Reference gene for gene expression of various tissue of salix cheilophila under nitrogen form treatment and application of reference gene

Abstract

The invention discloses a reference gene for gene expression of each tissue of salix cheilophila under nitrogen form treatment and application of the reference gene. Through stability evaluation software of three reference genes, namely geNorm, NormFinder and BestKeeper, the stability of 13 candidate reference genes of salix cheilophila is systematically evaluated, and an alpha TUB / EF1 alpha or alpha TUB / EF beta combination is determined to be an optimal reference gene suitable for real-time fluorescent quantitative PCR expression analysis of various tissues of salix cheilophila under different nitrogen form treatment through comprehensive analysis. The specificity and the stability of the reference gene primer are verified by further analyzing the expression quantity of the dustpan ammonium transporter SsAMT1 gene relative to the reference gene in roots, stems and leaves under the treatment of different nitrogen forms. The application of the invention is beneficial for improving the accuracy and reliability of root, stem and leaf gene quantitative expression research under different nitrogen form treatment of salix chensinensis.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology, and in particular relates to an internal reference gene for gene expression of various tissues of Willow of Safflower under nitrogen form treatment and application thereof. Background Art

[0002] Nitrogen (N) is a key element in the composition of nucleotides and proteins and plays an important role in plant growth and development. Plants mainly absorb inorganic nitrogen from the soil, including ammonium nitrogen (NH4 + ) and nitrate nitrogen (NO3 - ) to meet their growth needs, and show different response patterns to these nitrogen sources (Xu, G., Fan, X., and Miller, AJ (2012). Plant nitrogen assimilation and use efficiency. Annu Rev Plant Biol 63, 153-182.).

[0003] Willow is considered to be a nitrogen efficient plant because it effectively allocates and utilizes nitrogen in its growth cycle over many years. However, existing research results on willow nitrogen demand are contradictory (Hangs, RD, Schoenau, JJ, Van Rees, KC, Bélanger, N., Volk, T., and Jensen, TJBr (2014). First rotation biomass production and nutrient cycling within short-rotation coppice willow plantations in Saskatchewan, Canada. Bioenerg Res. 7, 1091-1111.). In willow agricultural planting, it is usually necessary to apply a large amount of nitrogen fertilizer to improve productivity. For example, Ireland recommends applying 120-150 kg of nitrogen fertilizer per hectare per year (Caslin B FJ, McCracken A. (2015). Short rotation coppice willow best practice guidelines.), and the United States recommends applying 112 kg of nitrogen fertilizer per hectare in the spring after felling (Abrahamson, L., Volk, T., F., KR, White, E., and Ballard, J. (2002). Willow biomass producer's handbook.). Therefore, studying the nitrogen absorption and utilization process of willow is of great significance for determining whether it is a nitrogen-efficient crop.

[0004] Suchowensis is a shrub belonging to the Salicaceae family. It has the advantages of rapid growth, strong adaptability and strong regeneration ability after pruning. At the same time, its genome information is complete and its genetic background is simple. It is an ideal model for studying the gene function of willow plants (Karp, A., Hanley, SJ, Trybush, SO, Macalpine, W., Pei, M., and Shield, I. (2011). Genetic improvement of willow for bioenergy and biofuels. J Integr Plant Biol 53, 151-165; Dai, X., Hu, Q., Cai, Q., Feng, K., Ye, N., Tuskan, GA, Milne, R., Chen, Y., Wan, Z., Wang, Z., et al. (2014). The willow genome and divergent evolution from poplar after the common genome duplication. Cell Res 24, 1274-1277.).

