Molecular marker for identifying duck body weight character based on FRYL gene and identification method and application thereof

Abstract

The invention discloses a molecular marker for identifying duck weight traits based on an FRYL gene and an identification method and application thereof, and belongs to the technical field of molecular markers, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, and the 197th basic group of the nucleotide sequence is C or T. The invention further discloses a method for identifying the duck weight traits based on the FRYL gene. If the to-be-detected duck molecular marker type is CC type, the duck body weight character is the best; if the molecular marker type of the duck to be detected is a CT type, the weight character of the duck is medium; if the type of the molecular marker of the duck to be detected is TT type, the weight character of the duck is poor. By identifying the type of the molecular marker in the duck genome, the weight character of the duck can be selected according to the genotype, a breeding method for poultry weight early selection is established, and the method is simple, rapid and low in cost, does not need special instruments, and is suitable for the needs of molecular marker assisted breeding experiments.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to a molecular marker for identifying duck body weight traits based on a FRYL gene, and an identification method and application thereof. Background Art

[0002] Weight is an important indicator to measure the uniformity of poultry groups, and it is also a key factor that determines feed consumption and affects production costs. With the improvement of people's living standards, the demand for duck meat, eggs and other foods is also increasing, and consumers tend to prefer products with larger weight and better meat quality. Therefore, increasing the weight of meat ducks will help meet market demand and improve product competitiveness. Select poultry with excellent growth performance and body shape characteristics as the source. By continuously optimizing genetic combinations and cultivating new varieties, the stable growth of meat duck weight and performance improvement can be achieved, thereby shortening the breeding cycle, reducing breeding costs, and improving production efficiency.

[0003] The FRY-like transcriptional coactivator (FRYL) gene located on duck chromosome 4 is a paralog of the FRY microtubule-binding protein (Fry) in vertebrates. Zhang et al. showed through genome-wide association studies that FRYL is an important candidate gene affecting Jinling White Duck BW7 (7-week body weight). (ZHANG Y, JIA C, LI S, et al. Comparative genome-wide association study on body weight in Chinese native ducks using four models [J]. Poult Sci, 2024, 103 (8): 103899.). In the growth and development of chickens, studies have found that FRYL (FRY-like transcriptional coactivator) and SGCB (sarcoglycan β) are both related to chicken growth. (ZHANG GX, FAN QC, ZHANG T, et al. Genome-wide association study of growth traits in the Jinghai Yellow chicken [J]. Genetics and molecular research: GMR, 2015, 14 (4): 15331-8.). Tarsani et al. applied functional enrichment analysis and found that FRYL is a potential candidate gene affecting broiler body weight, indicating its importance in chicken growth (TARSANI E, KRANIS A, MANIATIS G, et al. Discovery and characterization of functional modules associated with body weight in broilers [J]. Scientific reports, 2019, 9 (1): 9125.). Liu et al. sequenced the whole genome of 193 sheep from two Tibetan sheep breeds (PT and ZS) by identifying SNPs and candidate genes associated with body shape traits, and conducted GWAS studies on eight phenotypes related to body shape using four models. Enrichment analysis showed that FRYL is involved in growth and development-related pathways and may help regulate the body shape of Tibetan antelopes (LIU D, LI X, WANG L, et al. Genome-wide association studies of body size traits in Tibetan sheep [J]. BMC Genomics, 2024, 25 (1): 739.).

[0004] At present, the research on FRYL gene is mainly focused on the growth and development of chickens, while the research on ducks is relatively rare. In-depth study of the relationship between FRYL gene variation and expression and meat duck weight will help reveal that its gene plays a key role in the growth and development of meat ducks. It is expected to provide theoretical support for the precise regulation of meat duck growth and development, and provide a scientific basis for meat duck breeding. Based on the above content, a molecular marker for identifying duck weight traits based on FRYL gene and its identification method and application are proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker for identifying duck weight traits based on the FRYL gene, and an identification method and application thereof, and to develop SNP (single nucleotide polymorphism) molecular markers for candidate genes (FRYL genes) related to duck weight traits, which can solve the problem of slow progress in conventional phenotypic breeding and realize early identification of weight traits.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0007] As a first aspect of the present invention, a molecular marker for identifying duck body weight traits based on the FRYL gene is provided, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 197th base of the nucleotide sequence is C or T.

[0008] As a second aspect of the present invention, there is also provided an application of the molecular marker as described above in identifying the body weight trait of ducks.

[0009] As a further optimization scheme of the present invention, if the molecular marker type of the duck to be tested is CC type, the weight trait of the duck is the best;

[0010] If the molecular marker type of the duck to be tested is CT type, the weight trait of the duck is medium;

[0011] If the molecular marker type of the duck to be tested is TT type, the weight trait of the duck is poor.

