Application of reagent for detecting SNP site rs1531641 in preparation of AMS susceptible population screening product

Abstract

The invention provides application of a reagent for detecting an SNP (Single Nucleotide Polymorphism) site rs1531641 in preparation of a product for screening AMS susceptible population, and relates to the technical field of biomedicine. Whole genome association research finds that the genotype TT of the SNP site rs1531641 of 3q25.1 is a susceptible genotype of AMS, and by detecting the SNP site rs1531641, auxiliary screening of AMS susceptible population can be effectively realized, and scientific intervention is carried out, so that the risk of AMS occurrence of the susceptible population is reduced in a targeted manner.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of a reagent for detecting a SNP site rs1531641 in preparing an AMS susceptible population screening product. Background Art

[0002] Acute mountain sickness (AMS) is the most common illness at high altitudes, usually occurring soon after a rapid ascent to an oxygen-deprived environment. The incidence of AMS increases with altitude, with an incidence of 5.8% at 2,850 meters, 2.1% at 3,050 meters, 14.8% at 3,650 meters, and 21.9% at 4,559 meters. The main symptoms of the disease include headache, loss of appetite, nausea, dizziness, fatigue, and insomnia. Although altitude sickness itself is not life-threatening, it can develop into more serious conditions such as high-altitude pulmonary edema (HAPE) and high-altitude cerebral edema (HACE), which can be fatal if not treated promptly. As more and more people travel, work, and exercise at high altitudes, altitude sickness has become a major public health issue. However, the exact pathophysiology of AMS remains poorly understood.

[0003] Studies have shown that genetic factors play an important role in the susceptibility to AMS, and certain genotypes are conducive to rapid adaptation to high-altitude environments. Association studies based on candidate genes have found several single nucleotide polymorphisms (SNPs) sites that are significantly associated with the risk of AMS. The genes associated with these SNPs were mainly divided into the following four categories: (a) hypoxia-inducible factor (HIF) pathway genes, such as EPAS1 (index SNP, rs6756667, rs4953348) and EGLN1 (rs12097901, rs2790859); (b) genes involved in angiogenesis, vascular permeability and vascular smooth muscle relaxation, such as VEGFA (rs3025039), eNOS3 (rs1799983) and EDN1 (rs2070699); (c) heat shock protein (HSP) genes, such as HSPA1A (rs1008438), HSPA1B (rs10661581) and HSPA1L (rs2227956); and (d) genes in the renin-angiotensin system, such as ACE (rs4340) and AGT (rs699). However, the selection of candidate genes is limited by the limited understanding of the physiological mechanisms underlying AMS susceptibility. Furthermore, this approach does not fully explain the overall heritability of AMS.

[0004] So far, there is no research report on the correlation between the polymorphism of genomic region 3q25.1 (RNF13) and the susceptibility to AMS.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The first object of the present invention is to provide a reagent for detecting the SNP site rs1531641 for use in preparing an AMS susceptible population screening product to solve the above technical problems.

[0007] The second object of the present invention is to provide a reagent for screening AMS susceptible population.

[0008] The third object of the present invention is to provide a kit for screening AMS susceptible population.

[0009] The fourth object of the present invention is to provide a device for screening AMS susceptible population.

[0010] In order to achieve the above objectives, the following technical solutions are adopted:

[0011] In a first aspect, the present invention provides the use of a reagent for detecting the SNP site rs1531641 in the preparation of a product for screening an AMS susceptible population.

[0012] As a further technical solution, if the genotype of the SNP site rs1531641 is TT, the population is susceptible to AMS.

[0013] As a further technical solution, the product includes a reagent or a kit.

[0014] In a second aspect, the present invention provides a reagent for screening AMS susceptible populations, comprising primers and / or probes for detecting the SNP site rs1531641.

[0015] As a further technical solution, the nucleic acid sequences of the primers are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0016] As a further technical solution, the nucleic acid sequence of the probe is shown as SEQ ID NO.3 or SEQ ID NO.4.