[0005] Gene expression pattern analysis is an important method to reveal gene function, and real-time quantitative PCR (RT-qPCR) is an effective tool for accurately determining the relative expression level of genes. Selecting appropriate reference genes can significantly reduce experimental errors in RT-qPCR, thereby improving the reliability of the results (Bustin, SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29, 23–39.). Housekeeping genes are usually used as reference genes, and they are basically stably expressed in cells. The expression of ideal reference genes should be consistent in different tissues, developmental stages and environmental conditions. Studies have shown that ACT and DnaJ genes are stably expressed in male and female flowers of Salix suchowensis, and are ideal reference genes for willow development research (Zhou F, Chen Y, Wu H, et al. (2022). A selection of reliable reference genes for gene expression analysis in the female and male flowers of Salix suchowensis. Plants, 11 (5): 647.). However, reference genes are not universal and cannot guarantee stable expression in different species and experimental conditions. Therefore, selecting appropriate reference genes under specific conditions is the key to accurately analyzing gene expression levels using RT-qPCR (Guénin, S. et al. (2009) Normalization of RT-qPCR data: the necessity of adopting a systematic, experimental conditions-specific, validation of references. J. Exp. Bot. 60, 487–493.). Therefore, screening for internal reference genes that are stably expressed in different tissues of Willow of the Saposhnikovia divaricata under different nitrogen forms is the core to ensure the accuracy of real-time fluorescence quantitative analysis results. Summary of the invention

[0006] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide an internal reference gene for gene expression in different tissues of Willow of Ilex chinensis under nitrogen form treatment, which solves the current situation of lack of internal reference genes and instability in the process of gene expression pattern analysis of Willow of Ilex chinensis, especially in the analysis of gene expression patterns in different tissues under different nitrogen form treatment conditions.

[0007] The invention also provides primers for amplifying internal reference genes for gene expression in different tissues of Ligustrum lucidum under nitrogen form treatment and application of the primers in quantitative detection of internal reference genes of Ligustrum lucidum.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides an internal reference gene for gene expression in different tissues of Willow of Miscanthus under nitrogen form treatment, wherein the internal reference gene is any one or more of EF1α, EFβ, αTUB, βTUB, GAPDH, Actin1, Actin2, and H2A1, the EF1α nucleotide sequence is shown in SEQ ID NO.1, the EFβ nucleotide sequence is shown in SEQ ID NO.2, the αTUB nucleotide sequence is shown in SEQ ID NO.3, the βTUB nucleotide sequence is shown in SEQ ID NO.4, the GAPDH nucleotide sequence is shown in SEQ ID NO.5, the Actin1 nucleotide sequence is shown in SEQ ID NO.7, the Actin2 nucleotide sequence is shown in SEQ ID NO.8, and the H2A1 nucleotide sequence is shown in SEQ ID NO.9.

[0009] The primer pair for amplifying an internal reference gene of the present invention, the nucleotide sequence of the primer pair of the EF1α gene is shown in SEQ ID NOs.14-15, the nucleotide sequence of the primer pair of the EFβ gene is shown in SEQ ID NOs.16-17, the nucleotide sequence of the primer pair of the αTUB gene is shown in SEQ ID NOs.18-19, the nucleotide sequence of the primer pair of the βTUB gene is shown in SEQ ID NOs.20-21, the nucleotide sequence of the primer pair of the GAPDH gene is shown in SEQ ID NOs.22-23, the nucleotide sequence of the primer pair of the Actin1 gene is shown in SEQ ID NOs.26-27, the nucleotide sequence of the primer pair of the Actin2 gene is shown in SEQ ID NOs.28-29, and the nucleotide sequence of the primer pair of the H2A1 gene is shown in SEQ ID NOs.30-31.

[0010] Furthermore, the internal reference gene is preferably αTUB / EF1α or αTUB / EFβ.

[0011] The invention provides a real-time fluorescence quantitative PCR detection kit, which comprises a primer pair for amplifying the internal reference gene.

[0012] Furthermore, the kit also includes other reagents used for fluorescent quantitative PCR.

[0013] The application of the internal reference gene or the internal reference gene primer of the present invention in gene detection of different tissues of Willow of Siberia scabra under different nitrogen forms treatment.

[0014] Furthermore, the gene detection is real-time fluorescence quantitative PCR detection of gene transcription expression levels in different tissues of Willow of Ilex lappa under different nitrogen forms treatments.

[0015] Furthermore, the gene detection includes αTUB / EF1α or αTUB / EFβ.

[0016] Furthermore, the different nitrogen forms are treated by any one of NH4NO3, (NH4)2SO4, Ca(NO3)2 or without adding N source.

