Molecular marker related to acetoin content in pig muscle and application of molecular marker

Abstract

The invention belongs to the technical field of determination or inspection methods of enzymes, nucleic acids or microorganisms, and relates to a molecular marker related to the acetoin content in pig muscles and application of the molecular marker. The technical problem to be solved by the invention is to provide a molecular marker related to the acetoin content in pig muscle. In order to solve the technical problem, the invention provides a molecular marker obtained through genome-wide association (GWAS) analysis, namely an SNP site, the SNP site is an SNP in a pig genome and is the 270th nucleotide of SEQ ID NO: 1, the nucleotide variety is A or G, and the SNP site is a nucleotide of SEQ ID NO: 1. The SNP can be used for detection or auxiliary detection of acetoin content, detection or auxiliary detection of SNP polymorphism or genotype or pig breeding. By detecting the genotype of a to-be-detected pig at the SNP site, the content of acetoin in pig muscle can be selected at an early stage.

Description

Technical Field

[0001] The invention belongs to the technical field of determination or inspection methods of enzymes, nucleic acids or microorganisms, and specifically relates to a molecular marker related to the acetoin content in pig muscle and an application thereof. Background Art

[0002] Meat is a food with high edible value. With the improvement of living standards, people have higher and higher requirements for meat quality. The evaluation of meat quality is multifaceted, including its sensory quality and nutritional value. Among them, the flavor substances in meat directly determine the smell, taste and overall edible quality of meat, and are important indicators that affect consumer choice. The main source of pork flavor is the volatile compounds in meat. Volatile compounds naturally present in pork, such as ketones, aldehydes and alcohols, are the basis for the original flavor of pork and can give pork a unique aroma.

[0003] The content of acetoin in pork will have a certain effect on the flavor, mainly by inhibiting fat oxidation and thus affecting the flavor. It plays a very important role in maintaining the natural flavor of pork, especially maintaining the aroma of meat during storage and avoiding rancid odor. If the acetoin content in meat is insufficient, fat oxidation will be significantly accelerated. The odorous substances generated by fat oxidation will cover the original aroma of the meat. The oxidation reaction destroys certain unsaturated fatty acids in the meat, resulting in a reduction in umami molecules. At present, molecular marker-assisted breeding technology has been widely used in the breeding of new varieties in the livestock and poultry field, and molecular markers closely related to the target traits can be obtained through whole genome association analysis. The use of molecular markers for early selection of target traits can greatly save breeding costs and accelerate genetic progress. However, there are currently no molecular markers related to the acetoin content in pork. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a molecular marker related to the acetoin content in pig muscle. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions: The present invention provides any of the following uses of a substance for detecting the polymorphism or genotype of a SNP site in a pig genome: A1) Application of a substance for detecting the polymorphism or genotype of a SNP site in the pig genome in detecting or assisting in detecting the acetoin content; A2) Use of a substance for detecting the polymorphism or genotype of a SNP site in a pig genome in detecting or assisting in detecting the polymorphism or genotype of a SNP; A3) Application of materials for detecting polymorphism or genotype of SNP sites in pig genome in pig breeding; A4) Use of a substance for detecting the polymorphism or genotype of a SNP site in the pig genome in the preparation of a product for detecting or assisting in detecting the content of acetoin; A5) Use of a substance for detecting the polymorphism or genotype of a SNP site in the pig genome in the preparation of a product for detecting or assisting in detecting the polymorphism or genotype of a SNP; A6) Use of a substance for detecting polymorphism or genotype of a SNP site in the pig genome in the preparation of a pig breeding product; The SNP site is a SNP in the pig genome, which is the 270th nucleotide of SEQ ID NO: 1, and its nucleotide type is A or G.

[0006] The SNP is also located at nucleotide position 29962358 on chromosome 6 of the pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to nucleotide position 270 of the nucleotide sequence SEQ ID NO: 1).

