A proximity labeling enzyme and its application in in situ proximity labeling

By performing amino acid mutations at specific sites in the ProtA-Turbo enzyme, especially K71R, the labeling activity and stability of the enzyme were improved, solving the problem of labeling activity weakening over time in the existing technology and achieving a more efficient proximity labeling effect.

CN119955756BActive Publication Date: 2025-09-30UNIVERSITY OF HEALTH & REHABILITATION SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510126134.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-27
Publication Date
2025-09-30
Estimated Expiration
2045-01-27

AI Technical Summary

Technical Problem

The existing ProtA-Turbo enzyme loses its labeling activity gradually over time during the in situ proximity labeling process, and completely loses its activity after pre-biotinylation, resulting in a strong nonspecific signal and affecting the labeling effect.

Method used

A proximity labeling enzyme mutant, ProtA-Turbo-K71R, was designed to improve the labeling activity and stability of the enzyme by mutating the K71, K240, K335, K345 or K351 sites to non-polar hydrophobic amino acids, polar neutral amino acids, acidic amino acids or unnatural amino acids.

Benefits of technology

The mutant ProtA-Turbo-K71R maintained good labeling activity during the in vitro cell labeling process, significantly improved the sensitivity of the target protein's neighboring interacting proteins, and overcame the effect of the enzyme's own biotinylation on activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955756B_ABST
    Figure CN119955756B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of genetic engineering, and in particular to a proximity marker enzyme mutant and its application. The proximity marker enzyme mutant uses ProtA-Turbo as the starting sequence, and mutates one or more sites among K71, K240, K335, K345 and K351 to non-polar hydrophobic amino acids, polar neutral amino acids, acidic amino acids, basic amino acids or non-natural amino acids. The proximity marker enzyme mutant of the present invention overcomes the influence of self-biotinylation on its proximity marker activity, and can continuously and stably mark the proximity protein group of the target protein on the fixed cell, significantly improving the sensitivity of identifying the proximity interacting proteins of the target protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, in particular to a proximity labeling enzyme and application thereof in in situ proximity labeling. Background Art

[0002] Proteins functionally control cellular processes, and protein analysis is essential for accurately determining cellular states in disease. Proteins not only function on their own but also interact with other proteins or molecules that mediate signaling pathways and biological processes. Protein-protein interaction (PPI) networks provide a holistic concept for understanding a variety of biological processes. Dysfunction of protein-protein interactions is a major cause of many diseases, and understanding how proteins interact within cells is crucial for elucidating the mechanisms of disease. Therefore, the development of protein interaction research methods is gaining increasing attention.

[0003] Proximity labeling is a relatively novel method developed in recent years for studying protein interactions. This technique involves fusion proteins with a biotin ligase that exhibits promiscuous labeling activity and a target protein. These proteins are then biotinylated. Enrichment of the biotinylated proteins with streptavidin allows for the selective isolation and identification of the target protein's proteome. Currently, the main proximity labeling methods utilize biotinylated enzymes (BioID) or oxidoreductases (Apex). Fusion proteins with these enzyme probes indiscriminately biotinylate the proteome near the target protein. Combined with highly sensitive mass spectrometry, these enzymes provide direct proteome information and are used for characterizing protein complex configurations, analyzing organelle proteomes, and identifying protein interactomes. Recently, Alice Ting et al. systematically mutagenized BirA* to generate the TurboID enzyme, demonstrating enhanced labeling activity. TurboID has become a popular enzyme in the proximity labeling field.

[0004] Conventional proximity labeling methods typically require the fusion expression of a protein biotin ligase with the target gene. To modify this labeling approach, Santos-Barriopedro et al. fused the TurboID proximity biotinylation enzyme to protein A and expressed and purified the resulting ProtA-Turbo (protein A-TurboID) fusion protein in Escherichia coli. After target cells were fixed with paraformaldehyde and permeabilized, the ProtA-Turbo enzyme can be targeted to the target protein or a specific post-translational modification site using a specific antibody. Biotin is then added to trigger proximity labeling, biotinylating proteins adjacent to the target protein or specific post-translational modification site. The biotinylated proteins can then be enriched from the lysate and identified by mass spectrometry. The ProtA-Turbo enzyme is an in situ proximity labeling method, extending the labeling environment of proximity labeling beyond the cell environment. However, existing in situ proximity labeling methods based on the ProtA-Turbo enzyme generate strong nonspecific signals during labeling, and their labeling activity decreases significantly with prolonged labeling. These issues remain to be explored and addressed. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the object of the present invention is to provide a proximity labeling enzyme mutant and its application in in situ proximity labeling.