[0017] Furthermore, the different tissues include any one of roots, stems or leaves.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0019] (1) Provide stable and reliable internal reference genes

[0020] The present invention aims at the problem of lack of reliable internal reference genes in the research and application of Ligustrum lucidum, and screens out the internal reference genes αTUB and EF1α / EFβ that are relatively stable in expression in different tissues under different nitrogen form treatment conditions. The detection primers are highly specific, ensuring that the experimental data are authentic and reliable, providing a correction tool for studying gene expression in different tissues of Ligustrum lucidum under different nitrogen form treatment conditions, and significantly improving the stability and accuracy of the research.

[0021] (2) Propose a gene combination correction method

[0022] The present invention proposes for the first time to use a combination of αTUB and EF1α / EFβ as an internal reference gene for studying gene expression in different nitrogen forms and different tissues of Ligustrum lucidum. This combined correction method effectively improves the accuracy and reliability of fluorescence quantitative PCR results, solves the problem of unstable results often caused by the selection of a single reference gene in previous studies, and provides a more reliable tool for real-time fluorescence quantitative analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Agarose gel electrophoresis and RT-qPCR analysis of PCR products of 13 candidate internal reference genes of Ligustrum lucidum;

[0024] Figure 2 The melting curve analysis of 13 candidate reference genes of Ligusticum chuanxiong by real-time fluorescence quantitative PCR;

[0025] Figure 3 To analyze the amplification efficiency of 10 candidate reference genes of Salix babylonica.

[0026] Figure 4Gene expression analysis of 8 candidate internal reference genes of Salix pseudostellariae in different tissues under different nitrogen forms;

[0027] Figure 5 To analyze the expression stability of 8 candidate reference genes of Willow of Ilex fasciatus based on GeNorm algorithm (M);

[0028] Figure 6 To analyze the effect of the number of internal reference genes (V value) of Willow of Ilex fasciatus on stable expression based on GeNorm algorithm;

[0029] Figure 7 This is the Venn diagram of the reference genes stably expressed in different tissues of Salix babylonica under different nitrogen forms.

[0030] Figure 8 To analyze the expression pattern of the ammonium transporter SsAMT1 in Schizonepeta tenuifolia. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0032] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0033] The experimental methods without specific conditions in the examples are usually carried out under conventional conditions or conditions recommended by the manufacturers.

[0034] Salix suchowensis (Ecotype: NANJING) (Reference: Dai, X., Hu, Q., Cai, Q., Feng, K., Ye, N., Tuskan, GA, Milne, R., Chen, Y., Wan, Z., Wang, Z., et al. (2014). The willow genome and divergent evolution from poplar after the common genome duplication. Cell Res 24, 1274-1277.), preserved in the willow germplasm resource bank of Yangzhou University.

[0035] Example 1

[0036] Analysis of primer specificity of internal reference genes for gene expression analysis in various tissues of Salix babylonica under nitrogen form treatments

[0037] One-year-old stem segments of Nanjing willow (Ecotype: NANJING) were selected and cut into 12 cm long and 1 cm diameter cuttings. After culturing in a turnover box filled with 14 L of clean water for three weeks, they were transferred to 1 / 4 modified Hoagland nutrient solution (Hoagland nutrient solution formula: 1mM Ca(NO3)2, 1.25mM KNO3, 0.5mM MgSO4, 0.5mM NH4H2PO4, 25μMFe-EDTA, 1.43mg / L H3BO3, 0.055mg / L ZnCl2, 0.03mg / L CuCl2, 0.905mg / L MnCl2, and 0.015mg / LNa2MoO4; pH 5.5, references: Guo, N., Fan, L., Cao, Y., Ling, H., Xu, G., Zhou, J., Chen, Q., and Tao, J. (2022). Comparison of two willow genotypes reveals potential roles of iron-regulated transporter 9 and heavy-metal ATPase 1 in cadmium accumulation and resistance in Salix suchowensis. Ecotoxicol Environ Saf244, 114065.) were grown for four weeks, followed by a one-week nitrogen deficiency treatment, and then replaced with 0.3 mM NH4NO3, 0.3 mM (NH4)2SO4, 0.3 mM Ca(NO3)2, and no N source (-N) for 24 hours, and fresh root, stem and leaf tissues of the plants were collected. Total RNA of the samples was extracted according to the instructions of FastPure Universal Plant Total RNA Isolation Kit (Novozyme, Nanjing, China), and total RNA was reverse transcribed into cDNA using HiScript IIQ RT SuperMix with a gDNAwiper (Novozyme, Nanjing, China). RT-qPCR detection was performed using ChamQ SYBR qPCR Master Mix (Novozymes, Nanjing, China) with the following reaction conditions: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, for a total of 40 cycles; and then melting curve analysis at 65–95°C.