[0007] Those skilled in the art know that SEQ ID NO: 1 is composed of the SNP site (nucleotide No. 270 of SEQ ID NO: 1) and the nucleotide sequence in its vicinity, and the amount of the nucleotide sequence in the vicinity of the SNP site should not be used as a limiting factor for the scope of protection of the present invention. It can be 25 bp, 50 bp, 70 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of the SNP on chromosome 6 of the pig genome.

[0008] The front and back mentioned herein should be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0009] The present invention also provides a method for detecting or assisting in detecting the content of acetoin, comprising the following steps: detecting the genotype of the aforementioned SNP site in the pig to be tested, and detecting or assisting in detecting the content of acetoin according to the genotype.

[0010] In the above-mentioned method for detecting or assisting in detecting the acetoin content, the relative acetoin content of the pig to be tested whose SNP genotype is GG is significantly higher than that of the pig to be tested whose genotypes are GA and AA, and the relative acetoin content of the pig to be tested whose genotype is GA is significantly higher than that of the pig to be tested whose genotype is AA; the GG is the homozygous type of the SNP site being G, the GA is the heterozygous type of the SNP site being G and A, and the AA is the homozygous type of the SNP site being A.

[0011] In the above application or method, the detection or auxiliary detection of acetoin content can specifically be the detection of acetoin content in the longissimus dorsi muscle of pigs.

[0012] In the above method, a partial region of the pig genome containing the aforementioned SNP can be amplified by PCR, such as sequencing the PCR product containing SEQ ID NO: 1, detecting the type of the 270th deoxyribonucleotide of SEQ ID NO: 1, and detecting the genotype of the SNP site in the pig genome to be tested.

[0013] The present invention also provides a method for pig breeding, which comprises detecting the genotype of the aforementioned SNP site in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is GG as a parent for breeding, wherein GG is a homozygous type of the SNP site being G.

[0014] The present invention also provides a product, which contains the aforementioned substance, and the product is any one of the following: B1) Products used for the preparation or auxiliary detection of acetoin content; B2) Products used to detect or assist in detecting the polymorphism or genotype of SNPs; B3) Products for pig breeding.

[0015] In the above products, the substance is any of the following: C1) the substance is a primer composition for amplifying a pig genomic DNA fragment including the SNP site; C2) the substance is a PCR reagent containing the primer combination described in C1); C3) The substance is a kit containing the primer composition described in C1) or the PCR reagent described in C2).

[0016] The kit may also include conventional reagents for PCR amplification. The kit may also include conventional reagents for sequencing.

[0017] In the above product, the primer composition is any one of F1)-F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence list and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence list; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 24 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 388 to 411 of SEQ ID NO: 1 in the sequence listing; F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 after one or several nucleotides are substituted and / or deleted and / or added, and a single-stranded DNA having the same function as SEQ ID NO: 3 after one or several nucleotides are substituted and / or deleted and / or added.

[0018] The invention also provides application of the above product in pig breeding.

[0019] The present invention also provides a DNA molecule, one chain of which is SEQ ID NO:1.

[0020] The present invention also provides an application, any of the following applications of the aforementioned DNA molecule: N1) Use of the aforementioned DNA molecules in detecting or assisting in detecting the content of acetoin; N2) Use of the aforementioned DNA molecules in detecting or assisting in detecting the polymorphism or genotype of SNPs; N3) Application of the aforementioned DNA molecules in pig breeding; N4) Use of the aforementioned DNA molecules in the preparation of products for detecting or assisting in the detection of acetoin content; N5) Use of the aforementioned DNA molecules in the preparation of products for detecting or assisting in detecting the polymorphism or genotype of SNPs; N6) Use of the aforementioned DNA molecule in the preparation of pig breeding products.

[0021] The present invention also protects the application of any of the above methods in breeding.

[0022] The present invention also protects the application of the specific primer in breeding.

[0023] The present invention also protects the use of the kit in breeding.

[0024] Herein, any of the above breeding is pig breeding.

[0025] Herein, the purpose of the breeding is to select individuals with high acetoin content in the longissimus dorsi muscle. The individuals with high acetoin content in the longissimus dorsi muscle are individuals whose SNP genotype is GG genotype.