[0006] The first aspect of the present invention provides a proximity labeling enzyme mutant, which uses ProtA-Turbo as the starting sequence and has one or more of K71, K240, K335, K345, and K351 mutated to a non-polar hydrophobic amino acid, a polar neutral amino acid, an acidic amino acid, a basic amino acid, or an unnatural amino acid. Preferably, the mutated sites are K71, K240, K335, K345, or K351. More preferably, the mutations are K71R, K240R, K335R, K345R, or K351R.

[0007] In some embodiments of the present invention, the amino acid sequence of the starting sequence is shown as SEQ ID NO: 1.

[0008] In some embodiments of the present invention, the amino acid sequence of the proximity labeling enzyme mutant is shown in one of SEQ ID NOs: 2-6.

[0009] The second aspect of the present invention is to provide a polynucleotide comprising a polynucleotide encoding the proximity marker enzyme mutant according to the first aspect of the present invention.

[0010] The third aspect of the present invention is to provide a vector comprising the polynucleotide described in the second aspect of the present invention. The vector may be a viral vector or a non-viral vector.

[0011] The fourth aspect of the present invention is to provide a host cell comprising the vector according to the third aspect of the present invention.

[0012] The fifth aspect of the present invention is to provide the use of the proximity marker enzyme mutant described in the first aspect of the present invention, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the host cell described in the fourth aspect in detecting protein interactions.

[0013] The sixth aspect of the present invention is to provide the use of the proximity labeling enzyme mutant described in the first aspect of the present invention, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the host cell described in the fourth aspect in in situ proximity labeling.

[0014] Beneficial effects of the present invention:

[0015] In existing in situ proximity labeling techniques, the labeling activity of the proximity labeling enzyme ProtA-Turbo gradually decreases with the duration of in vitro cell labeling. Furthermore, if the ProtA-Turbo enzyme is pre-biotinylated, its labeling activity is completely lost.

[0016] The proximity labeling enzyme mutants constructed in the present invention, particularly the ProtA-Turbo-K71R mutant, not only possess enhanced labeling activity but also maintain this activity over time, even after complete pre-biotinylation. These proximity labeling enzyme mutants overcome the effects of biotinylation on their proximity labeling activity and are capable of consistently and stably labeling the proteome adjacent to the target protein on fixed cells, significantly improving the sensitivity of identifying the target protein's neighboring interacting proteins.

[0017] Sequence listing of the present invention:

[0018]

[0019] BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Coomassie blue staining of ProtA-Turbo protein after expression and purification.

[0021] Figure 2Biotin signal detection diagram after ProtA-Turbo protein self-biotinylation. The left image shows the result of streptavidin-HRP detection of biotin labeling, and the right image shows the result of Ponceau S detection of biotin labeling.

[0022] Figure 3 Schematic diagram of the ProtA-Turbo protein autobiotinylation sites identified by mass spectrometry. The sites marked with red K are the sites where the ProtA-Turbo protein can undergo autobiotinylation.

[0023] Figure 4 Results of detection of proximity labeling activity of ProtA-Turbo protein mutants.

[0024] Figure 5 Results of detection of proximity labeling activity of biotin-ProtA-Turbo protein mutant after self-biotinylation. DETAILED DESCRIPTION

[0025] Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiments are only used to illustrate the present invention and are not used in limiting the scope of the present invention.In addition, should be understood that after reading the content of the present invention being recorded, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the limited scope of the present invention equally.