[0038] According to the transcriptome sequencing data of Ligustrum lucidum, 13 candidate internal reference genes were initially screened, and the nucleotide sequences were shown in SEQ ID NOs. 1 to 13. Quantitative primers were designed, and the primer sequences of the internal reference candidate genes were shown in SEQ ID NOs. 14 to 39. Among them, the 13 candidate internal reference genes include elongation factor 1alpha gene (EF1α), elongation factor beta gene (EFβ), microtubule protein gene (αTUB, βTUB), glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH), 18SrRNA gene, actin gene (Actin1, Actin2), histone gene (H2A1, H2A2, H2B2), ubiquitin gene (UBQ1, UBQ3); the nucleotide sequence of the EF1α gene is shown in SEQ ID NO.1; the nucleotide sequence of the EFβ gene is shown in SEQ ID NO.2; the nucleotide sequence of the αTUB gene is shown in SEQ ID NO.3; the nucleotide sequence of the βTUB gene is shown in SEQ ID NO.4; the nucleotide sequence of the GAPDH gene is shown in SEQ ID NO.5; the nucleotide sequence of the 18SrRNA gene is shown in SEQ ID NO.6; the nucleotide sequence of the Actin1 gene is shown in SEQ ID NO.7; the nucleotide sequence of the Actin2 gene is shown in SEQ ID NO.8. NO.8; the nucleotide sequence of the H2A1 gene is shown in SEQ ID NO.9; the nucleotide sequence of the H2A2 gene is shown in SEQ ID NO.10; the nucleotide sequence of the UBQ1 gene is shown in SEQ ID NO.11; the nucleotide sequence of the UBQ3 gene is shown in SEQ ID NO.12; and the nucleotide sequence of the H2B2 gene is shown in SEQ ID NO.13.

[0039] A special primer pair for amplifying the internal reference genes expressed in different tissues of the Willow of Psoralea corylifolia under different nitrogen forms treatment conditions, and the sequences of 13 candidate internal reference candidate gene primers are shown in SEQ ID NO.14-39:

[0040] EF1α-F:TGAAGAACGGAGATGCTGGT (SEQ ID NO. 14),

[0041] EF1α-R:TTGGCAGCAGATTTGGTCAC (SEQ ID NO.15),

[0042] EFβ-F:GGCGATGAGACTGAAGAGGA (SEQ ID NO.16),

[0043] EFβ-R:CTAACTGCCTTCTCCAACGC (SEQ ID NO.17),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0044] <h2 style=";text-align:left;direction:ltr"> αTUB-F:GAGCGACCCACCTATACCAA(SEQ ID NO.18),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0045] <h2 style=";text-align:left;direction:ltr"> αTUB-R:TGGTGCATAGGAGGAAAGCA(SEQ ID NO.19),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0046] <h2 style=";text-align:left;direction:ltr"> βTUB-F:AGCAGTTCACTGCCATGTTC(SEQ ID NO.20),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0047] <h2 style=";text-align:left;direction:ltr"> βTUB-R:ATGTTGCTCTCAGCCTCTGT(SEQ ID NO.21),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0048] <h2 style=";text-align:left;direction:ltr"> GAPDH-F:ACCCTCTCAAGCTTCCTTGG(SEQ ID NO.22),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0049] <h2 style=";text-align:left;direction:ltr"> GAPDH-R:CTTTGGCTGGAGCAGTGATG(SEQ ID NO.23),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0050] <h2 style=";text-align:left;direction:ltr"> 18SrRNA-F:CGGAGAAAGCTGCTCTGAAG(SEQ ID NO.24),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0051] <h2 style=";text-align:left;direction:ltr"> 18SrRNA-R:TCCCTTTCGTCTCAGTTGCT(SEQ ID NO.25),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0052] <h2 style=";text-align:left;direction:ltr"> Actin1-F:CGACAATGGTACCGGAATGG(SEQ ID NO.26),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0053] <h2 style=";text-align:left;direction:ltr"> Actin1-R:TGAGCCTCATCGCCCAACATA(SEQ ID NO.27),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0054] <h2 style=";text-align:left;direction:ltr"> Actin2-F:GCAGTGCTCTCCCTTTATGC(SEQ ID NO.28),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0055] <h2 style=";text-align:left;direction:ltr"> Actin2-R:AAGCCTAAGGATTGCATGGG(SEQ ID NO.29),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0056] <h2 style=";text-align:left;direction:ltr"> H2A1-F:GGAGGAAGGAGAGGAGGAGA(SEQ ID NO.30),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0057] <h2 style=";text-align:left;direction:ltr"> H2A1-R:CGTTGAGCGTAACGACCTTT(SEQ ID NO.31),<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0058] H2A2-F: TACCTCGCTGCTGTTCTTGA (SEQ ID NO.32),