[0026] Herein, the purpose of the breeding is to select a population with a high acetoin content in the longissimus dorsi muscle.

[0027] Herein, the purpose of the breeding is to select varieties with high acetoin content in the longissimus dorsi muscle.

[0028] Herein, the purpose of the breeding is to eliminate individuals whose genotypes of the SNP site are AA genotype and GA genotype.

[0029] In the breeding, individuals with the GG genotype are retained.

[0030] Any of the above-mentioned pigs refers to all pig breeds.

[0031] The beneficial effects of the present invention are as follows: the SNP molecular marker of the present invention is related to the acetoin content trait of the longissimus dorsi muscle of pigs, and is a new molecular marker. By determining the genotype of the SNP site of the pig to be tested, early selection is performed for the acetoin content trait of the longissimus dorsi muscle of pigs, which can save production costs, improve meat quality and flavor, and accelerate genetic progress, better serve pig breeding, and has great economic application value and scientific research value. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] The following examples used GraphPad Prism 8 statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference.

[0035] Example 1: Determination of the correlation between specific SNP and acetoin content in longissimus dorsi muscle Experimental animals: Landrace pigs, Large White pigs, and Sanyuan pigs, all from COFCO Jiajiankang (Chifeng) Co., Ltd.

[0036] 1. Determination of acetoin content in the longissimus dorsi muscle The pigs were fed under the same feeding conditions for 180 days, and 521 pigs in good health were randomly selected. 10 g of longissimus dorsi muscle samples were collected and frozen in liquid nitrogen.

[0037] Pretreatment of samples: uniformly sample the sample, accurately weigh 3.0 g and put it into the headspace bottle, add 10 μL of internal standard 2-methyl-3-heptanone solution (where the content of 2-methyl-3-heptanone is 10 ug / mL), tighten the bottle cap and wait for the test. Preparation method of internal standard 2-methyl-3-heptanone solution: weigh 1 mg of 2-methyl-3-heptanone (Cat. No.: 103128-5g; CAS No.: 13019-20-0), add methanol to 100 mL, and ultrasonicate for 30 min to ensure complete dissolution.

[0038] Instruments and equipment: automatic sampler, gas chromatography, mass spectrometry, olfactometer, headspace solid phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm id × 0.25 µm).

[0039] The relative content of acetoin Ca = (Sa / Sis)×(Cis×Vis / m)×1000.

[0040] In the above formula: Ca is the relative content of volatile compound acetoin in the sample, expressed in micrograms per kilogram (μg / kg); Sa is the peak area of ​​acetoin, a volatile compound in the sample; Sis is the peak area of ​​the internal standard 2-methyl-3-heptanone in the sample; Cis is the concentration of the internal standard 2-methyl-3-heptanone, expressed in micrograms per milliliter (μg / mL); Vis is the volume of the internal standard 2-methyl-3-heptanone, in milliliters (mL); m is the sample mass in grams (g); 1000: coefficient for converting μg / g to μg / kg; The retention time of acetoin was 19.691±0.1 min.

[0041]

[0042]

[0043] 2. Detection of SNP Molecular Markers 1. Blood sample collection: Collect blood from the pig wing vein to be tested using a sodium heparin anticoagulation blood collection tube and store it at -20℃ for later use.

[0044] 2. Whole blood genomic DNA extraction: The specific operation method refers to the instructions of the blood genomic DNA extraction kit (Tian Gen, DP319).

[0045] 3. Genotyping: The genomic DNA of each pig to be tested was taken and the whole genome individual resequencing was performed using the HiSeq X-Ten sequencing platform of Illumina. The sequencing depth of each individual was about 5×. The specific method was referred to the standard operating procedures provided by Illumina. After the data was quality controlled, the two bioinformatics softwares BWA and GATK were used for sequence alignment and genotype extraction.