[0012] As a third aspect of the present invention, a method for identifying the weight trait of a duck using the molecular markers as described above is also provided, comprising the following steps:

[0013] (1) Extract total DNA from duck wing vein blood;

[0014] (2) designing specific amplification primers based on the sequence of the site where the molecular marker is located and its upstream and downstream bases as the target sequence, using the total DNA as a template, and performing PCR amplification using the specific amplification primers to obtain an amplified product;

[0015] (3) performing genotyping detection and sequencing on the amplified products to obtain the molecular marker type of the duck to be tested;

[0016] (4) Determine the weight traits of ducks based on the type of molecular markers.

[0017] As a further optimization scheme of the present invention, the method of genotyping detection is to obtain a digestion product by digesting the amplified product, detect the digestion product by agarose gel electrophoresis, and perform genotyping according to the image. If the digestion product:

[0018] If it contains 1 band, it is CC type;

[0019] If it contains 2 strips, it is TT type;

[0020] If it contains 3 bands, it is CT type.

[0021] As a further optimization scheme of the present invention, the amplified product is digested with XCMI restriction endonuclease.

[0022] The beneficial effects of the present invention are as follows: based on the study of the relationship between the FRYL gene and the weight trait of ducks, the present invention develops a molecular marker, by identifying the type of the molecular marker present in the duck genome, the weight trait of the duck can be selected according to the genotype, and a breeding method for early selection of poultry weight rate is established. The method is simple, fast, low-cost, does not require special instruments, and is suitable for the needs of molecular marker-assisted breeding experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Agarose gel electrophoresis diagram of PCR amplification products of some samples provided by the present invention;

[0024] Figure 2 The agarose gel electrophoresis diagram of the enzyme digestion products obtained by enzyme digestion of some samples provided by the present invention;

[0025] Figure 3 The present invention provides the genotype verification sequencing result of the C183627302T site (the 197th site in SEQ ID NO.1) in the duck FRYL gene. DETAILED DESCRIPTION

[0026] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0027] 1. Materials

[0028] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0029] 2. Methods

[0030] 2.1 Primer design

[0031] The DNA sequence corresponding to the FRYL gene shown in SEQ ID NO.1 was found from the duck genome database, and the partial DNA sequence of the FRYL gene (the sequence of the site where the molecular marker is located and its upstream and downstream bases) was used as a template to design specific amplification primers. The sequence information of the specific amplification primers is as follows:

[0032] SEQ ID NO.2: Forward primer: TGTTCCTCTTGTGTTTTAGT;

[0033] SEQ ID NO.3: Reverse primer: TGAAAGGTGCTCAATAATAG.

[0034] The length of the amplifiable region of the primer is 433 bp, and the sequence information is shown in SEQ ID NO.4, which includes a molecular marker for a T / C site mutation at the C49474125T site (corresponding to the 197th site in SEQ ID NO.1).

[0035] 2.2 Extraction of total blood DNA

[0036] 420 Qiangying ducks were selected, blood was collected from the wing vein, and total blood DNA was extracted. The blood DNA extraction kit produced by Tiangen Biotechnology Co., Ltd. was used to extract total DNA from the duck wing vein blood samples. The extraction steps were carried out according to the kit instructions.

[0037] 2.3 PCR amplification

[0038] Mix produced by Shanghai Yisheng Biological Company was used to perform PCR amplification reaction on the target fragment of FRYL gene through synthesized specific amplification primers. The PCR amplification system is shown in Table 1:

[0039] Table 1. PCR amplification system

[0040]

[0041] PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; first step denaturation at 95°C for 45 s; second step annealing at 64.8°C for 45 s (annealing temperature was set according to primers); third step extension at 72°C for 30 s, wherein the second to third steps were cycled 31 times, for a total of 32 cycles; and extension at 72°C for 10 min.

[0042] 2.4. PCR amplification product detection and sequencing

[0043] The PCR amplification products were detected by 2% agarose gel electrophoresis. Figure 1 As shown, after imaging with a gel imager, a band of approximately 433 bp in length was obtained, which was consistent with the predicted length, indicating that the target fragment was obtained. The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. (Nanjing), and the sequence was shown in SEQ ID NO.4, which was consistent with the predicted result.

[0044] 2.5 Genotyping

[0045] First, the enzyme digestion system shown in Table 2 was prepared, and the digestion conditions were 37° C. water bath for 1 hour, and the PCR amplification product was digested with XCMI restriction endonuclease purchased from NEB (Beijing) Co., Ltd.

