CircASCC3 inhibitor and application thereof

Abstract

The invention discloses a circASCC3 inhibitor and an application of the circASCC3 inhibitor. Specifically, the siRNA disclosed by the invention can be used for effectively knocking out circASCC3 and increasing the sensitivity of tumors to genotoxic stress. The combination of the circASCC3-targeting siRNA and chemotherapeutic drugs can effectively improve the killing effect of the chemotherapeutic drugs on tumor cells, especially on chemotherapeutic drug-resistant tumors.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and biomedicine. Specifically, the present invention relates to a circASCC3 inhibitor and a use thereof. Background Art

[0002] Genomic instability is responsible for malignant transformation and cancer progression. Defects in the DNA damage repair system lead to chromosomal alterations and gene mutations. Amplification of oncogenes such as c-MYC leads to uncontrolled DNA replication and cell proliferation, which in turn may exacerbate genomic instability. In addition, depletion or mutation of DNA repair genes can further disrupt genome integrity to promote tumorigenesis. However, defects in DNA repair genes can drive apoptosis in chemotherapy-exposed cancer cells because the impaired repair system is unable to detect or resolve damaged DNA. For example, while BRCA1 / 2 mutations or homologous recombination deficiency (HRD) increase cancer susceptibility, these defects can enhance the sensitivity of tumors to genotoxic therapeutics such as chemotherapeutics and PARP inhibitors. Therefore, a strong DNA repair system can prevent the initiation of cancer while also protecting cancer cells from genotoxic insults and subsequent apoptosis.

[0003] Therefore, those skilled in the art are committed to finding drugs and methods that can reduce the resistance of cancer cells to genotoxic insults and improve the anti-tumor effect of chemotherapy. Summary of the invention

[0004] The purpose of the present invention is to provide a circASCC3 inhibitor and its use in anti-tumor.

[0005] In a first aspect of the present invention, a siRNA targeting circASCC3 is provided, wherein the siRNA is selected from the following group:

[0006] siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and

[0007] siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

[0008] In another preferred embodiment, the circASCC3 is derived from mammals (including humans).

[0009] In a second aspect of the present invention, a siRNA precursor (shRNA) is provided, wherein the siRNA precursor is the siRNA precursor according to claim 1; preferably, the 5' to 3' ends of the siRNA precursor sequentially include: a first sequence unit, a stem-loop sequence unit and a second sequence unit, wherein the first sequence unit and the second sequence unit are complementary so that the siRNA precursor forms a hairpin structure, and the first sequence unit is selected from the following group:

[0010] siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and

[0011] siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

[0012] The third aspect of the present invention provides an exosome, wherein the exosome is loaded with the siRNA or a precursor thereof according to claim 1.

[0013] The fourth aspect of the present invention provides the use of the siRNA according to the first aspect of the present invention, or the siRNA precursor according to the second aspect of the present invention, or the exosome according to the third aspect of the present invention, for:

[0014] (1) Preparation of drugs for preventing or treating tumors;

[0015] (2) preparing agents that enhance tumor sensitivity to chemotherapy or reduce tumor resistance to chemotherapy;

[0016] (3) preparing drugs that inhibit tumors through p53-dependent mechanisms; or

[0017] (4) Prepare drugs that inhibit tumors through p53-independent mechanisms.

[0018] In another preferred embodiment, the tumor is a p53 wild-type tumor, or the tumor is a p53 mutant tumor.

[0019] In another preferred embodiment, the tumor is a chemotherapy-resistant tumor.

[0020] In another preferred embodiment, the tumor is selected from: lung cancer, gastric cancer, liver cancer, kidney tumor, small intestine cancer, bone cancer, prostate cancer, colorectal cancer, breast cancer, colon cancer, cervical cancer, ovarian cancer, lymphoma, nasopharyngeal cancer, adrenal tumor, bladder tumor, brain cancer, endometrial cancer, testicular cancer, thyroid cancer, or a combination thereof.

[0021] In a fifth aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the siRNA described in the first aspect of the present invention, or the siRNA precursor described in the second aspect of the present invention, or the exosomes described in the third aspect of the present invention.

[0022] In another preferred embodiment, the pharmaceutical composition further comprises an effective amount of chemotherapeutic drugs.

[0023] In another preferred embodiment, the pharmaceutical composition is used to prevent or treat tumors.

[0024] In a sixth aspect of the present invention, a method for knocking down the expression level of circASCC3 in cells is provided, comprising the steps of: culturing cells in the presence of the siRNA described in the first aspect of the present invention, the siRNA precursor described in the second aspect of the present invention, or the exosomes described in the third aspect of the present invention, thereby achieving the knockdown of the expression level of circASCC3 in the cells.

[0025] In a seventh aspect, the present invention provides a method for non-therapeutic inhibition of tumor cells in vitro, comprising the steps of: culturing tumor cells in the presence of a circASCC3 inhibitor, thereby inhibiting the tumor cells.

[0026] In another preferred embodiment, the inhibition of tumor cells is the inhibition of tumor cell growth or the inhibition of tumor cell tumorigenesis.

[0027] In another preferred example, compared with the control tumor cells, the expression of circASCC3 in the tumor cells is reduced by more than 10%, preferably by more than 20%, more preferably by more than 30%, more preferably by more than 40%, more preferably by more than 50%, more preferably by more than 60%, more preferably by more than 70%, more preferably by more than 80%, more preferably by more than 90%, and most preferably, there is no expression of circASCC3 at all.

[0028] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0030] Figure 1CircASCC3 is a circular RNA that responds to DNA damage. (A) Heat map of differentially expressed circRNAs in cancer cells treated with DMSO, Nutlin-3 (10 μM), cisplatin (10 μM), or 5-FU (20 μM). (B) Volcano plot of differentially expressed circRNAs after treatment with all three drugs (Nutlin-3, cisplatin, and 5-FU). (C) Venn diagram based on circRNAs according to the indicated criteria. (D) Genomic loci of circASCC3 and sequencing analysis of the head-to-tail splice junction of circASCC3. Blue arrows represent convergent primers, and yellow arrows represent divergent primers. (E) Amplification of circASCC3 from cDNA of CAL51, MCF7, and RKO cells using divergent primers compared with gDNA. circNSUN2 was used as a positive control, and ACTB was used as a negative control. (F) CircASCC3 is more stable compared with ASCC3 and p21 mRNA. Cells were treated with actinomycin D for the indicated time, and then subjected to RT-qPCR analysis. (G) CircASCC3 is resistant to RNase R digestion compared to ASCC3 and p21 mRNA. Cells were treated with RNase R and then analyzed by RT-qPCR. (H) CircASCC3 is mainly localized in the cytoplasm. Cell lysates were subjected to RT-qPCR analysis after cytoplasmic and nuclear RNA separation. ACTB, U1, and circNSUN2 were used as references for comparison. **p<0.01, ***p<0.001.

[0031] Figure 2p53 transcriptionally induces circASCC3 expression. (AD) Expression of circASCC3 and ASCC3 mRNA increased after treatment with Nutlin-3 or DNA damage inducers. RT-qPCR analysis was performed after CAL51 (A), MCF7 (B), HCT116 (C), and A549 (D) cells were treated with Nutlin-3 (10 μM), cisplatin (10 μM), or 5-FU (20 μM) for 48 h. The right panel indicates the relative abundance of circASCC3 by normalization to ASCC3 mRNA. (EG) Knockdown of p53 abolished the elevated levels of circASCC3 and ASCC3 mRNA. RT-qPCR analysis was performed after CAL51 (E), MCF7 (F), and HCT116 (G) cells were treated with the indicated drugs for 48 h and siRNAs for 60 h. (HK) circASCC3 and ASCC3 mRNA levels were not affected by Nutlin-3 (10 μM) or cisplatin (10 μM) treatment in p53-negative or mutant cancer cells, including HCT116 p53- / - (H), H1299 (I), TOV112D (J), and OVCA420 (K) cells. (L,M) Knockdown of p53 had no effect on circASCC3 expression in TOV112D (L) and ES-2 (M) cells. (N) Overexpression of wild-type p53, but not some p53 mutants, significantly induced circASCC3 expression. (O) Schematic representation of potential p53 response elements (p53-REs) within the ASCC3 promoter and first intron. (P) p53 binding to p53-RE-1 and -2 determined by ChIP analysis. (Q) Overexpression of p53 triggered luciferase activity driven by the ASCC3 promoter as analyzed by luciferase reporter gene. *p<0.05, **p<0.01, ***p<0.001.