[0046] 3. Genome-wide association analysis of acetoin in the longissimus dorsi muscle The genome-wide association analysis of acetoin and genotype in the longissimus dorsi muscle was statistically analyzed using the compressed mixed linear model of EMMAX software. A SNP significantly associated with the acetoin trait was found, namely the 29962358th nucleotide of chromosome 6, so the SNP was named "Chr6: 29962358 site SNP", that is, the 29962358th nucleotide on chromosome 6 of the pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to the 270th nucleotide of the nucleotide sequence SEQ ID NO:1), and the multiple nucleotide types of the SNP are G / A. For simplicity, it is subsequently called a specific SNP.

[0047] A pair of primers consisting of F and R were designed based on the specific SNP. The target sequence of F and R in the pig genomic DNA was 411 bp, and the specific SNP was located at the 270th nucleotide of the target sequence.

[0048] F (SEQ ID NO:2): 5'-TTCCTCCAGGCTTGAGCAGAATAT-3'; R (SEQ ID NO:3): 5'-TACCCACAGAGACGCCTGCACTCC-3'.

[0049] It can be seen that the genotype of the pig to be tested can be defined according to the following rules: GG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains only a DNA fragment whose nucleotide sequence is SEQ ID NO:1 and the 270th nucleotide of SEQ ID NO:1 is G, and does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO:1 and the 270th nucleotide of SEQ ID NO:1 is A, then the aforementioned SNP genotype of the pig to be tested is GG.

[0050] AA genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO:1 and the 270th nucleotide of SEQ ID NO:1 is G, and only contains a DNA fragment whose nucleotide sequence is SEQ ID NO:1 and the 270th nucleotide of SEQ ID NO:1 is A, then the aforementioned SNP genotype of the pig to be tested is AA.

[0051] AG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains both a DNA fragment whose nucleotide sequence is SEQ ID NO:1 and the 270th nucleotide of SEQ ID NO:1 is A, and a DNA fragment whose nucleotide sequence is SEQ ID NO:1 and the 270th nucleotide of SEQ ID NO:1 is G, then the aforementioned SNP genotype of the pig to be tested is AG.

[0052] Example 2: Application of specific SNP in genetic improvement of acetoin content in longissimus dorsi muscle of pigs Experimental animals: 476 Landrace pigs, Large White pigs, and Sanyuan pigs, sourced from COFCO Jiajiankang (Chifeng) Co., Ltd.

[0053] 1. Detection based on genotype of specific SNP loci 1. Blood sample collection The wing vein blood of the experimental animals was collected using a sodium heparin anticoagulation blood collection tube and stored at -20°C for later use.

[0054] 2. Extraction of genomic DNA Take the venous blood obtained in step 1 and extract genomic DNA.

[0055] 3. Genotype detection The genomic DNA obtained in step 2 is used as a template, and a primer pair consisting of F and R is used for PCR amplification, and then the PCR amplification product is sequenced.

[0056] The results showed that a PCR amplification product of 411 bp was obtained from all 476 experimental animals.

[0057] According to the definition rules of genotype in Example 1, 476 test animals were divided into three genotypes, AA genotype (30 test animals), GA genotype (192 test animals) and GG genotype (254 test animals).

[0058] 2. Determination of acetoin content in the longissimus dorsi muscle 2-Methyl-3-heptanone: purchased from Sigma-Aldrich, product number 103128-5g.

[0059] Preparation method of 10 ug / mL 2-methyl-3-heptanone solution: weigh 1 mg of 2-methyl-3-heptanone, add methanol to make up to 100 mL, and ultrasonicate for 30 min to ensure complete dissolution.

[0060] The pigs were fed under the same feeding conditions until 180 days. 476 pigs in good health were randomly selected, and 10 g of longissimus dorsi muscle samples were collected and frozen in liquid nitrogen.

[0061] Pre-treatment of samples: uniformly sample the sample, accurately weigh 3.0 g and put it into a headspace bottle, add 10 uL of the prepared 10ug / mL internal standard 2-methyl-3-heptanone solution, tighten the bottle cap and wait for testing.

[0062] Instruments and equipment: automatic sampler, gas chromatography, mass spectrometry, olfactometer, headspace solid phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm id × 0.25 µm).