[0017] As a further technical solution, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;

[0018] The fluorescent reporter group includes FAM or HEX;

[0019] The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2.

[0020] In a third aspect, the present invention provides a kit for screening AMS susceptible populations, comprising the above reagents.

[0021] As a further technical solution, it also includes nucleic acid extraction reagents.

[0022] In a fourth aspect, the present invention provides a device for screening a population susceptible to AMS, comprising a sequencing device, a comparison device, and an analysis device;

[0023] The sequencing device is used for sequencing the sample to be tested including the rs1531641 region;

[0024] The comparison device is used to determine the genotype of rs1531641 according to the result of the sequencing device;

[0025] The analyzing device is used to determine the AMS susceptibility risk according to the result of the comparing device.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] A whole-genome association study found that the genotype TT of the SNP site rs1531641 at 3q25.1 is a susceptible genotype for AMS. By detecting the SNP site rs1531641, it is possible to effectively implement auxiliary screening of people susceptible to AMS, and carry out scientific intervention to specifically reduce the risk of AMS in these susceptible people. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 : Manhattan and quantile plots for genome-wide association studies in population cohorts. DETAILED DESCRIPTION

[0030] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0031] In a first aspect, the present invention provides the use of a reagent for detecting the SNP site rs1531641 in the preparation of a product for screening an AMS susceptible population.

[0032] A genome-wide association study found that the genotype TT of the SNP site rs1531641 at 3q25.1 is a susceptible genotype for AMS. When an individual's rs1531641 shows the genotype TT, it indicates that the individual is more likely to suffer from AMS. In addition, by analyzing the expression quantitative trait loci (eQTL), the protective allele C of rs1531641 was significantly associated with the low expression of the RNF13 gene in blood neutrophil CD16+ (P = 7.42 × 10 -8 ). These results indicate that RNF13 is a major AMS susceptibility candidate gene on chromosome 3q25.1.

[0033] Accordingly, by detecting the SNP site rs1531641, the screening of AMS susceptible population can be effectively achieved. For example, since the present invention confirms that the rs1531641 genotype TT is associated with the susceptibility to AMS, in the prevention and control of the AMS population, it is necessary to carry out rs1531641 genotype detection on the consulted object to determine whether the object carries the AMS susceptible genotype rs1531641TT. For individuals with the genotype rs1531641TT, scientific intervention can be carried out, such as suggesting early therapeutic prevention, etc., so that the risk of AMS in these susceptible populations can be targeted and reduced.

[0034] In some optional embodiments, the product includes a reagent or a kit.

[0035] In a second aspect, the present invention provides a reagent for screening AMS susceptible populations, comprising primers and / or probes for detecting the SNP site rs1531641.

[0036] By detecting the SNP site rs1531641, the reagent can assist in the early prediction of AMS individuals in a short time, at low cost and with high accuracy, providing a theoretical basis for clinical treatment and prognosis assessment.

[0037] In some optional embodiments, the nucleic acid sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2:

[0038] Upstream primer: CCACAGAACTACCTTGTTGGA (SEQ ID NO. 1);

[0039] Downstream primer: CCAGATCCAGAGTTCTAAACTTTGT (SEQ ID NO. 2).

[0040] In some optional embodiments, the nucleic acid sequence of the probe is shown in SEQ ID NO.3 or SEQ ID NO.4:

[0041] ACAGCATCAGCATAACGTGGGATCT(SEQ ID NO.3);

[0042] ACAGCATCAGCATAATGTGGGATCT (SEQ ID NO. 4).

[0043] In some optional embodiments, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;

[0044] The fluorescent reporter group includes but is not limited to FAM or HEX;

[0045] The fluorescence quenching group includes but is not limited to TAMRA, BHQ1 or BHQ2.