[0059] H2A2-R:TGAACGTGCCTTGGGACTAT (SEQ ID NO.33),

[0060] UBQ1-F:GCCGTACCTTAGCCGATTAC(SEQ ID NO.34),

[0061] UBQ1-R:TGCTAGGACCTCCCTTTCCT (SEQ ID NO.35),

[0062] UBQ3-F:GAGGAGGCCATTCTGCTCT (SEQ ID NO.36),

[0063] UBQ3-R:CAGCCTGAAACCTGTTCGAC (SEQ ID NO.37),

[0064] H2B2-F:TCTCAAGCAAGGCTATGGGT (SEQ ID NO.38),

[0065] H2B2-R: CATGCTTGGCAAGTTCTCCA (SEQ ID NO. 39).

[0066] The specificity of the primer amplification product was verified by the BLAST function of the NCBI website. The primers were further screened using ordinary PCR, and the amplification product bands were detected using 1% agarose gel, and the Ct value and primer amplification efficiency and specificity were analyzed by RT-qPCR ( Figure 1 ). PCR gel electrophoresis and RT-qPCR melting curve analysis showed that the length of the amplified products of the 13 candidate genes was 100-250 bp ( Figure 1 A). Among them, the PCR bands of UBQ1, UBQ3 and H2B2 were not obvious, and the RT-qPCR melting curve showed double peaks or mixed peaks ( Figure 1 , Figure 2 ), so its primer specificity is poor and its expression abundance is low. The products of the other 10 candidate internal reference genes are all single bands, with Ct values ​​less than 35 and single peak melting curves, indicating that their amplification specificity is high and they may be ideal internal reference genes ( Figure 1 , Figure 2 ).

[0067] Example 2

[0068] Analysis of the amplification efficiency of reference gene primers for gene expression analysis in various tissues of Salix babylonica under nitrogen form treatments

[0069] The cDNA reverse transcribed in Example 1 was diluted by a multiple of 5 (5 0 , 5 -1 , 5 -2 , 5 -3 , 5 -4 , 5 -5 , 5 -6 , 5 -7 ). A standard curve was established with the dilution multiple as the x-axis and the gene Ct value as the y-axis, and the slope was calculated using a linear regression model ( Figure 3 ). The calculation formula of RT-qPCR efficiency (E): E = (10 [-1 / slopes] -1)×100, the amplification efficiency ranged from 90% to 110%, and the linear regression correlation coefficient (R 2 )>0.99, the primer amplification efficiency was considered good.

[0070] The standard curves were constructed for the 10 candidate gene primers screened above. The results showed that the amplification efficiencies of 18S and H2A2 were 237% and 155%, respectively, which did not meet the requirements. The amplification efficiencies of the remaining 8 candidate gene primers were between 90% and 110%, and the linear regression correlation coefficient (R 2 ) is greater than 0.99( Figure 3 ). Combining amplification efficiency and amplification specificity, the remaining 8 candidate internal reference genes were preliminarily screened for subsequent stability evaluation.