[0046] Table 2. Enzyme digestion system

[0047]

[0048]

[0049] Subsequently, 1.5% mass ratio low voltage agarose gel electrophoresis was used to obtain Figure 2 The results shown (partial results); among them, if the enzyme digestion product: contains 1 band, it is CC type; contains 2 bands, it is TT type; contains 3 bands, it is CT type.

[0050] 2.6. Enzyme Digestion and Sequencing Verification

[0051] The agarose gel electrophoresis diagram of gene restriction typing was statistically analyzed to obtain three types of CC, TT, and CT. One individual was selected for each of the three types for sequencing comparison. The sequencing comparison diagram is shown in Figure 3 As shown, in the sequencing result, T mutated into C, and the arrow marked the mutation position, which was consistent with the enzyme digestion typing result.

[0052] 2.7 Effect Verification

[0053] In order to determine the association between the T / C polymorphism of the C49474125T site of the duck FRYL gene and important phenotypic traits of ducks, the 420 Qiangying ducks in step 2.2 were used as experimental materials, and the weight on day 1 (BW1), weight on day 21 (BW2) and weight on day 31 (BW3) of the ducks aged 1 to 42 days were counted. 21 ), 42-day-old body weight (BW 42 ), 21 days of age daily gain (ADG 21 ) and daily weight gain (ADG 42 ). Using the genotyping method shown in step 2.5, 420 Qiangying ducks were genotyped, and the results are shown in Table 3.

[0054] Table 3. Genotype test results of individuals with different phenotypes

[0055]

[0056] Experimental conclusion: The chi-square test results showed that the genotype of the experimental duck population was in Hardy-Weinberg equilibrium (P>0.05).

[0057] 2.8 Statistical Analysis

[0058] The association between the three genotypes and the weight traits of ducks was analyzed using the least squares analysis method in SAS9.4 software. The results of the association analysis between different genotypes and each trait are shown in Table 4.

[0059] Table 4. Association analysis between duck FRYL genotype and duck body weight traits

[0060]

[0061] Note: Different lowercase letters in the same row indicate significant differences (P<0.05), and different uppercase letters in the same row indicate extremely significant differences (P<0.01).

[0062] Experimental conclusion: From Table 4, we can see that for the FRYL gene C49474125T site, the 21-day-old body weight (BW 21 ), 42-day-old body weight (BW 42 ) and daily weight gain (ADG) at 21 days of age 21 ) were significantly higher than those of TT individuals, and the daily weight gain (ADG 42 ) was significantly higher than that of TT genotype individuals. There was no significant difference in the body weight at day 1 (BW1) among the three genotypes, which showed that the body weight trait of CC genotype individuals was the best, that of CT genotype individuals was medium, and that of TT genotype individuals was poor.

[0063] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A molecular marker for identifying duck weight traits based on the FRYL gene, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 197th base of the nucleotide sequence is C or T.

2. Use of the molecular marker as claimed in claim 1 in identifying the weight trait of ducks.

3. The use according to claim 2, characterized in that: If the molecular marker type of the duck to be tested is CC type, the weight trait of this duck is the best; If the molecular marker type of the duck to be tested is CT type, the weight trait of the duck is medium; If the molecular marker type of the duck to be tested is TT type, the weight trait of the duck is poor.

4. A method for identifying the weight trait of ducks using the molecular marker according to claim 1, characterized in that: The following steps are involved: (1) Extract total DNA from duck wing vein blood; (2) designing specific amplification primers based on the sequence of the site where the molecular marker is located and its upstream and downstream bases as the target sequence, using the total DNA as a template, and performing PCR amplification using the specific amplification primers to obtain an amplified product; (3) performing genotyping detection and sequencing on the amplified products to obtain the molecular marker type of the duck to be tested; (4) Determine the weight traits of ducks based on the type of molecular markers.

5. The method for identifying duck weight traits using molecular markers according to claim 4, characterized in that: The sequence of the specific amplification primer is: SEQ ID NO.2: Forward primer: TGTTCCTCTTGTGTTTTAGT; SEQ ID NO.3: Reverse primer: TGAAAGGTGCTCAATAATAG.

6. The method for identifying duck weight traits using molecular markers according to claim 4, characterized in that: The genotyping detection method is to obtain a digestion product by digesting the amplified product, detect the digestion product by agarose gel electrophoresis, and perform genotyping based on the image. If the digestion product: If it contains 1 band, it is CC type; If it contains 2 strips, it is TT type; If it contains 3 bands, it is CT type.

7. The method for identifying duck body weight traits using molecular markers according to claim 6, characterized in that: The amplified product was digested with XCMI restriction endonuclease.

Images