[0032] Figure 3SFPQ is involved in p53-mediated upregulation of circASCC3. (A,B) Levels of circASCC3 after knockdown of a series of RNA-binding proteins in CAL51 (A) and HCT116 (B) cells. RT-qPCR analysis was performed 48 h after cells were transfected with the indicated siRNAs. (C,D) Knockdown of SFPQ increased the levels of circASCC3 but reduced the expression of ASCC3 mRNA. RT-qPCR analysis was performed 48 h after CAL51 (C) and HCT116 (D) cells were transfected with the indicated siRNAs. The right panel indicates the relative abundance of circASCC3 by normalization to ASCC3 mRNA. (E) Schematic diagram of potential SFPQ binding sites within repetitive elements near repetitive elements and circASCC3 flanking regions. (F) RIP analysis determined the binding of SFPQ to repetitive elements. (G,H) SFPQ mRNA levels were reduced after Nutlin-3 (10 μM) or cisplatin (10 μM) treatment. CAL51 (G) and HCT116 (H) cells were treated with the indicated drugs for 48 hours, and then analyzed by RT-qPCR. (I) Knockdown of p53 increased the level of SFPQ mRNA. RT-qPCR analysis was performed after cells were treated with the indicated drugs for 48 hours and siRNAs for 60 hours. *p<0.05, **p<0.01, ***p<0.001.

[0033] Figure 4Ectopic circASCC3 promotes tumor resistance to genotoxic stress. (AD) Overexpression of circASCC3 increases the growth of cancer cells exposed to pulse treatment with DNA damage inducers. CAL51 (A), MCF7 (B), HCT116 (C), and RKO (D) cells were treated with MMS (1 mM), cisplatin (100 μM), or etoposide (80 μM) for 0.5-2 h and transfected with the indicated plasmids before cell viability assay. (EH) Overexpression of circASCC3 reduces apoptosis in cancer cells exposed to pulse treatment with DNA damage inducers. Flow cytometric analysis of CAL51 (E), MCF7 (F), HCT116 (G), and RKO (H) cells exposed to pulse treatment and transfected with the indicated plasmids. (I,J) Overexpression of circASCC3 reduces cleaved PARP levels in cancer cells exposed to pulse MMS. IB analysis was performed after CAL51 (I) and HCT116 (J) cells were treated with MMS and the indicated plasmids. (K, L) Overexpression of circASCC3 increased the resistance of cancer cells to DNA damage-inducing agents. Cell viability assays were performed after CAL51 (K) and HCT116 (L) were treated with different doses of the indicated drugs. (MP) Stable overexpression of circASCC3 increased the growth rate (M), weight (N), and size (O) of HCT116-derived xenograft tumors. The body weight of mice was not affected (P). Cisplatin was administered as indicated. Data are expressed as mean ± SD, n = 7. p values ​​were determined by two-tailed unpaired t-test. **p < 0.01, ***p < 0.001.

[0034] Figure 5 Knockdown of circASCC3 increases tumor sensitivity to genotoxic stress. (AC) Knockdown of circASCC3 inhibits the growth of cancer cells exposed to pulses of DNA damage inducers. CAL51 (A), MCF7 (B), and RKO (C) cells were treated with MMS (1 mM) or etoposide (80 μM) for 0.5-2 h and transfected with the indicated siRNAs before cell viability assays. (DG) Knockdown of circASCC3 increases apoptosis in cancer cells exposed to pulses of DNA damage inducers. CAL51 (D, E) and MCF7 (F, G) cells were exposed to pulses and transfected with the indicated plasmids before flow cytometric analysis. (HK) Stable knockdown of circASCC3 reduces the growth rate (H), weight (I), and size (J) of HCT116-derived xenograft tumors. Mouse body weight was unaffected (K). Cisplatin was administered as indicated. Data are presented as mean ± SD, n = 7. p values ​​were determined by two-tailed unpaired t-test. *1p<0.05, **p<0.01, ***p<0.001.

[0035] Figure 6 CircASCC3 interacts with and stabilizes DDX5. (A) circASCC3-interacting proteins were identified using a biotinylated RNA probe complementary to the endogenous circASCC3 backsplicing junction. (B) circASCC3-interacting proteins were identified using a biotinylated linear circASCC3 transcript as bait. (C,D) CircASCC3 binds to DDX5 but not to NONO, RUVBL1, or EIF4A3. Cells were transfected with the indicated plasmids encoding circASCC3 or RNA-binding proteins and subjected to RIP assays. (EH) Knockdown of circASCC3 reduced the protein level of DDX5 without affecting the expression of DDX5 mRNA. MCF7 (E,G) and HCT116 (F,H) cells were transfected with the indicated siRNAs and subjected to IB and RT-qPCR analysis. (I,J) The proteasome inhibitor MG132 restored the protein level of DDX5 in circASCC3-depleted cells. IB analysis was performed after CAL51 (I) and HCT116 (J) cells transfected with the indicated plasmids were treated with DMSO or MG132 (20 μM) for 8 h. (K, L) Overexpression of circASCC3 prolonged the half-life of DDX5 protein. IB analysis was performed after MCF7 (K) and HCT116 (L) cells transfected with the indicated plasmids were treated with CHX for different time points. (M, N) Knockdown of DDX5 restored circASCC3-mediated cell growth and apoptosis. Cells were transfected with the indicated plasmids or siRNAs and subjected to cell viability assay (M) or flow cytometry analysis (N). **p<0.01, ***p<0.001.

[0036] Figure 7p53-circASCC3 axis inhibits R-loop accumulation via DDX5. (A) Overexpression of circASCC3 reduces the level of R-loops formed at ACTB and RPS23 sites. Cells were treated with cisplatin and transfected with the indicated plasmids, and then subjected to DRIP analysis using the S9.6 antibody. (B) Knockdown of circASCC3 increases the level of R-loops formed at ACTB and RPS23 sites. Cells were treated with cisplatin and transfected with the indicated siRNAs, and then subjected to DRIP analysis using the S9.6 antibody. RNase H, which catalyzes RNA cleavage in RNA / DNA hybrids, served as a negative control. (C) Overexpression of circASCC3 reduces the level of R-loops formed at JUN and NEAT1 sites. Cells were treated with cisplatin and transfected with the indicated plasmids, and then subjected to R-ChIP analysis using the anti-V5 antibody. TSS, transcription start site. (D) Knockdown of circASCC3 increases the level of R-loops, while overexpression of DDX5 reverses this effect. Cells were treated with or without cisplatin and transfected with the indicated siRNAs or plasmids, and then IF stained with S9.6 antibody. (E) The expression level of circASCC3 was lower in 15 colorectal cancer samples compared with 15 matched adjacent normal tissues. (F,G) In 80 colorectal cancer patients, higher levels of circASCC3 were associated with worse prognosis. *p<0.05, **p<0.01, ***p<0.001.

[0037] Figure 8 .Schematic diagram of the role of the p53-circASCC3 axis in cancer. DETAILED DESCRIPTION

[0038] After extensive and in-depth research, the inventors unexpectedly found that ectopic circASCC3 promoted cancer cell survival under genotoxic stress in vitro and in vivo, and the siRNA of the present invention can effectively knock out circASCC3 and increase the sensitivity of tumors to genotoxic stress. Specifically, circASCC3 triggers chemotherapy resistance by stabilizing DDX5, thereby eliminating the R loop, and knocking down circASCC3, such as the siRNA targeting circASCC3 of the present invention (SEQ ID NO.2 and SEQ ID NO.3), can reduce the chemotherapy resistance of tumors, thereby improving the anti-tumor effect of chemotherapy drugs. The siRNA targeting circASCC3 of the present invention combined with chemotherapy drugs can effectively improve the killing effect of chemotherapy drugs on tumor cells, especially on chemotherapy-resistant tumors.