[0071] Example 3

[0072] Analysis of expression patterns of internal reference genes in various tissues of Salix pseudostellariae under nitrogen form treatments

[0073] The expression level of the gene is inversely proportional to the Ct value, that is, the larger the Ct value, the lower the gene expression level; the smaller the Ct value, the higher the gene expression level. The present invention detected the Ct values ​​of the 8 candidate reference genes screened out under different experimental conditions, including different organs (roots, stems and leaves) and N treatments (NH4NO3, NH4 + ,NO3 - , and -N). The results showed that EF1α had the highest expression level, with an average Ct value of 20.59; βTUB had a Ct value of 23.44-28.71, with the smallest expression level variation. In contrast, Actin2 had the lowest average expression level, with an average Ct value of 28.21; while H2A1 had the largest Ct value variability (23.72-37.21) ( Figure 4 ).

[0074] Example 4

[0075] Analysis on the stability of gene expression of reference genes in various tissues of Salix babylonica under nitrogen form treatments

[0076] The expression stability of candidate reference genes under different experimental conditions (different nitrogen treatments and different tissues) was evaluated using geNorm, NormFinder and Bestkeeper software, and a comprehensive ranking was performed using RefFinder.

[0077] The geNorm software uses the paired comparison method to convert the original Ct value into 2 -ΔCt The value (ΔCt = original Ct - minimum Ct) is used to calculate the gene expression stability M value. The lower the M value, the higher the stability of gene expression; otherwise, the stability is poor. The geNorm algorithm also determines the optimal number of internal reference genes by evaluating the Vn / n+1 value, and the default threshold is 0.15. If the Vn / n+1 value is less than 0.15, it is recommended to use n internal reference genes; otherwise, it is increased to n+1. According to the method of Example 1, under different nitrogen forms, except for GAPDH, the M values ​​of other candidate internal reference genes are all lower than 1.5, indicating that they are suitable as internal reference genes ( Figure 5 A). Among them, EF1α / EFβ and αTUB / βTUB have the smallest M values ​​and are the most stable reference genes under nitrogen treatment conditions ( Figure 5 A). In different tissues (roots, stems, leaves), the M values ​​of all reference genes were lower than 1.5 ( Figure 5 B), among which EF1α and αTUB were the most stably expressed genes in roots, stems, and leaves ( Figure 5 B). Comprehensively considering all experimental conditions, the M values ​​of EFβ and EF1α were both 0.35, further proving that they are the most stable reference genes ( Figure 5 C). In addition, the pairwise variation (V) analysis of geNorm showed that the V2 / 3 value was 0.148 under all experimental conditions, which was less than 0.15, indicating that two internal reference genes were sufficient for accurate normalization ( Figure 6 ).

[0078] The NormFinder algorithm is based on the variance analysis model and analyzes the stability of gene expression by evaluating the intra-group and inter-group variation. The smaller the stability parameter value (stability), the more stable the gene expression. The results show that under different nitrogen form treatment conditions according to the method of Example 1, αTUB has a significant difference in NH4NO3 and NO3 - The expression of EFβ was most stable under NH4 + The expression of EFβ in different tissues was the most stable in roots and leaves, while that of EF1α in stems was the most stable (Table 1). In summary, EFβ showed high stability under different nitrogen forms and tissue conditions and was a reliable internal reference gene.

[0079] Table 1 Analysis of the expression stability of 8 candidate reference genes in Psoralea corylifolia based on the NormFinder algorithm

[0080]

[0081] Bestkeeper evaluates the expression stability of candidate reference genes by calculating the standard deviation (SD) and coefficient of variation (CV) of the original Ct value. The smaller the SD value, the higher the gene stability. Comprehensive analysis under different nitrogen form treatments and tissue conditions showed that the stability ranking of the eight candidate reference genes was: EFβ>EF1α>αTUB>βTUB>Actin2>H2A1>Actin1>GAPDH (Table 2). The results showed that EFβ was the most stable reference gene, while GAPDH had the lowest stability.

[0082] Table 2 Standard deviation (SD) and coefficient of variation (CV) of Ct values ​​of 8 reference genes calculated based on the BestKeeper tool

[0083]

[0084]

[0085] RefFinder comprehensively ranked the results of the three algorithms, GeNorm, NormFinder, and BestKeeper, and finally evaluated the overall stability of the candidate genes by weighted geometric mean. The results showed that αTUB, EFβ, and EF1α were the most stable reference genes (Table 3).