[0046] In a third aspect, the present invention provides a kit for screening AMS susceptible populations, comprising the above reagents.

[0047] The kit detects the SNP site rs1531641 to screen people susceptible to AMS.

[0048] In some optional embodiments, a nucleic acid extraction reagent is also included to obtain DNA of the sample to be tested.

[0049] In a fourth aspect, the present invention provides a device for screening a population susceptible to AMS, comprising a sequencing device, a comparison device, and an analysis device;

[0050] The sequencing device is used for sequencing the sample to be tested including the rs1531641 region;

[0051] The comparison device is used to determine the genotype of rs1531641 according to the result of the sequencing device;

[0052] The analyzing device is used to determine the AMS susceptibility risk according to the result of the comparing device.

[0053] In some optional embodiments, the sequencing device is used to sequence a predetermined region in the whole genome of an individual to obtain a sequencing result, wherein the predetermined region is 1Kb upstream and downstream of rs1531641. Thus, sequencing can be performed more efficiently.

[0054] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0055] Example 1 Genome-wide association study of AMS susceptibility

[0056] 1. Materials and methods

[0057] 1.1 Research subjects

[0058] Population Cohort 1: Population Cohort 1 traveled from low altitude to high altitude (4,600 meters above sea level) by train in May 2022, with a total of 226 participants. All participants gave written informed consent after receiving a comprehensive introduction to the details of the study. Socio-demographic information of all participants was collected, and approximately 2 ml of fasting venous blood was drawn from each participant before they ascended the plateau and stored at minus 80 degrees Celsius. On the evening of arrival, each participant filled out the Lake Louise Questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified as the case group, while participants without obvious symptoms were classified as the control group.

[0059] 1.2 Genotyping, quality control, and imputation analysis

[0060] Peripheral whole blood samples were collected from all participants, and genomic DNA was extracted from 1 mL of blood using the QIAamp DNA Blood Kit (Qiagen, Crawley, UK) according to the manufacturer's instructions. DNA quality was assessed by two methods: (1) assessment of DNA degradation and contamination on a 1% agarose gel; and (2) measurement of DNA concentration using the Qubit DNA Assay Kit Qubit 2.0 Fluorometer. Samples were genotyped using the Illumina Infinium Global Screening Array-24v1.0 BeadChip.

[0061] Subsequently, strict quality control of samples and SNPs was performed to ensure the robustness of association tests. Samples with low detection rate (<90%), undetermined sex, close relatives (PI_HAT value greater than 0.2 in PLINK v.1.9), high heterozygosity (greater than 3 standard deviations from the mean), or identified as outliers using principal component analysis were excluded. For SNPs, this study excluded SNPs with genotype detection rate less than 90%, deviation from Hardy-Weinberg equilibrium (control HWE deviation P < 1e-6, case HWE deviation P < 1e-10), minor allele frequency less than 5%, and located on chromosomes XY.

[0062] To improve the coverage of genomic regions, genotyping data were imputed using SHAPEIT (v.4.1.2) and IMPUTE5 (v.1.1.5) using the human genome hg19 and the 1000 Genomes Project data as reference. SNPs with information scores lower than 0.6 or minor allele frequencies lower than 0.01 were excluded.

[0063] 1.3 Association studies

[0064] Genome-wide association analysis was performed using a logistic regression model in PLINK v.1.9, with sex, age, and the first 10 principal components as covariates. A quantile-quantile plot (Q-Qplot) was generated in R (4.3.1) to assess the distribution of P values, and the lambda (λ) inflation factor was assessed to detect whether there were systematic biases. In this study, SNPs with P < 0.05 in population cohort 1 were considered to be significantly different AMS susceptibility SNPs.

[0065] Subsequently, fine-mapping analysis was performed using CAVIAR (v.2.2) and FINEMAP (v.1.3.1). A set of credible SNPs was determined for each locus, defined as the minimum set of variants that contained all causal variants with a certainty greater than 0.95. Subsequently, we used RegulomeDB (V2) and Haploreg to identify potential functional SNPs.