[0039] The tumor suppressor p53 prevents tumorigenesis by maintaining genome integrity and is therefore regarded as the "guardian of the genome." Under moderate genotoxic stress, p53 transcriptionally activates the expression of genes such as p21 and GADD45A to induce cell cycle arrest. At the same time, it also promotes the repair of damaged DNA by activating numerous repair-related genes. In this way, p53 maintains genome stability and prevents cell malignant transformation. In contrast, germline mutations in the TP53 gene lead to increased genome instability and a familial cancer susceptibility disease called Li-Fraumeni syndrome. However, recent evidence has revealed that p53 can also confer drug resistance in cancer by promoting DNA repair through various mechanisms. For example, p53 induces the transcription of nucleotide excision repair (NER) genes XPC and DDB2 to promote melanoma resistance to chemotherapeutic drugs. Another p53 target gene, MGMT, encodes O-6-methylguanine-DNA methyltransferase, which promotes the repair of DNA alkylation damage, leading to tumor resistance to alkylating agents. In addition, p53 can prevent abnormal chromosomal changes by activating a long noncoding RNA (lncRNA) GUARDIN. p53 promotes resistance to genotoxic stress, especially when it is not fully activated. It has been reported that RMRP limits the full activation of p53, which may lead to cell cycle arrest and DNA damage repair, which ultimately triggers tumor resistance to PARP inhibitors.

[0040] R-loops are RNA / DNA hybrid structures formed during transcription when an RNA strand invades double-stranded DNA. Accumulation of R-loops due to DNA damage, oncogenic activation, or dysfunction of the R-loop removal machinery leads to transcription-replication conflicts, replication stress, and impaired double-strand break repair. Recently, p53 has been reported to prevent R-loop-associated genomic instability by limiting aberrant satellite transcription. Furthermore, elevated levels of R-loops due to inactivation of p53 by the E6 viral oncoprotein were found to be essential for HPV replication and pathogenesis. These studies suggest that p53 plays a critical but understudied role in regulating unplanned R-loop formation.

[0041] In the present invention, p53-induced circular RNA circASCC3 was identified to increase cancer cell survival and growth under DNA damage stress. circASCC3 interacts with DEAD-box RNA helicase DDX5, leading to R-loop resolution. The present invention reveals the important role of circASCC3 in p53-mediated R-loop resolution and genome stability.

[0042] circASCC3 and its inhibitors

[0043] The sequence of circASCC3 in the present invention is as follows:

[0044] CTATTTGAACTGCTGGGACCTGAAGGACTTGAACTTATTGAGAAACT

[0045] CCTCCAGAACAATTACATTGTGGATAGATTTCTTAATTCTTCAAATG

[0046] ATCATAGGTTTCAGGCTCTTCAAGACAATTGTAAAAAAATTTTAGGAGAA

[0047] AATGCTAAACCCAATTATGGTTGTCAAGTCACTATTCAGTCTGAACAA

[0048] AAAGCAGTTAAATGAAACAATATCGACGTGAAGAAAAAAAGAATTGCCAGA

[0049] CGAGAAAAAAGGCTGGAGAAGATTTAGAAGTTTCAGAAGGACTTATGT

[0050] GCTTTGATCCTAAGGAATTGCGGATACAAAGGAACAGGCACTTCTGAAT

[0051] GCTAGAAGTGTTCCAATTCTGAGCAGGCAGAGAGATGCAGACGTTGAAA

[0052] AAATACATTATCCCCATGTGTATGATTCCCAGGCTGAAGCCATGAAAAACA

[0053] TCAGCATTTATTGCTGGTGCAAAGATGATTTTGCCAGAAGGAATCCAAAG

[0054] AGAGAATAACAAGCTTTATGAAGAAGTAAGGATTCCCTACAGCGAACCA

[0055] ATGCCACTCAGCTTTGAGGAAAAGCCAGTTTATATCCAAGACTTAGATGA

[0056] G(SEQ ID NO.1)

[0057] As used herein, the term "circASCC3 inhibitor" refers to a substance that inhibits circASCC3 replication or transcription, or a substance that reduces the level of circASCC3. The inhibitor of circASCC3 includes (but is not limited to): siRNA, microRNA, compound, or a combination thereof. The inhibitor of circASCC3 gene is preferably siRNA or microRNA.

[0058] As used herein, the term "RNAi" (RNA interference) refers to a highly conserved phenomenon in evolution that is induced by double-stranded RNA (dsRNA) and efficiently and specifically degrades RNA with complementary paired sequences. Since RNAi technology can specifically shut down the expression of specific genes, it has been widely used in the fields of exploring gene functions and gene therapy for infectious diseases and tumors.

[0059] In a preferred embodiment of the present invention, the present invention provides a siRNA sequence of circASCC3. As used herein, the term "siRNA" (Small interfering RNA, siRNA) refers to a small RNA molecule (about 21-25 nucleotides), which can be processed by Dicer (an enzyme in the RNase III family that is specific for double-stranded RNA) from its precursor (such as dsRNA, shRNA, etc.), or can be synthesized by chemical methods or produced by other protein processing. siRNA is a major member of siRISC, which stimulates the rapid cleavage and degradation of target RNAs with complementary sequences, resulting in the silencing of target genes, and thus becomes a key functional molecule in RNAi.

[0060] In a preferred embodiment of the present invention, the present invention provides a siRNA precursor having the siRNA sequence of the present invention. As used herein, the term "siRNA precursor" refers to an RNA molecule that can be processed in mammalian cells to produce siRNA, specifically, it is selectively processed by Dicer or other similar proteins to produce mature siRNA, thereby implementing RNAi.

[0061] In a preferred embodiment of the present invention, the present invention provides a nucleic acid construct. As used herein, the term "construct" is a nucleic acid construct comprising the siRNA precursor of the present invention.

[0062] In a preferred embodiment of the present invention, the present invention provides an expression cassette. As used herein, the term "expression cassette" refers to an expression cassette comprising a coding sequence of the siRNA precursor of the present invention and a promoter and a termination signal operably connected to the coding sequence, and the expression cassette produces the siRNA precursor of the present invention after transcription.

[0063] One way to produce "small interfering RNA" (siRNA) in vivo is to clone the siRNA sequence into a plasmid vector as part of a "short hairpin". When delivered into an animal, the hairpin sequence is expressed to form a "double-stranded RNA" (shRNA) with a top loop structure, which is recognized and processed by the Dicer protein in the cell to produce a functional siRNA.

[0064] As used herein, the term "shRNA" is a special shRNA constructed with the precursor of human miR-26b as the backbone. The shRNA comprises, from the 5' end to the 3' end, the following in order: (a) a 5' end flanking sequence region; (b) a 5' end paired siRNA region; (c) a top loop region; (d) a 3' end paired siRNA region, and the 5' end paired siRNA region and the 3' end paired siRNA region form a double-stranded region; (e) a 3' end flanking sequence region; the shRNA produces siRNA, and the nucleotide sequence of the siRNA corresponds to the 3' end paired siRNA region or the 5' end paired siRNA region.

[0065] In a broad sense, shRNA is the abbreviation of short hairpin RNA, i.e., "short hairpin RNA". shRNA consists of two short reverse complementary sequences separated by a top loop sequence in the middle, forming a hairpin structure. The transcription is usually controlled by the endogenous RNA polymerase III promoter of the cell, and 5-6 Ts are connected to the end of the shRNA sequence as the transcription terminator of RNA polymerase III. shRNA can also be transcribed by the promoter of other RNA polymerases.

[0066] In a preferred embodiment of the present invention, the siRNA targeting the circASCC3 gene is selected from the following group:

[0067] siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and

[0068] siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

[0069] Chemotherapy drugs

[0070] Chemotherapy drugs are a type of drug used to treat tumors. Chemotherapy drugs can kill tumor cells. These drugs can act on different stages of tumor cell growth and reproduction, inhibiting or killing tumor cells. Chemotherapy drug treatment is currently one of the main means of treating tumors.

[0071] In a preferred embodiment of the present invention, the chemotherapeutic drug is a DNA damage inducer, such as Nutlin-3, 5-fluorouracil (5-FU) or cisplatin.

[0072] Pharmaceutical composition

[0073] The term "pharmaceutical composition" refers to a mixture containing a therapeutically effective amount of one or more of the compounds and their pharmaceutically acceptable tautomers, solvates, hydrates or salts, and other pharmaceutically acceptable carriers. The purpose of preparing the compounds into a pharmaceutical composition is to more conveniently administer them to the subject.

[0074] According to one aspect of the present invention, the present invention provides a pharmaceutical composition, comprising a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the siRNA of the present invention or a precursor thereof, or exosomes loaded with the siRNA of the present invention or a precursor thereof.