[0026] Example 1 Expression and purification of ProtA-Turbo protein

[0027] 1. Protein Amplification and Induced Expression

[0028] The plasmid containing the nucleotide sequence encoding the ProtA-Turbo protein (amino acid sequence as shown in SEQ ID NO: 1) was transformed into BL21 cells for culture. A single clone was picked, amplified, and preserved in glycerol. A portion of the bacterial suspension was transferred to 1.5LLB medium (ampicillin resistance) and incubated at 37°C for about 4 hours. The OD was measured. 600 Induction can be performed when the OD value is between 0.8 and 1.0. Before induction, take 1 mL of bacterial solution as a control. Add IPTG for induction at a dilution of 1:1000 and shake overnight at 18°C ​​and 200 rpm. Before protein extraction, measure the OD value before and after induction. 600Use the OD value to adjust the bacterial suspension concentration to a similar value by adding PBS to ensure consistent loading. Prepare protein samples by adding 5× loading buffer and mixing thoroughly. Heat at 100°C for 10 minutes and run on a gel to verify successful protein expression. Transfer the bacterial suspension to a centrifuge tube and centrifuge at 8000 rpm for 10 minutes. Resuspend each suspension in 5 mL of PBS at 4°C, transfer to a centrifuge tube, and freeze at -80°C. Add IPTG to a final concentration of 100 μg / mL and shake overnight at 16°C at 180 rpm for 16 hours. Centrifuge at 10000 g for 1 minute to collect the bacterial suspension, discard the supernatant, and freeze.

[0029] 2. Protein Purification

[0030] Resuspend the cells in 20 mL of 10 mM imidazole, add 100 μM PMSF, 100 μM DNase, and 100 μM lysozyme to a final concentration of 100 μM, and incubate on ice for 30 minutes. Then sonicate for 10 minutes (10 seconds on, 10 seconds off). Centrifuge at 15,000 g for 10 minutes at 4°C. The expression product is in the supernatant, which is collected in a 50 mL centrifuge tube. Equilibrate the nickel column with 30-40 mL of 10 mM imidazole at a drip rate of 1 drop / s. Add the expression product supernatant to the nickel column and pass it through the column at a drip rate of 1 drop / s. Pass the sample at least twice. Wash away contaminants with 30-40 mL of 10 mM imidazole at a drip rate of 1 drop / s. Elute the sample twice with 6-8 mL of 250 mM imidazole. Desalt the eluted protein solution by dialysis or PD-10. Quantify protein concentration using the Bradford method. Add 0.1% sodium azide and 50% glycerol, divide into aliquots and store at -80°C.

[0031] 3. Coomassie Brilliant Blue Staining

[0032] Dissolve the protein in protein loading buffer, boil and denature it, then add it to the gel well for SDS-PAGE electrophoresis. Run the electrophoresis at 110V for 1 hour until the front end of the loading buffer approaches the edge of the SDS-PAGE gel. After the electrophoresis is completed, take the SDS-PAGE gel and put it into an appropriate amount of Coomassie Brilliant Blue staining solution until the staining solution covers the gel. Place it on a horizontal shaker at room temperature and shake it slowly for more than 1 hour to stain. After staining, add an appropriate amount of Coomassie Brilliant Blue staining destaining solution to ensure that the destaining solution can fully cover the gel. Place it on a horizontal shaker at room temperature for destaining for more than 24 hours. Replace the destaining solution every 8 hours until the gel is nearly transparent. After destaining is completed, take a picture of the gel for later use. The results are as follows: Figure 1 As shown, the final ProtA-Turbo protein obtained was 40 kDa in size.

[0033] Example 2 Mass spectrometry identification of ProtA-Turbo protein self-biotinylation sites

[0034] 1 μg of ProtA-Turbo protein was placed in reaction buffer (100 μM ATP, 10 mM biotin, 10 mM MgCl2, pH = 7.4) and reacted at 37°C for 0 h, 30 min, 1 h, 2 h, 4 h, and 16 h. After the reaction, one-fifth of the volume of SDS denaturation buffer was added and the mixture was boiled at 100°C for 5 min. After cooling, the biotin labeling effect was detected using WB and streptavidin-HRP. The results of successful labeling are as follows: Figure 2 As shown, ProtA-Turbo protein has a significant biotin signal.