[0066] 2. Results

[0067] 2.1 Whole-genome SNP data quality control results

[0068] To explore the AMS susceptibility region in the Chinese population, the inventors genotyped the SNPs in population cohort 1. After strict quality control (Table 1), 74 cases and 145 controls, as well as 7,010,527 SNPs were retained in population cohort 1.

[0069] Table 1 Quality control process of the population (a) Quality control of population samples:

[0070]

[0071] (b) SNP quality control process:

[0072]

[0073] 2.2 Results of association analysis

[0074] The inventors performed association analysis on population cohort 1 and identified a locus 3q25.1 (P<0.05) that was significantly associated with AMS. In population cohort 1, chromosome 3q25.1 (index SNP rs1531641; odds ratio of C allele OR=0.5264; 95% confidence interval CI=0.3357-0.8253; P=5.16×10 -3 The allele frequencies of the above loci were significantly different between the case group and the control group ( Figure 1 , wherein (a) a Manhattan plot is drawn according to the association results of the population cohort 1 according to an embodiment of the present invention, describing the association statistics of the entire population of the population cohort 1, which are derived from a logistic regression model that takes into account gender, age, and the first 10 principal components; (b) a quantile plot is drawn according to the association results of the population cohort 1 according to the present invention; the inflation factor λ is 1.053; the oblique line segment represents the null hypothesis that there is no real association).

[0075] Example 2 Susceptibility gene location analysis

[0076] To identify potential susceptibility genes at SNPs, this study used five publicly available datasets for eQTL analysis: (1) QTLbase collects genome-wide QTL statistical summaries for many human molecular traits in more than 95 tissues / cell types and under multiple biological conditions. The database includes tens of millions of significant genotype-molecular trait associations under different conditions. (2) Genotype-Tissue Expression Database (GTEx, Release 8), covering 48 tissues (including blood and lung), using whole-genome sequencing to detect SNPs and RNA sequencing to measure mRNA expression levels. (3) ImmuNexUT, covering 9852 immune cell samples from 416 donors, including 10 different immune-mediated diseases and 28 immune cell types from healthy donors. (4) FIVEx, including eQTL and sQTL data from 16 different studies in the EBI eQTL catalog. (5) scQTLbase is a comprehensive portal for human single-cell eQTLs, including 304 datasets for 57 cell types and 95 cell states. It includes about 16 million SNPs associated with gene expression in specific cells and about 690,000 disease-related sc-eQTLs from 3333 traits / diseases. This study only focuses on protein-coding genes within the 1Mb region upstream and downstream of the SNP, and P < 0.001 is considered statistically significant. The gene RNF13 is included in the 1Mb region upstream and downstream of the index SNP rs1531641 site. According to the results of QTLbase2, the protective allele C of rs1531641 is significantly associated with low expression of the RNF13 gene in blood neutrophils CD16+ (P = 7.42×10 -8 ). These results indicate that RNF13 is a prime candidate gene on chromosome 3q25.1.

[0077] RNF13 encodes an E3 ubiquitin protein ligase that regulates cell proliferation and participates in the regulation of apoptosis. There are currently no reports of its association with AMS. The latest studies have shown that it can inhibit lysosomal maturation and enhance TLR-mediated inflammatory responses in macrophage endosomal regions. Combined with previous studies, we speculate that under acute hypoxic conditions, the C allele of rs1531641 may reduce inflammation in the same way, thereby reducing the severity of AMS-related symptoms. In summary, the inventors' association studies and functional studies suggest that the AMS susceptibility genes in the region (3q25.1) where rs1531641 is located include the RNF13 gene. The present invention confirms the association between the genotype TT of rs1531641 and AMS susceptibility. In the prevention and control of the AMS population, the genotype of rs1531641 should be tested for the consulting object in order to conduct scientific intervention and specifically reduce the risk of AMS in these susceptible populations.