[0075] According to certain embodiments of the present invention, the pharmaceutical composition comprises a first component and a second component, wherein the first component is the siRNA of the present invention or its precursor, or exosomes loaded with the siRNA of the present invention or its precursor, and the second component is a chemotherapeutic drug.

[0076] According to some embodiments of the present invention, the molar concentration ratio of the first component to the second component is about 1:5000-100:1, for example, 1:4000-10:1, 1:3000-10:1, 1:2000-10:1, 1:1000-10:1, 1:1000-10:1, 1:100-10:1, 1:10-10:1.

[0077] According to some embodiments of the present invention, the pharmaceutical composition is used to treat cancer.

[0078] According to some embodiments of the present invention, the cancer includes prostate cancer, colorectal cancer, lung cancer and breast cancer.

[0079] According to some embodiments of the present invention, the total content of the first component and the second component accounts for 1-100% of the pharmaceutical composition, for example, 1-99.5%, 1-99%, 1-90%, 1-80%, 1-70%, 1-60%, 1-50%, 1-40%, 1-30%, 1-20%, 1-10%, 10-100%, 10-99.5%, 10-99%, 10-90%, 10~80%、10~70%、10~60%、10~50%、10~40%、10~30%、10~20%、20~100%、20~99.5%、20~99%、20~90%、20~80%、20~70%、20~60%、20~50%、20~40%、20~30%、30~100%、30~99.5%、30~99%、 30-90%, 30-80%, 30-70%, 30-60%, 30-50%, 30-40%, 40-100%, 40-99.5%, 40-99%, 40-90%, 40-80%, 40-70%, 40-60%, 40-50%, 50-100%, 50-99.5%, 50-99%, 50-90%, 50-80%, 50-70%, 50-60%, 60-100%, 60-99.5%, 60-99%, 60-90%, 60-80%, 60-70%, 70-100%, 70-99.5%, 70-99%, 70-90%, 70-80%, 80-100%, 80-99.5%, 80-99%, 80-90%, 90-100%, 90-99.5%, or 90-99%.

[0080] According to certain embodiments of the present application, the total content of the first component and the second component accounts for about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, %, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%.

[0081] Drug synergy: When two or more drugs are used together, if their directions of action are consistent, the effect of mutual enhancement is called synergy, and the total effect exceeds the sum of the effects of each drug when used alone. In other words, the effect of the combined use of two drugs is greater than the efficacy of any one drug used alone, and greater than the additive effect of the two drugs.

[0082] The term "about" may refer to a value or composition within an acceptable error range for a particular value or composition determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. In the present application, when "about" is used to modify a numerical value, it means that the numerical value may fluctuate up or down within the range of ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2% or ±1%.

[0083] The term "modulate" includes treating, preventing or interfering.

[0084] The term "treatment" refers to administering the drug of the present invention to a subject in need of treatment for the purpose of curing, alleviating, improving, alleviating, affecting the disease, symptoms, or predisposition of the subject. The subjects of the present invention include mice, rabbits, monkeys, humans, and other mammals.

[0085] The term "therapeutically effective amount" refers to the amount of a drug that can achieve the therapeutic purpose in the body of the treated subject. It should be understood by those skilled in the art that the "therapeutically effective amount" may vary depending on the route of administration of the drug, the pharmaceutical excipients used, and the combination of the drug with other drugs.

[0086] The pharmaceutical composition of the present invention comprises the drug (active ingredient) of the present invention within a safe and effective amount and a pharmacologically acceptable excipient or carrier. The "safe and effective amount" means that the amount of the active ingredient is sufficient to significantly improve the condition without causing serious side effects. Generally, the pharmaceutical composition contains 0.001-1000 mg of active ingredient / dose, preferably 0.05-300 mg of active ingredient / dose, and more preferably, 0.5-200 mg of active ingredient / dose.

[0087] The active ingredient of the present invention and its pharmacologically acceptable salt can be made into various preparations, which contain the active ingredient of the present invention or its pharmacologically acceptable salt within the safe and effective amount range and a pharmacologically acceptable excipient or carrier. The "safe and effective amount" means that the amount of the active ingredient is sufficient to significantly improve the condition without causing serious side effects. The safe and effective amount of the active ingredient is determined according to the specific circumstances such as the age, condition, and course of treatment of the subject.

[0088] "Pharmacologically acceptable excipients or carriers" refer to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the compounds of the present invention and with each other without significantly reducing the efficacy of the compounds. Some examples of pharmacologically acceptable excipients or carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as, wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0089] When the composition of the present invention is used, it can be administered orally, rectally, parenterally (intravenously, intramuscularly or subcutaneously), or topically. It can be prepared into any dosage form allowed pharmaceutically, including but not limited to tablets, oral agents, granules, injections, liposomes, targeted drug delivery injection pills, capsules, granules, powders, suppositories, powders, ointments, patches, injections, solutions, suspensions, sprays, lotions, drops, liniments, etc. The pharmaceutical composition can be made into a dry powder form and mixed with sterile water or a buffer before administration to make a solution form. The pH of the buffer is generally 3-11, preferably 5-9, and more preferably 7-8.

[0090] The composition of the present invention can be administered alone or in combination with other pharmaceutically acceptable compounds.

[0091] Microcapsules containing the pharmaceutical composition of the present invention can be used for sustained-release administration of the active ingredient of the present invention. The sustained-release preparation of the active ingredient of the present invention can be prepared with a lactic acid glycolic acid polymer (PLGA) having good biocompatibility and broad biodegradability. The degradation products of PLGA, lactic acid and glycolic acid, can be quickly cleared by the human body. Moreover, the degradation capacity of the polymer can be extended from several months to several years depending on its molecular weight and composition (Lewis, "Controlled release of bioactive agents form lactide / glycolide polymer," in: M.Chasin and R.Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp.1-41)).

[0092] When using the pharmaceutical composition, a safe and effective amount of the active ingredient of the present invention is applied to a mammal (such as a human) in need of treatment, wherein the dosage during administration is a pharmaceutically effective dosage, and for a person weighing 60 kg, the dosage per administration is usually 0.01 to 300 mg, preferably 0.5 to 100 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the health status of the patient, which are all within the skill of a skilled physician.

[0093] According to one aspect of the present invention, the present invention provides a method for preparing the pharmaceutical composition, wherein the method comprises mixing the first component and the second component with a pharmaceutically acceptable excipient.

[0094] The term "excipient" means a pharmaceutically acceptable ingredient that does not have any pharmacological effect and is generally used in the pharmaceutical technology of preparing granules and / or solid oral dosage forms and / or liquid injection formulations. Excipients can act as carriers, diluents, or dissolution modifiers, absorption enhancers, stabilizers, or auxiliary agents for preparation and other effects. Excipients useful in preparing pharmaceutical compositions are generally safe, nontoxic, and acceptable for medical use and pharmaceutical use. "Excipients" or "pharmaceutically acceptable excipients" used in this specification include one or more such excipients.

[0095] Pill Box

[0096] The terms "kit" or "test kit" are used interchangeably in this application. The present application discloses a kit comprising a therapeutically effective amount of the therapeutic agent or pharmaceutical composition. According to certain embodiments of the present application, the kit further comprises one or more other therapeutic agents. According to certain embodiments of the present application, the kit further comprises instructions for use. According to certain embodiments of the present application, the kit further comprises a device for a corresponding administration method, such as but not limited to a needle.

[0097] According to one aspect of the present invention, the present invention provides a drug kit, which comprises the siRNA of the present invention or its precursor, or exosomes loaded with the siRNA of the present invention or its precursor, and a chemotherapeutic drug.

[0098] Treatment

[0099] According to one aspect of the present invention, a method for treating cancer using the siRNA of the present invention or its precursor, or exosomes loaded with the siRNA of the present invention or its precursor, or the pharmaceutical composition of the present invention is provided.

[0100] According to certain embodiments of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the siRNA of the present invention or a precursor thereof, or exosomes loaded with the siRNA of the present invention or a precursor thereof.

[0101] According to certain embodiments of the present invention, the pharmaceutical composition comprises a first component and a second component, wherein the first component is the siRNA of the present invention or its precursor, or exosomes loaded with the siRNA of the present invention or its precursor, and the second component is a chemotherapeutic drug.