[0035] Then perform in-gel enzymatic digestion and mass spectrometry sample preparation. First, place the gel after SDS-PAGE electrophoresis in a glass dish, cut out the band, then cut the gel band into small pieces and rinse twice with distilled water. Add an appropriate amount of decolorizing solution, place in a 37°C constant temperature incubator, and decolorize until colorless or very light. Aspirate the decolorizing solution, add an appropriate amount of acetonitrile to rinse, aspirate the acetonitrile, add acetonitrile again, place for 10 minutes, aspirate the acetonitrile, and use a vacuum centrifugal concentrator to dehydrate the gel block to dry. Acetonitrile can remove the water inside the gel particles and dry the gel particles. Add 25mM dithiothreitol solution to the dried gel block, place at 55°C, and incubate for 45 minutes. Dithiothreitol opens the disulfide bonds, allowing trypsin to fully hydrolyze. After this step is completed, the next step of iodoacetamide operation must be carried out immediately, otherwise disulfide bonds may form again. Add an appropriate amount of acetonitrile to rinse, then absorb dryness, add acetonitrile again, and incubate for 10 minutes. Absorb the acetonitrile and use a vacuum centrifugal concentrator to dehydrate the gel. Add an appropriate amount of 55mM iodoacetamide solution and react in the dark for 30 minutes. Rinse with acetonitrile, then soak in acetonitrile for 10 minutes, and use a vacuum centrifugal concentrator to dehydrate the gel. Add an appropriate amount of trypsin to cover the gel, invert in a 37℃ incubator, and incubate for 12-16 hours. Terminate the enzymatic hydrolysis reaction with 1μL of 10% trifluoroacetic acid solution, centrifuge at low speed to separate the gel and solution, aspirate the solution, and collect it in a new centrifuge tube. Add an appropriate amount of extraction solution (50% acetonitrile, 0.1% formic acid) to the gel, incubate at 37℃ for 30 minutes, and combine the supernatant with the previous supernatant. Repeat the extraction step twice. The supernatant was concentrated in a vacuum centrifugal concentrator and then reconstituted with 20 μL of 0.1% formic acid solution. After oscillation and centrifugation, repeat twice. The peptide solution was added to the mass spectrometry loading bottle and stored at 4°C for mass spectrometry analysis. Figure 3 As shown in the figure, a total of 12 lysine sites (marked with red K) were identified in the ProtA-Turbo protein, namely: K6, K9, K37, K52, K56, K71, K107, K236, K240, K335, K345 and K351. These sites are the sites where the ProtA-Turbo protein can undergo self-biotinylation.

[0036] Example 3: Point mutation of ProtA-Turbo self-biotinylation site

[0037] Design a pair of forward and reverse primers, each 30-40 bp in length. Center the mutated base and add 12-20 bp of sequence on either side. If the flanking primers are too short, the mutation experiment may fail. Primers should contain at least 11-12 base pairs to bind to the template. After primer synthesis, perform a standard PCR amplification reaction. After completion, mix the two reactions and add an appropriate amount of a high-fidelity polymerase (such as Q5). Continue the reaction using the above protocol for 16 cycles. Digest the resulting PCR product with 1 μL of DpnI and 4 μL of 10×NEB cutsmart buffer (DpnI only digests methylated DNA). Incubate at 37°C for 1 hour (or 2-3 hours to ensure cleanliness). Run 5 μL of the aliquot on a gel to detect bands. Transform the remaining aliquot into bacteria and plate. After 12 hours, select 3-5 clones for sequencing. After obtaining the correct mutant sequence, the plasmid was expressed, purified and the in situ labeling activity was identified according to the above steps.

[0038] Primer sequence list:

[0039] Primer name Sequence composition K71R-f GCGGAGGTGGCTCTGTCGACCGCGACAATACTGTGCCTCTGAA K71R-r TTCAGAGGCACAGTATTGTCGCGGTCGACAGAGCCACCTCCGC K240R-f GAGCAGACAAGGTGCGAGTCCGCTGGCCCAATGACCTGTATCT K240R-r AGATACAGGTCATTGGGCCAGCGGACTCGCACCTTGTCTGCTC K335R-f CATATCTGCCACGGTGGGAGCGCCTGGATAACTTCATCAATAG K335R-r CTATTGATGAAGTTATCCAGGCGCTCCCACCGTGGCAGATATG K345R-f ACTTCATCAATAGACCCGTGCGCCTGATCATTGGGGACAAAGA K345R-r TCTTTGTCCCCAAATGATCAGGCGCACGGGTCTATTGATGAAGT K351R-f TGAAGCTGATCATTGGGGACCGCGAGATTTTCGGGATTAGCCG K351R-r CGGCTAATCCCGAAAATCTCGCGGTCCCCCAATGATCAGCTTCA

