extraction, and their cDNA sequences were obtained by reverse transcription PCR to construct cDNA libraries. Transcriptome sequencing was performed using a high-throughput sequencer MGI-T7, and metabolite detection was performed. After data quality control and filtering, differential genes and metabolites were screened, and functional annotation and enrichment analysis were performed on the differential genes and metabolites to explore the key genes in the synthesis pathway of curcuminoids.

[0020] Relevant candidate synthase genes involved in the curcumin biosynthesis pathway were selected, and their amino acid sequences were translated. A phylogenetic tree was constructed with plant type III PKS to find genes that were clustered together with known curcumin synthases or had high similarity as the key gene CsPKS1 for the next step.

[0021] Since the substrates 4-coumaroyl-CoA ligase and asafoetida CoA in the synthesis pathway of curcuminoids are not commercially available, At4CL (ID: AY376729) and ClDCS (ID: AB495006.1) were co-expressed in the engineered bacteria. The target genes CsPKS-1, At4CL and ClDCS were synthesized, CsPKS-1 was connected to pYES2, At4CL and ClDCS were connected to pESC-LEU, and the recombinant plasmids pYES2-NTB: CsPKS1 and pESC-LEU: At4CL-ClDCS were co-transformed into the cerevisiae host BY4741. The BY4741 / pESC-LEU / pYES2-NTB recombinant yeast strain was screened through the SD-UL defective screening plate to achieve efficient expression of the curcuminoid synthase CsPKS1.

[0022] Example 1

[0023] The BY4741 / pESC-LEU / pYES2-NTB strain curcuminoid synthase gene Cs Cloning and expression of PKS-1 Chemical synthesis of target gene Cs PKS-1, At4CL and ClDCS, and construct the recombinant plasmid pYES2-NTB respectively: Cs PKS-1 and pESC-LEU:At4CL-ClDCS.

[0024] Design primers to amplify the target gene. The primer sequences are as follows: At4CL CDS-F:TTAAGAGCTCAGATTCACAAACCGTT At4CL CDS-R:CGACGATAAGATGGCTCCACAAG ClDCS CDS-F:AAGACCTCGAGATGGAAGCCAAC ClDCS CDS-F: ACCAAGCTTTATCAGTTCAATCTACA pYES2-NTB-F:CAGCTGTAATACGACTCACTATAGG pYES2-NTB-R: AGGGTTAGGGATAGGCTTACCTTCG Yeast transformation, the specific steps are as follows: (1) Pick a single colony of BY4741 from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium. Incubate at 30°C, 225 rpm, and shake for 18-20 h (overnight) until OD600>1.5.

[0025] (2) Transfer to YPDA liquid culture medium, culture volume is 50 ml, initial OD600 = 0.2, 30℃, 225 rpm, shake culture for 4-5 h, until OD600 = 0.6-0.8.

[0026] (3) Collect the bacteria by centrifugation at room temperature, 4000 rpm, for 5 min.

[0027] (4) Resuspend the cells in 20 ml of sterile water, mix well, and centrifuge to collect the cells at room temperature, 4000 rpm, for 5 min, and discard the supernatant.

[0028] (5) Resuspend the cells in 5 ml of 0.1 M LiAc, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0029] (6) Resuspend the cells in 500 μl of 0.1 M LiAc, mix well, and dispense into 1.5 ml centrifuge tubes, 50 μl each (for each transformation), for later use.

[0030] (7) Add 240 ul of 50% PEG3350, 36 ul of 1 M LiAc, 5 ul of ssDNA (10 mg / ml), and 5 ul of plasmid DNA to each 1.5 ml centrifuge tube in sequence and mix by pipetting or shaking vigorously for about 1 min until completely mixed.

[0031] (8) Incubate in a 30°C water bath for 30 min.

[0032] (9) Heat shock in a 42°C water bath for 25 min.

[0033] (10) Resuscitate in a 30°C water bath for 30 min.

[0034] (11) Collect the bacteria by centrifugation at 4000 rpm for 5 min at room temperature and discard the supernatant.

[0035] (12) For each transformation, resuspend the cells in 200 μl of sterile water, mix as gently as possible, and spread on the corresponding defect type screening plate (SD-UL).

[0036] (13) Incubate at 30°C for 4 days.

[0037] (14) After 4-7 days, select 8-16 white yeast cells that are 2 mm in size and plate them on SG-UL+raffinose plates.

[0038] In order to identify whether the positive clones screened in the defective screening plate are correct, these positive clones are amplified from yeast cells for DNA sequencing, and the positive clones expressing correctly are selected.