[0102] Unless otherwise specified in this application or clearly contradicted by the context, the terms "a", "an", "said", "the", "at least one" and similar references used in the context of describing this application (including the context of the claims) are interpreted to cover the singular and the plural. Unless otherwise specified in this application or clearly contradicted by the context, the terms "comprising", "having", "including" and "containing" used in this application are interpreted as open terms (i.e., "including but not limited to"). Unless otherwise specified in this application or clearly contradicted by the context, all methods described in this application can be performed in any suitable order according to the understanding of those skilled in the art.

[0103] The present invention is further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, parts and percentages are by weight.

[0104] Materials and methods

[0105] Plasmids and antibodies: The loop sequence of circASCC3 was cloned into the plasmid pLCDH-GFP-CiR. DDX5, NONO, RUVBL1, and EIF4A3 were cloned into the pcDNA3.1 vector with a Myc tag. The p53 response element (p53-RE) was cloned into the pGL3 vector. The pPyCAG-RNASEH1-D210N and -WKKD plasmids were gifts from Liang Chen's laboratory. The purchased antibodies included anti-Flag (F1804, Sigma-Aldrich), anti-Myc (60003-2-Ig and 16286-1-AP, Proteintech), anti-DDX5 (Cat. No.67025-1-Ig, Proteintech), anti-α-Tubulin (66031-1-Ig, Proteintech), anti-β-actin (Cat. No.66009-1-Ig, Proteintech), anti-Cleaved PARP (Cat. No.13371-1-AP, Proteintech), anti-γ-H2AX (Cat. No.9718, Cell Signaling Technology) and anti-S9.6 (Cat. No.GS50001, Mabnus).

[0106] Cell culture and transient transfection: Human cancer cell lines including CAL51, MCF7, HCT116, HCT116 p53- / -, RKO, H1299, TOV112D and ES-2 were cultured in DMEM supplemented with 10% FBS and 1% penicillin and streptomycin. OVCA420 cells were cultured in 1640 supplemented with 10% FBS and 1% penicillin and streptomycin. All cells were mycoplasma-free and authenticated by the mycoplasma detection kit (Yeasen, Shanghai, China) and cultured in a humidified incubator at 37°C with 5% CO2. Transient transfection of plasmids and siRNAs was performed using Hieff Trans Liposomal transfection reagent according to the manufacturer's protocol (Yeasen, Shanghai, China). The siRNAs used in the study are listed in Table 1.

[0107] Quantitative real-time polymerase chain reaction: Total RNA was extracted using RNAiso Plus (Takara, Japan). IIIRT SuperMix for qPCR (+gDNA wiper) (Vazyme) was used for complementary DNA (cDNA) synthesis. SYBR Green SuperMix (Takara, Japan) and QuantStudioTM 6Flex Real-Time PCR System (ThermoFisher Scientific, USA) were used for RNA quantitative real-time polymerase chain reaction (RT-qPCR).

[0108] RNA stability analysis: For actinomycin D treatment, cells were seeded in six-well plates and grown to 60% confluence. Cells were then treated with 5 μg / ml actinomycin D and collected at the indicated time points. Total RNA was extracted using RNAiso Plus (Takara, Japan) and analyzed by RT-qPCR. For RNase R treatment, total RNA (3 μg) was incubated with 5U RNase R (Lucigen, Wisconsin, USA) at 37°C for 15 minutes and then incubated at 70°C for 10 minutes to inactivate RNaseR. The abundance of the indicated RNA was analyzed by RT-qPCR.

[0109] Immunoblotting: Cells were collected and lysed in a lysis buffer containing 50 mM Tris / HCl (pH 8.0), 150 mM NaCl, 1% (v / v) Triton X-100, 0.1% (w / v) SDS, 1% sodium dodecyl sulfate, and a complete protease inhibitor cocktail. Equal amounts of protein lysates were separated by SDS-PAGE gel and then transferred to a PVDF membrane (Millipore, USA). The membrane was incubated with the primary antibody overnight at 4°C and then incubated with the secondary antibody for 1 hour at room temperature. The immunoreaction signal was detected by an enhanced chemiluminescence (ECL) kit.

[0110] Immunoprecipitation: Cells were collected and lysed in immunoprecipitation (IP) lysis buffer containing 50 mM Tris / HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% (v / v) NP-40 and complete protease inhibitor cocktail. 500 to 1000 mg of total protein was incubated with the indicated antibodies overnight at 4°C and then mixed with protein A or G beads for 2 hours at 4°C. The mixture was washed five times with IP lysis buffer. Bound proteins were detected by IB analysis.

[0111] RNA precipitation experiments: Cell lysates were prepared in RIP buffer supplemented with complete protease inhibitor cocktail and RNase inhibitor. Cell lysates were incubated with in vitro transcribed biotin-labeled RNA or RNA probe for 3 h at 4 °C. The mixture was then incubated with pre-cleared streptavidin magnetic beads at 4 °C overnight. After washing the mixture five times, SDS loading buffer was added to the beads and boiled at 100 °C for 10 min. Samples were analyzed by SDS-PAGE gel and mass spectrometry.

[0112] RNA immunoprecipitation: Cells were lysed in RNA immunoprecipitation (RIP) buffer containing 10mMTris / HCl (pH7.4), 150mM NaCl, 1mM EDTA, 1mM dithiothreitol, 0.1% (w / v) sodium dodecyl sulfate, 1% (v / v) NP-40, complete protease inhibitor cocktail, and RNase inhibitor. Equal amounts of cell lysates were immunoprecipitated with the indicated antibodies overnight at 4°C, followed by incubation with protein A or G beads for 3 hours at 4°C. 2% of each sample was used for input analysis by immunoblotting or PCR. After washing the mixture six times, bound RNA was extracted using RNAiso Plus and analyzed by RT-qPCR.

[0113] Chromatin immunoprecipitation: Chromatin immunoprecipitation (ChIP) assays were performed using the Magna ChIPTM A / G Chromatin IP Kit following the manufacturer's protocol (Merck). Briefly, 1% formaldehyde was added to the cell dish to crosslink the cells for 10 min at room temperature, and then glycine was added to a final concentration of 125 mM to stop crosslinking. After rinsing with ice-cold PBS, the cells were scraped from the dish and suspended in chromatin lysis buffer supplemented with protease inhibitors. The nuclei were then collected and lysed using nuclear lysis buffer. Chromatin was sheared into fragments ranging from 200 to 1000 bp by sonication. Magnetic beads with anti-p53 antibody or IgG were mixed with the sheared chromatin overnight at 4 °C. The beads were washed four times and eluted using elution buffer. The purified DNA was purified and analyzed by qPCR.

[0114] DNA-RNA immunoprecipitation: Cells were lysed with SDS / proteinase K overnight at 37°C. Nucleic acids were purified using phenol-chloroform and high-density Maxtract phase-locked gels followed by ethanol precipitation at room temperature. The obtained nucleic acids were digested overnight at 37°C using a combination of restriction enzymes (BsrGI, EcoRI, HindIII, SspI, and XbaI) in NEB buffer 2.1 supplemented with 1 mM spermine and 100 μg / ml BSA. The digested DNA was purified by phenol-chloroform extraction and then either treated with RNase H overnight at 37°C or not. DNA:RNA hybrids extracted from 10 μg of digested nucleic acids were incubated with 3 μl of S9.6 antibody (specifically capturing DNA:RNA hybrids) and 50 μl of protein A / G agarose beads at 4°C for 3 hours in DNA-RNA immunoprecipitation (DRIP) binding buffer (10 mM NaPO4, 140 mM NaCl, 0.05% Triton X-100). The beads were then washed three times with DRIP binding buffer at room temperature and incubated with elution buffer (50 mM Tris pH 8.0, 10 mM EDTA pH 8.0 and 0.5% SDS, and 140 μg proteinase K) at 55°C for 45 minutes. Nucleic acids were purified by phenol-chloroform extraction followed by ethanol precipitation at -20°C overnight.