[0040] For in situ labeling activity assay, cells were cultured in 60 mm culture dishes. When the cell density exceeded 80%, the cells were removed and placed on ice. Washed three times with 2 mL of 4°C pre-chilled PBS. The PBS was aspirated, and the cells were fixed with 4% PFA for 15 minutes, followed by two washes with PBS. The cells were treated with 0.3% Triton X-100 for 10 minutes, followed by two washes with PBS. Blocked with 3% BSA (containing 0.3% Triton X-100 in PBS) for 30 minutes. Antibody dilution was prepared in blocking buffer, with 1 μg of antibody added per well, and incubated at room temperature for 1 hour. Washed twice with PBS. 1 μg of ProtA-Turbo protein mutant (protein / antibody molar ratio ≈ 1:1) was added to each well, incubated at room temperature for 1 hour, and washed twice with PBS. Biotin buffer (5 μM biotin, 5 mM MgCl2, 1 mM ATP, adjusted to pH 7.5 with 1 M NaOH) was added, and the cells were incubated at 37°C for 30 minutes. Washed twice with TBST. The cells were harvested, RIPA lysis buffer was added, and the cells were harvested and incubated overnight at 4°C. Add SDS to a final concentration of 1% and boil at 99°C for 1 hour until the precipitate is completely dissolved. Quantify protein concentration using BCA and adjust to a consistent level. Denature equal amounts of total protein in each sample by adding 5× loading buffer and boiling at 99°C for 5 minutes. Proximity labeling was assessed using Western blotting and HRP-streptavidin.

[0041] We selected 5 sites from the 10 biotinylated lysines on ProtA-Turbo that are most likely to affect its structure or protein activity, and mutated the sites to study whether the biotinylation of these lysine sites affected the labeling activity of ProtA-Turbo. We mutated K71, K240, K335, K345 and K351 to R, respectively, and constructed and expressed the K71R, K240R, K335R, K345R and K351R mutant proteins of ProtA-Turbo. We used anti-TUBB to verify the in vitro in situ proximity labeling activity of the K71R, K240R, K335R, K345R and K351R mutant proteins of ProtA-Turbo on H1975 cells. The results are shown in Figure 2. Figure 4 As shown, the five mutants all had good proximity labeling activity on H1975 cells, just like wild-type ProtA-Turbo. The proximity labeling abilities of the three mutants, K71R, K335R, and K345R, were significantly improved compared to wild-type ProtA-Turbo.

[0042] Next, we tested whether K71R, K240R, K335R, K345R, and K351R could affect the sustained labeling ability of ProtA-Turbo after self-biotinylation. We also performed in vitro proximity labeling experiments on H1975 cells using anti-TUBB. The results are shown in Figure 2. Figure 5 As shown, after self-biotinylation, the K71R mutant showed significantly improved processive proximity labeling compared to wild-type ProtA-Turbo. This indicates that biotinylation at the K71 site is crucial for the activity of ProtA-Turbo, and mutating it significantly enhances the processive biotinylation activity of ProtA-Turbo after self-biotinylation.

[0043] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A proximity marker enzyme mutant, characterized in that The proximity labeling enzyme mutant uses ProtA-Turbo as the starting sequence, the mutation is K71R, K335R or K345R mutation, and the amino acid sequence of the starting sequence is shown in SEQ ID NO:

1.

2. The proximity marker enzyme mutant according to claim 1, characterized in that: The amino acid sequence of the proximity labeling enzyme mutant is shown in one of SEQ ID NOs: 2, 4, and 5.

3. A polynucleotide, characterized in that The polynucleotide comprises a polynucleotide encoding the proximity marker enzyme mutant according to claim 1 or 2.

4. A carrier, characterized in that The vector comprises the polynucleotide according to claim 3.

5. A host cell, characterized in that The host cell comprises the vector according to claim 4.

6. Use of the mutant according to claim 1 or 2, or the polynucleotide according to claim 3, or the vector according to claim 4, or the host cell according to claim 5 in detecting protein interactions.

7. Use of the mutant according to claim 1 or 2, or the polynucleotide according to claim 3, or the vector according to claim 4, or the host cell according to claim 5 in in situ proximity labeling.

Citation Information

Patent Citations

  • Nanometer antibody-proximity marker enzyme fusion protein and application thereof

    CN119998331A