[0078] Example 3

[0079] In order to verify the accuracy of using rs1531641 genotype TT to predict AMS susceptible population, the inventors verified population cohort 2.

[0080] Population Cohort 2: Population Cohort 2 took a bus from low altitude to high altitude (4,600 meters above sea level) in May 2023, recruiting a total of 367 participants. All participants gave written informed consent after hearing a comprehensive introduction to the details of the study. Socio-demographic information of all participants was collected, and about 2 ml of fasting venous blood was drawn from each participant before they climbed the plateau and stored at minus 80 degrees Celsius. On the evening of arrival, each participant filled out the Lake Louise Questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 points were classified as case group, while participants without obvious symptoms were classified as control group. After strict quality control (refer to 1.2 of Example 1 for quality control methods), Population Cohort 2 retained 84 cases and 176 controls.

[0081] According to the manufacturer's instructions, peripheral whole blood samples were collected from all participants, and the genotypes of the subjects' rs1531641 locus were tested. The statistical results are shown in Table 2:

[0082] Table 2

[0083]

[0084]

[0085] According to the results in Table 2, the sensitivity, specificity and accuracy of rs1531641 genotype TT in predicting AMS susceptible population were calculated, and the results were as follows:

[0086] Sensitivity: 0.52, specificity: 0.62, accuracy: 0.59.

[0087] It is proved that the present invention has good diagnostic value and can be used for auxiliary diagnosis of AMS susceptible population.

[0088] Example 4

[0089] Design of primers and probes for rs1531641 locus:

[0090] Upstream primer: CCACAGAACTACCTTGTTGGA (SEQ ID NO. 1);

[0091] Downstream primer: CCAGATCCAGAGTTCTAAACTTTGT (SEQ ID NO. 2);

[0092] Probe 1: (FAM) ACAGCATCAGCATAACGTGGGATCT (BHQ1) (SEQ ID NO. 3);

[0093] Probe 2: (HEX)ACAGCATCAGCATAATGTGGGATCT(BHQ1) (SEQ ID NO. 4).

[0094] DNA of subjects with CC and TT genotypes at the SNP site rs1531641 was extracted respectively, and then the DNA was used as a template to perform fluorescence quantitative PCR detection using an amplification system containing the above-mentioned primers and probes (upstream primer, downstream primer, probe 1 and probe 2). The results showed that only a single fluorescence was detected after amplification of the two nucleic acids, indicating that the primers and probes of the present invention can be used for the detection of the rs1531641 site.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of reagents for detecting SNP site rs1531641 in the preparation of AMS susceptible population screening products.

2. The use according to claim 1, characterized in that: If the genotype of SNP site rs1531641 is TT, then the population is susceptible to AMS.

3. The use according to claim 1, characterized in that: The product includes a reagent or a kit.

4. A reagent for screening AMS susceptible population, characterized in that: Includes primers and / or probes for detecting the SNP site rs1531641.

5. The reagent according to claim 4, characterized in that The nucleic acid sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

6. The reagent according to claim 4, characterized in that The nucleic acid sequence of the probe is shown as SEQ ID NO.3 or SEQ ID NO.

4.

7. The reagent according to claim 6, characterized in that The 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group; The fluorescent reporter group includes FAM or HEX; The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2.

8. A kit for screening AMS susceptible population, characterized in that: The invention comprises the reagent according to any one of claims 4 to 7.

9. The kit according to claim 8, characterized in that Also included are nucleic acid extraction reagents.

10. A device for screening AMS susceptible population, characterized in that: Including sequencing device, comparison device and analysis device; The sequencing device is used for sequencing the sample to be tested including the rs1531641 region; The comparison device is used to determine the genotype of rs1531641 according to the result of the sequencing device; The analyzing device is used to determine the AMS susceptibility risk according to the result of the comparing device.

Images