[0039] Example 2 Induced expression (1) The correctly identified clones (clones grown on SG-UL+raffinose plates) were picked into 5 mL SD-Ura / Leu liquid medium (2% glucose as the carbon source) and shaken for 24 h at 30°C and 220 rpm until the OD600 reached 0.2; (2) Expansion culture: 500 μl of bacterial culture was transferred to 5 mL of SD-Ura / Leu liquid medium (2% glucose as carbon source), and shaken for 12 h at 30°C and 220 rpm until OD600 reached 5.0. (3) Re-cultivation: dilute the cultured bacterial solution to an OD of 0.05, take 2 mL of the bacterial solution and add it to 20 mL of SD-Ura / Leu liquid medium (2% glucose as the carbon source), and shake the culture for 48 h at 30°C and 220 rpm. (4) Inducing expression: 20 ml of bacterial solution was collected at 4000 rpm for 5 min, the supernatant was removed, and the cells were resuspended in 20 mL of SG-Ura / Leu + raffinose liquid medium (2% galactose as the carbon source); (5) Adding substances: Weigh 97.09 mg of ferulic acid powder and dilute to 50 ml with 25% PGE3350. After dissolution, filter and sterilize. After the strain has grown for 10 h, add 200 uM ferulic acid to the culture medium. (6) Harvesting bacteria: After 14 h of growth, observe the color of the culture medium and collect the bacteria in 20 ml of the culture medium at 4000 rpm for 5 min for subsequent analysis.

[0040] Example 3 ESI-HPLC-MS / MS detection of fermentation products (1) Reagent configuration Sample extract: 95% ethanol: 1.5M HCl = 85:15 Standard curve solution configuration: Take 1 mg / mL of various types of curcumin as the mother solution and dilute them with methanol to prepare standard curve solutions with final concentrations of 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 100 ng / mL, 500 ng / mL, and 1000 ng / mL.

[0041] Mobile phase configuration: Organic phase: chromatographic grade acetonitrile.

[0042] Inorganic phase: Take 900 mL of ultrapure water and add it to a 1 L volumetric flask. Add 1 mL of formic acid and make up to 1 L with ultrapure water. Invert and mix.

[0043] (2) Liquid phase conditions Chromatographic column: WATERS ACQUITY UPLC HSS T3 1.8um 2.1x100mm; Column temperature: 35°C; Mobile phase: A: (water / 0.1% formic acid); B: acetonitrile Elution gradient: Table 1 Elution gradient conditions

[0044] Injection volume: 2 µl.

[0045] (3) Mass spectrometry parameters Ionization mode: ESI+ / ESI- Air curtain gas: 35Psi Spray voltage: 5000 v / -4500 v Atomizing gas pressure: 60 psi Auxiliary gas pressure: 60 psi Atomization temperature: 400℃ Table 2 Selected reaction monitoring conditions for protonation of curcumin ([M+H]+)

[0046] (4) Calculate the yield using the external standard method. Draw a standard curve with the peak area as the ordinate and the concentration as the abscissa, such as Figure 1-3 shown.

[0047] like Figure 4-6 As shown, the results show that: the target peak in the ESI-HPLC-MS / MS spectrum is compared with the reference mass spectrum data, and it is found that the chromatographic peak of BY4741 / pESC-LEU / pYES2-NTB strain fermentation broth at a retention time of 5.53min is curcumin. The chromatographic peak at a retention time of 5.27min is dihydrocurcumin. The chromatographic peak at a retention time of 4.88min is tetrahydrocurcumin.

[0048] Finally, it should be noted that: The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions described in the above embodiments may still be modified, or some or all of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A curcuminoid synthase CsPKS1, characterized in that: The amino acid sequence of the curcuminoid compound synthase CsPKS1 is shown in SEQ ID NO.

1.

2. The gene encoding the curcuminoid synthase CsPKS1 according to claim 1, characterized in that: The coding gene is denoted as CsPKS-1, and its nucleotide sequence is shown in SEQ ID NO.

2.

3. Application of a curcuminoid synthase CsPKS1 in the preparation of curcumin and its derivatives.

4. The use of the curcuminoid synthase CsPKS1 according to claim 3 in the preparation of curcumin and its derivatives, characterized in that: In the process of preparing curcumin and its derivatives, the following primer sequences were designed to amplify the target gene: At4CL CDS-F:TTAAGAGCTCAGATTCACAAACCGTT At4CL CDS-R:CGACGATAAGATGGCTCCACAAG ClDCS CDS-F:AAGACCTCGAGATGGAAGCCAAC ClDCS CDS-F: ACCAAGCTTTATCAGTTCAATCTACA pYES2-NTB-F:CAGCTGTAATACGACTCACTATAGG pYES2-NTB-R:AGGGTTAGGGATAGGCTTACCTTCG.

5. The use of the curcuminoid synthase CsPKS1 according to claim 3 in the preparation of curcumin and its derivatives, characterized in that: In the process of preparing curcumin and its derivatives, the recombinant plasmid pESC-LEU:At4CL-ClDCS and the recombinant plasmid pYES2-NTB: Cs PKS-1, the recombinant plasmid pESC-LEU:At4CL-ClDCS contains genes encoding Arabidopsis 4-coumaroyl CoA ligase and curcuminone-CoA synthetase, galactose-inducible PGal 1, 10, and leucine and uracil auxotrophic screening tags; the recombinant plasmid pYES2-NTB: Cs PKS-1 contains genes encoding curcuminoids, galactose-inducible PGal 1 and 10, and leucine and uracil nutritional deficiency screening tags.

Images