[0115] R-Chromatin immunoprecipitation: HEK-293T cells expressing V5-tagged RNASEH1-D210N or -WKKD mutant proteins were cross-linked with 1% formaldehyde for 10-15 minutes. Glycine was added to a final concentration of 125 mM at room temperature to stop the reaction. After washing twice with PBS, the cells were scraped, and the nuclei were extracted using cell lysis buffer (10 mM Tris / HCl pH8.0, 10 mM NaCl, 0.5% Igepal CA-630) and suspended in nuclear lysis buffer (50 mM Tris / HCl pH8.0, 10 mM EDTA pH8.0, 1% SDS). Chromatin DNA was sheared into fragments of 100-600 bp by ultrasound. 5% of the chromatin fragments were retained for input analysis. The remaining samples were incubated overnight at 4°C with beads with anti-V5 antibodies. The beads were then washed once with wash buffer I (20 mM Tris / HCl pH 8.0, 2 mM EDTA pH 8.0, 1% Triton X-100, 0.1% SDS, 150 mM NaCl), wash buffer II (20 mM Tris / HCl pH 8.0, 2 mM EDTA pH 8.0, 1% Triton X-100, 0.1% SDS, 500 mM NaCl), wash buffer III (10 mM Tris / HCl pH 8.0, 1 mM EDTA pH 8.0, 1% Igepal CA-630, 250 mM LiCl, 1% sodium dodecyl sulfate) and TE buffer. The beads were then incubated with elution buffer (10 mM Tris / HCl pH 8.0, 1 mM EDTA pH 8.0, 1% SDS) at 65°C overnight and treated with RNase A and proteinase K. DNA was purified by phenol-chloroform extraction and ethanol precipitation at -20°C overnight.

[0116] Immunofluorescence staining: cells were treated with cisplatin and transfected with specific siRNA and plasmids. Then, cells were fixed with methanol at -20 ° C overnight. Cells were washed three times with PBS and blocked with blocking buffer (8% BSA and 0.3% Triton X-100) for 1 hour at room temperature. Next, cells were incubated with primary antibody (anti-S9.6, 1:100) at 4 ° C overnight. Then, cells were washed with PBS and incubated with fluorescent secondary antibody (Yeasen) and DAPI (Sigma-Aldrich). Images were acquired using a confocal fluorescence microscope (Leica, Wetzlar, Germany).

[0117] Cell viability assay: Cell viability assay was performed using a cell counting kit-8 (CCK-8) (Dojindo, Shanghai, China) according to the manufacturer's instructions. Cells transfected with the indicated plasmids or siRNA or treated with pulse agents were seeded in 96-well culture plates with 2000-4000 cells per well. 10% WST-8 was added to each well every 24 hours, and the absorbance of the samples was measured at 450 nm.

[0118] Flow cytometry: Apoptosis was assessed using the PE annexin V apoptosis detection kit (BD Pharmingen). Cells were collected with trypsin, washed with pre-chilled PBS, and resuspended with 100 μl 1× binding buffer. They were then incubated with Annexin V-PE and 7-aminoactinomycin D (7AAD) for 15 minutes at room temperature in the dark. Apoptosis levels were determined by flow cytometry (CytoFLEXS, Beckman Coulter).

[0119] Mouse xenograft experiments: 5-week-old female BALB / c nude mice were obtained from the Laboratory Animal Science, Shanghai Cancer Center, Fudan University. 4 × 10^6 HCT116 cells stably overexpressing circASCC3 or shcircASCC3 or control vector were resuspended in serum-free medium and injected subcutaneously into the flank region of mice. Tumor growth was monitored every other day with an electronic digital caliper. Tumor volume was calculated according to the formula: volume = length × width^2 × 0.52. When the tumor reached the appropriate volume, it was harvested, weighed, and photographed. The animal protocol was in accordance with ethical guidelines and approved by the Animal Welfare Committee of Shanghai Cancer Center, Fudan University.

[0120] Whole transcriptome microarray: CAL51 cells were treated with DMSO, Nutlin-3, 5-fluorouracil, or cisplatin for 48 h. Total RNA was extracted using RNAiso Plus (Takara, Japan). Microarray analysis was provided by China Shanghai Biotechnology Co., Ltd. (Shanghai, China).

[0121] Colorectal cancer specimens: A total of 80 colorectal cancer tissues and 15 matched adjacent normal tissues were used to construct cDNA microarrays (Shanghai Outdo Biotechnology, Shanghai, China), which were subjected to qPCR analysis of circASCC3 expression. This application was approved by the Human Research Ethics Committee of Shanghai Cancer Center, Fudan University.

[0122] Statistical analysis: All in vitro experiments were performed with biological replicates. Differences between two or more groups were analyzed by Student's t-test or one-way ANOVA. Statistical analysis was performed using GraphPad Prism 8.0, and the results are presented as mean ± standard deviation (SD). The Kaplan-Meier plot method and log-rank test were used to analyze significant differences in patient survival. Asterisks indicate statistical significance: *p<0.05; **p<0.01; ***p<0.001.

[0123] Example 1 Identification of circASCC3 as a p53-induced circular RNA

[0124] To identify circular RNAs that respond to DNA damage and p53 activation, whole transcriptome microarray analysis was performed on CAL51 cells treated with the chemotherapeutic drugs Nutlin-3, 5-fluorouracil (5-FU), or cisplatin ( Figure 1 A). The results are robust because many genes encoding known p53-induced proteins are upregulated after treatment. By combining analysis of fold change, p-value, and circular RNA length and expression ( Figure 1 B and 1C), we identified a circular RNA hsa_circ_0077495 with high baseline expression levels (determined by microarray data and cycle threshold (Ct) values ​​of RT-qPCR) and that was consistently upregulated by Nutlin-3 and DNA damage inducers. This circular RNA was named circASCC3 because it consists of exons 5 to 8 of the host gene ASCC3, which was verified by Sanger sequencing ( Figure 1 D). The circular structure of circASCC3 was further confirmed by PCR analysis using convergent and divergent primers as described ( Figure 1 D). The results show that the PCR product from the junction site can be amplified from cDNA, but not from genomic DNA, using divergent primers, indicating the presence of a back-splicing event at this site ( Figure 1 E). CircNSUN2 was used as a reference for comparison. In addition, circASCC3 is more stable than the linear transcripts of ASCC3 and CDKN1A (commonly known as p21) as it exhibits a prolonged half-life in cancer cells blocked for transcription with actinomycin D ( Figure 1 F) and are resistant to RNase R digestion ( Figure 1 G). Finally, the subcellular localization of circASCC3 was determined, and it was found that this circular RNA was mainly distributed in the cytoplasm of cancer cells ( Figure 1 H). These results indicate that circASCC3 is a circular RNA whose expression level is increased in response to DNA damage and p53 activation.

[0125] Example 2 p53 transcriptionally activates circASCC3 expression

[0126] To explore whether p53 regulates the expression of circASCC3, a set of RT-qPCR analyses were performed after cancer cells were treated with p53 inducers such as Nutlin-3, cisplatin, and 5-FU. These drugs significantly induced the expression of circASCC3 and its host gene ASCC3, as well as the expression of the p53 target gene p21 in a group of wild-type p53-bearing cancer cells, including CAL51, MCF7, HCT116, RKO, and A549 ( Figure 2 A-2D;). In contrast, knockdown of p53 significantly reduced the expression of circASCC3 and ASCC3 in cancer cells treated with cisplatin or Nutlin-3 ( Figure 2 E-2G). We also tested whether wild-type p53 is required for this regulation by using cancer cells without p53 or expressing mutant p53, including HCT116 p53- / -, H1299, TOV112D, OVCA420, and ES-2 cells. Treatment of these cells with cisplatin or Nutlin-3 did not affect the expression of circASCC3 and ASCC3 ( Figure 2 H-2K). In addition, knockdown of mutant p53 had no significant effect on the expression of circASCC3 and ASCC3 ( Figure 2 L and 2M). Consistently, overexpression of wild-type p53, but not some p53 mutants, significantly induced the expression of circASCC3 ( Figure 2 N). These results suggest that the increase in circASCC3 expression may be associated with the transcriptional activity of wild-type p53. To test this hypothesis, the p53MH algorithm was used to search for potential p53-responsive elements (p53-REs) in the promoter sequence of ASCC3. Three possible p53-REs were identified at positions −1511 to −1536, −1281 to −1307, and +3303 to +3327 ( Figure 2 O). ChIP analysis showed that p53 strongly bound to p53-RE-1 and moderately bound to p53-RE-2, but not to p53-RE-3 ( Figure 2 In addition, overexpression of p53 significantly induced the luciferase activity driven by the ASCC3 promoter fragment containing p53-RE-1 and -2 ( Figure 2 Q). Taken together, these results suggest that p53 induces the expression of circASCC3 by transcriptionally activating its host gene ASCC3.