[0063] The conditions of solid phase microextraction and gas chromatography-mass spectrometry are shown in Table 1 and Table 2. The results in Table 3 show that the relative content of acetoin in the three genotype pigs is significantly different (P < 0.001), the relative content of acetoin in the GG genotype pigs is higher than that in the GA genotype pigs (P < 0.001) and AA genotype pigs (P < 0.001), and the relative content of acetoin in the GA genotype pigs is higher than that in the AA genotype pigs.

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] SEQ ID NO:1 5'-TTCCTCCAGGCTTGAGCAGAATATGGTGGCAAAGGGTGACATTCTCATGCCGGGGGCGCCGAAGGGGCTTGGGGGATGTAGCGAGGAGCAGAATCCAGGGCTTCTTTCAGCAGCTTTCTGCTTCCCCTCCCCTCTCTTCCTTCCCCTCCTCTCCCCTCCTCCATCCTTTTAAATACCAAGCATCTCCTCATCTCCAAGTCCCTT TGGTCTTCACAGTTCGTGGAGCCGGTAATGTCTTCTATTTTGCAGATAAGAACATAGTGGTTCRCGTTTTAGGGAAGTGGCCGAGCTGGGATCTGAACCCAGGCTGAGTTGAGCCTCTGACTCCATCTTTGGGCCTCTCCCATCTAGTCAGAGTCTCGGTGGGGTGTATTCGGGCAGGACAGGAGTGCAGGCGTCTCTGTGGGTA-3'.

[0078] The R is A or G.

[0079] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 270th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G. The application is any of the following: A1) Use of the substance in detecting or assisting in detecting the content of acetoin; A2) Use of the substance in detecting or assisting in detecting the polymorphism or genotype of SNP; A3) Use of the substance in pig breeding; A4) Use of the substance in the preparation of a product for detecting or assisting in the detection of acetoin content; A5) Use of the substance in the preparation of a product for detecting or assisting in detecting the polymorphism or genotype of a SNP; A6) Use of the substance in the preparation of products for pig breeding.

2. The use according to claim 1, characterized in that: The substance is any of the following: C1) a primer composition for amplifying a pig genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit comprising the primer combination described in C1) or the PCR reagent described in C2).

3. The use according to claim 2, characterized in that: The primer composition is any one of F1)-F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence list and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence list; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 24 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 388 to 411 of SEQ ID NO: 1 in the sequence listing; F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 after one or several nucleotides are substituted and / or deleted and / or added, and a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 3 after one or several nucleotides are substituted and / or deleted and / or added.

4. A method for detecting or assisting in detecting the content of acetoin, characterized in that: The method comprises the following steps: detecting the genotype of the SNP site in claim 1 in the pig to be tested, and detecting or assisting in detecting the acetoin content according to the genotype.

5. A method for pig breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is GG as a parent for breeding.

6. A product containing a substance for detecting the polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 270th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G; the product is any one of the following: B1) Products used for the preparation or auxiliary detection of acetoin content; B2) Products used to detect or assist in detecting the polymorphism or genotype of SNPs; B3) Products for pig breeding.

7. The product according to claim 6, characterized in that The substance is any of the following: C1) a primer composition for amplifying a pig genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit comprising the primer combination described in C1) or the PCR reagent described in C2).

8. Use of a product containing a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 270th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G; the application is the application of the product in pig breeding.

9. A DNA molecule, characterized in that The nucleotide sequence of one chain of the DNA molecule is SEQ ID NO:

1.

10. Use of DNA molecules, characterized in that The nucleotide sequence of one strand of the DNA molecule is SEQ ID NO: 1, and the application is any one of the following: N1) Use of the DNA molecule in detecting or assisting in detecting the content of acetoin; N2) Use of the DNA molecule in detecting or assisting in detecting the polymorphism or genotype of a SNP; N3) Application of the DNA molecule in pig breeding; N4) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting the content of acetoin; N5) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting the polymorphism or genotype of a SNP; N6) Use of the DNA molecule in the preparation of pig breeding products.

Images