[0127] Example 3 RNA binding protein SFPQ is involved in p53-mediated upregulation of circASCC3

[0128] Backsplicing circularization of circular RNA is catalyzed by the spliceosomal machinery and regulated by intron-complementary sequences (ICSs) and RNA-binding proteins (RBPs). By searching RBPmap, several RBPs were found to be responsible for the circularization of circASCC3 by binding to the flanking intronic regions of circASCC3. To test the hypothesis, RNAi screening of RBPs that can regulate circASCC3 expression was performed in CAL51 and HCT116 cells. As a result, ablation of SFPQ was identified to significantly induce circASCC3 expression in both cell lines ( Figure 3 To validate these results, two independent siRNAs were used to knock down SFPQ expression and consistently demonstrated that depletion of SFPQ significantly increased the expression level of circASCC3 but decreased the level of ASCC3 mRNA ( Figure 3 C and 3D). These results suggest that SFPQ may play a role in inhibiting the circularization of circASCC3, thereby increasing the production of ASCC3 linear transcripts. It is known that repetitive elements are major ICSs that facilitate backsplicing and the formation of circular RNAs. It is speculated that SFPQ may bind to these repetitive elements to prevent the circularization of circASCC3. Indeed, several potential SFPQ binding sites were predicted on the repetitive elements in the flanking intronic regions ( Figure 3 E). RIP analysis was then performed to confirm that SFPQ could bind to 4 of the 6 potential binding sites on exons 5 to 8 in both flanking regions ( Figure 3 F). DNA damage inducers and Nutlin-3 can induce the expression of circASCC3 more significantly than ASCC3 mRNA ( Figure 2 A-2G). These results suggest that p53 may also play a role in promoting the circularization of circASCC3. By reanalyzing the microarray data, we found that p53 activation reduced the expression of SFPQ. RT-qPCR analysis verified that cisplatin and Nutlin-3 inhibited the expression of SFPQ, which could be partially reversed by p53 depletion ( Figure 3 G-3I). Taken together, these results suggest that p53 may promote the circulation of circASCC3 by inhibiting the expression of SFPQ.

[0129] Example 4 Overexpression of circASCC3 promotes tumor resistance to genotoxic stress

[0130] To explore the biological function of circASCC3, plasmids encoding circASCC3 were ectopically overexpressed in various cancer cells. First, by performing cell viability assays and flow cytometry analysis, it was found that circASCC3 overexpression had little effect on cell proliferation or apoptosis. It is speculated that circASCC3 may play a role under DNA damage stress. To test this hypothesis, cancer cells were pulse-treated with the strong DNA damage inducer methyl methanesulfonate (MMS) as well as cisplatin and etoposide, which is very similar to chemotherapy but minimizes extensive cell death. Unexpectedly, circASCC3 overexpression significantly promoted the growth of cancer cells treated with these drugs, as evidenced by the results of cell viability assays ( Figure 4 A-4D). In addition, ectopic circASCC3 suppressed apoptosis under genotoxic stress in various cancer cells, as shown by flow cytometry analysis ( Figure 4 E-4H) and cleaved PARP levels ( Figure 4 I and 4J). Consistently, circASCC3 overexpression leads to cancer cell resistance to MMS and cisplatin ( Figure 4 K and 4L). Furthermore, the results showed that circASCC3 overexpression supported the growth of xenograft tumors treated with cisplatin, as evidenced by the increased tumor growth rate ( Figure 4 M)、Weight( Figure 4 N) and size ( Figure 4 O) indicates that potential adverse events caused by the treatment were tolerable, as the mean body weight of the mice was not affected ( Figure 4 P). Taken together, these results suggest that ectopic circASCC3 promotes cancer cell survival under genotoxic stress in vitro and in vivo.

[0131] Example 5 Knockout of circASCC3 increases tumor sensitivity to genotoxic stress

[0132] siRNA was designed for the circASCC3 gene and the knockdown efficiency and effectiveness were tested.

[0133] siRNA knockdown efficiency screening:

[0134] After the designed siRNA was synthesized, the cell RNA was extracted after transfection, and after reverse transcription reaction, the knockdown efficiency of the circASCC3 gene was detected by qPCR.

[0135] Some representative siRNAs designed are as follows:

[0136] Table 1

[0137]

[0138]

[0139] Based on the initial screening results, 10 siRNAs that showed knockdown effects on the circASCC3 gene were rescreened.

[0140] According to the re-screening results, siRNA No. 01 and siRNA No. 02 with the best knockdown effect were named sicircASCC3-1 (SEQ ID NO. 2) and sicircASCC3-2 (SEQ ID NO. 3) for subsequent experiments.

[0141] To examine the role of endogenous circASCC3, its expression was depleted in various cancer cells using two independent siRNAs (sicircASCC3-1 and sicircASCC3-2), while ASCC3 expression remained unchanged. Knockdown of circASCC3 had little effect on cell growth or apoptosis in unstressed cancer cells. However, depletion of circASCC3 significantly inhibited cell growth in cancer cells treated with genotoxic drugs ( Figure 5 A-5C) and promoted apoptosis ( Figure 5 D-5G). Consistent with these cell-based experiments, depletion of circASCC3 inhibited the growth rate of xenograft tumors treated with cisplatin ( Figure 5 H), weight ( Figure 5 I) and size ( Figure 5 J), without affecting the average body weight of mice ( Figure 5 K). These results indicate that knockout of circASCC3 enhances genotoxic stress-induced cancer cell death.

[0142] ASCC3 has been reported to cooperate with ALKBH3 to repair DNA alkylation lesions in prostate and lung cancer cells that express high levels of ALKBH3. Therefore, we tested whether endogenous ASCC3 is involved in cell survival under genotoxic stress. Knockdown of ASCC3 with two different siRNAs did not affect cell growth or apoptosis under unstressed and genotoxic conditions. These findings suggest that the role of circASCC3 in triggering resistance to genotoxic stress is independent of the host gene ASCC3 in these cells.

[0143] Example 6 CircASCC3 interacts with DDX5 and stabilizes DDX5

[0144] To understand the potential mechanism by which circASCC3 supports cell survival under DNA damage stress, two strategies were used to perform RNA-pull down assays combined with mass spectrometry (MS) analysis. CircASCC3-associated proteins were pulled down by biotin-labeled back-splicing junction (BSJ) probes targeting endogenous circASCC3 ( Figure 6 A), and biotin-labeled linear circASCC3 transcripts ( Figure 6 B). The protein complexes pulled down by the two strategies were subjected to MS analysis, and several proteins that may bind to circASCC3 were identified. RIP assays were then performed to verify that circASCC3 strongly binds to DDX5, as shown by gel electrophoresis and RT-qPCR analysis ( Figure 6 C and 6D). However, despite the presence of these proteins in the MS results, no interaction with NONO, RUVBL1, or EIF4A3 was observed ( Figure 6 C and 6D). DDX5 has been shown to maintain genome integrity and promote DNA damage repair by resolving R-loops. Therefore, circASCC3 may promote chemotherapy resistance by regulating DDX5. It was unexpectedly found that knocking out circASCC3 reduced DDX5 protein levels ( Figure 6 E and 6F), while its mRNA expression remained unchanged ( Figure 6 G and 6H). This decrease could be fully restored in cancer cells treated with the proteasome inhibitor MG132 ( Figure 6 I and 6J). In contrast, overexpression of circASCC3 prolonged the half-life of DDX5 protein ( Figure 6 K and 6L). In addition, the results showed that knocking down DDX5 could partially reverse the effects of circASCC3 overexpression on cancer cell growth ( Figure 6 M) and apoptosis ( Figure 6 Taken together, these results suggest that circASCC3 may trigger chemoresistance by stabilizing DDX5, thereby eliminating the R-loop.

[0145] Example 7 CircASCC3 inhibits R-loop accumulation via DDX5

[0146] Since DDX5 restricts R-loops to maintain genomic stability, we examined whether circASCC3 functions through DDX5 to resolve R-loops under DNA damage conditions. R-loops accumulate at transcriptional pause sites, which are key elements for transcription termination. The human ACTB gene has a G-rich pause element that can be used as a reference to indicate R-loop formation. DRIP-qPCR was performed using the S9.6 antibody that specifically captures R-loops. The results showed that circASCC3 overexpression significantly reduced the level of R-loops formed at ACTB pause sites ( Figure 7 A), while depletion of circASCC3 increased R-loop formation ( Figure 7 B). These findings were further confirmed by DRIP-qPCR assay at another R-loop site in the RPS23 locus ( Figure 7A and 7B). DRIP-qPCR results are reliable because R-loops can be nearly eliminated by RNase H ( Figure 7 A and 7B), RNase H is an endonuclease that specifically recognizes and resolves R-loops. The R-ChIP method has been previously developed to detect R-loops using catalytically inactive RNASEH1. R-ChIP assays were then performed to test whether circASCC3 prevents R-loop accumulation. The D210N mutant of RNASEH1 was shown to bind to R-loops without resolving them. The results showed that circASCC3 overexpression significantly reduced the level of R-loops bound to RNASEH1-D210N ( Figure 7 C). WKKD mutants (W43A, K59A, K60A, and D210N) lost their catalytic and binding activities and served as negative controls for comparison. In addition, IF staining assay using S9.6 antibody was used to validate the function of circASCC3 in regulating R-loops. Cisplatin-induced DNA damage increased the level of R-loops ( Figure 7 D). Notably, knockdown of p53 or circASCC3 further promoted R-loop accumulation, whereas overexpression of DDX5 partially restored the R-loop level ( Figure 7 D). Finally, the clinical significance of circASCC3 in colorectal cancer samples was evaluated. The results showed that the expression level of circASCC3 was lower in cancer tissues compared with normal tissues ( Figure 7 E). This may be because p53 is often inactivated or mutated in tumor cells. Consistent with its role in triggering tumor resistance to chemotherapy, high levels of circASCC3 in tumors are associated with poor prognosis ( Figure 7 F and 7G). However, the correlation was not statistically significant and more colorectal cancer samples may be needed. Overall, the p53-circASCC3 cascade maintains genomic stability by increasing DDX5-mediated R-loop resolution.

[0147] p53 maintains genome stability and suppresses cancer by regulating the transcription of numerous protein-coding and non-coding genes. p53 was found to control the expression of circRNA by activating the transcription of host genes. Circ-MDM2 was the first circRNA identified as regulated by p53 because it originates from the MDM2 gene locus. Like MDM2, this circRNA promotes tumor cell growth by downregulating p53 protein levels. IRSense is another p53-induced circRNA that confers resistance to radiotherapy in lung cancer. The present application discloses circASCC3 as a p53-induced circRNA and reveals the mechanism by which p53 regulates the expression of circASCC3. The expression of circRNA involves the transcription of its host gene and subsequent back splicing or circularization. The present application found that p53 activated the transcription of the host gene ASCC3 of circASCC3 under DNA damage stress ( Figure 2 ). In addition, although the RNA-binding protein SFPQ binds to the flanking region of circASCC3 to reduce its expression, p53 can inhibit the expression of SFPQ, thereby potentially promoting the circularization and expression of circASCC3 ( Figure 3 ). These findings suggest that p53 activates circASCC3 expression at both transcriptional and post-transcriptional levels.

[0148] Activation of p53 can inhibit cancer development, but may also lead to resistance to chemotherapy by enhancing DNA damage repair. Surprisingly, the results of this application showed that overexpression or depletion of circASCC3 had no effect on the growth and apoptosis of cancer cells cultured under normal conditions. However, overexpression of circASCC3 inhibited apoptosis of cancer cells treated with DNA damage inducers and promoted their growth ( Figure 4 ). In contrast, knockdown of circASCC3 increased apoptosis and inhibited cancer cell growth under DNA damage conditions ( Figure 5 ). These findings suggest that circASCC3 plays a role in regulating DNA damage repair in colorectal cancer and breast cancer. Mechanistically, our results show that circASCC3 interacts with DDX5 and stabilizes DDX5 ( Figure 6 ), which is an RNA / DNA helicase that can resolve R-loops. Although this application demonstrated that circASCC3 prevents proteasomal degradation of DDX5, further studies are needed to determine whether any E3 ubiquitin ligase is involved in this process. Interestingly, a recent study showed that circASCC3 promoted the growth of lung cancer cells even under normal growth conditions, suggesting that the regulatory mechanism of circASCC3 may vary depending on the context of different cancers. Finally, through multiple experimental approaches, this application demonstrated that circASCC3 prevents R-loop accumulation under DNA damage stress through DDX5 ( Figure 7 A-7D). The present application found that cisplatin-induced DNA damage significantly promoted the accumulation of R-loops ( Figure 7 D), which is consistent with previous studies, while the basal level of R-loops in cancer cells is relatively low. This result may explain why circASCC3 has little effect on the growth and apoptosis of cancer cells under normal growth conditions. By analyzing matched colorectal cancer samples, it was found that the expression level of circASCC3 was higher in normal tissues compared with cancer tissues ( Figure 7 E), suggesting that circASCC3 may prevent cancer formation by maintaining genome stability in normal cells. In addition, high levels of circASCC3 in tumors predicted poor prognosis ( Figure 7 F and 7G), possibly due to its role in resolving R-loops and conferring chemoresistance. Taken together, these findings reveal an important role for circASCC3 in p53-mediated R-loop resolution and maintaining genomic stability.

[0149] The results of this application revealed that the protein-coding gene ASCC3 is a true target gene of p53. This is because DNA damage inducers or Nutlin-3 increase the expression of ASCC3, while knockdown of p53 reduces its expression ( Figure 2 A-2G). In addition, the ChIP and luciferase reporter gene assays of the present application verified that p53 can bind to the ASCC3 gene promoter to activate transcription ( Figure 2 P and 2Q). The finding that p53 transcriptionally induces ASCC3 expression suggests a different mechanism by which p53 promotes DNA damage repair. ASCC3 encodes a 3'-5' DNA helicase that cooperates with ALKBH3 to remove DNA alkylation adducts. ASCC3 conferred resistance to alkylation damage in PC3, LNCap, and H23 cells with high ALKBH3 expression, but had no effect in WiDr, U2OS, and HTB-1 cells with low ALKBH3 expression levels. Therefore, p53 may be involved in the repair of alkylation damage in cancer cells with high ALKBH3 levels.

[0150] In summary, this application identified a p53-induced circular RNA, circASCC3. Overexpression of circASCC3 increased cancer cell survival and growth under DNA damage stress, whereas depletion of circASCC3 inhibited their survival and growth. Mechanistically, circASCC3 interacted with DDX5 and prevented its proteasomal degradation, thereby resolving R-loops and conferring resistance to DNA damage ( Figure 8 ). This application reveals an important mechanism by which p53 maintains genome integrity.

[0151] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A siRNA targeting circASCC3, characterized in that: The siRNA is selected from the group consisting of: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

2. A siRNA precursor (shRNA), characterized in that The siRNA precursor is the siRNA precursor of claim 1; preferably, the 5' to 3' ends of the siRNA precursor sequentially include: a first sequence unit, a stem-loop sequence unit and a second sequence unit, the first sequence unit and the second sequence unit are complementary so that the siRNA precursor forms a hairpin structure, and the first sequence unit is selected from the following group: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

3. An exosome, characterized in that: The exosomes are loaded with the siRNA or its precursor according to claim 1.

4. The use of the siRNA according to claim 1, or the siRNA precursor according to claim 2, or the exosome according to claim 3, characterized in that: Used for: (1) Preparation of drugs for preventing or treating tumors; (2) preparing agents that enhance tumor sensitivity to chemotherapy or reduce tumor resistance to chemotherapy; (3) preparing drugs that inhibit tumors through p53-dependent mechanisms; or (4) Prepare drugs that inhibit tumors through p53-independent mechanisms.

5. The use according to claim 4, characterized in that The tumor is a p53 wild-type tumor, or the tumor is a p53 mutant tumor.

6. The use according to claim 4, characterized in that The tumor is a chemotherapy-resistant tumor.

7. A pharmaceutical composition, characterized in that It comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the siRNA according to claim 1, or the siRNA precursor according to claim 2, or the exosomes according to claim 3.

8. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition also includes an effective amount of a chemotherapeutic drug.

9. A method for knocking down the expression level of circASCC3 in cells, comprising the steps of: culturing cells in the presence of the siRNA according to claim 1, the siRNA precursor according to claim 2, or the exosomes according to claim 3, thereby knocking down the expression level of circASCC3 in cells.

10. A method for non-therapeutic inhibition of tumor cells in vitro, characterized in that: The method comprises the steps of: culturing tumor cells in the presence of a circASCC3 inhibitor, thereby inhibiting the tumor cells.

Images