[0086] Table 3 Comprehensive ranking of the stability of 8 candidate reference genes based on RefFinder tool analysis

[0087]

[0088] A Venn diagram was further drawn to explore the overlap of stable reference genes under different algorithms. The results showed that EFβ, αTUB, EF1α and βTUB were most stably expressed under different nitrogen forms, while αTUB, EF1α and EFβ had the best expression stability in different tissues ( Figure 7 ). Considering that EF1α and EFβ belong to the same gene family, it is recommended to select EF1α+αTUB or EFβ+αTUB as the optimal reference gene combination.

[0089] Example 5

[0090] Analyze the expression pattern of target genes using the selected reference genes

[0091] Ammonium transporters (AMTs) play an important role in the process of ammonium absorption in plants, and their expression is induced by ammonium (references: Giehl, RFH, Laginha, AM, Duan, F., Rentsch, D., Yuan, L., and von Wiren, N.

[0092] (2017). A critical role of AMT2;1 in root-to-shoot translocation of ammonium in Arabidopsis. Mol Plant 10, 1449-1460.). Through BLAST analysis of the genome of Schizonepeta japonica, SsAMT1 (KAG5224131.1) was selected to verify the stability of the expression of the reference genes EF1α, αTUB and EFβ. The results showed that the relative expression level of AMT1 was consistent whether EF1α, EFβ and αTUB were used alone or in combination for normalization. AMT1 was expressed at a high level in the root and was affected by NH4 + Induced upregulation of expression ( Figure 8 ), indicating that the combination of EF1α or EFβ and αTUB is an ideal reference gene for gene expression analysis of various tissues of Salix pseudostellaria under nitrogen form treatments.

Claims

1. A reference gene for gene expression in different tissues of Salix babylonica under nitrogen form treatment, characterized in that: The internal reference gene is any one or more of EF1α, EFβ, αTUB, βTUB, GAPDH, Actin1, Actin2, and H2A1. The EF1α nucleotide sequence is shown in SEQ ID NO.1, the EFβ nucleotide sequence is shown in SEQ ID NO.2, the αTUB nucleotide sequence is shown in SEQ ID NO.3, the βTUB nucleotide sequence is shown in SEQ ID NO.4, the GAPDH nucleotide sequence is shown in SEQ ID NO.5, the Actin1 nucleotide sequence is shown in SEQ ID NO.7, the Actin2 nucleotide sequence is shown in SEQ ID NO.8, and the H2A1 nucleotide sequence is shown in SEQ ID NO.

9.

2. A primer pair for amplifying the internal reference gene according to claim 1, characterized in that: The nucleotide sequence of the primer pair of the EF1α gene is shown in SEQ ID NOs.14-15, the nucleotide sequence of the primer pair of the EFβ gene is shown in SEQ ID NOs.16-17, the nucleotide sequence of the primer pair of the αTUB gene is shown in SEQ ID NOs.18-19, the nucleotide sequence of the primer pair of the βTUB gene is shown in SEQ ID NOs.20-21, the nucleotide sequence of the primer pair of the GAPDH gene is shown in SEQ ID NOs.22-23, the nucleotide sequence of the primer pair of the Actin1 gene is shown in SEQ ID NOs.26-27, the nucleotide sequence of the primer pair of the Actin2 gene is shown in SEQ ID NOs.28-29, and the nucleotide sequence of the primer pair of the H2A1 gene is shown in SEQ ID NOs.30-31.

3. The internal reference gene according to claim 1, characterized in that The internal reference genes are preferably αTUB and EF1α, or αTUB and EFβ.

4. A real-time fluorescence quantitative PCR detection kit, characterized in that: The detection kit comprises the special primer pair described in claim 2.

5. The real-time fluorescence quantitative PCR detection kit according to claim 4, characterized in that: The kit also includes other reagents used for fluorescent quantitative PCR.

6. Use of the internal reference gene according to claim 1 or the internal reference gene primers according to claim 2 in detecting gene expression levels in different tissues of Salix babylonica under different nitrogen forms.

7. The use according to claim 6, characterized in that: The gene detection is a real-time fluorescence quantitative PCR detection of gene expression levels in different tissues of Willow of Ilex sibiricum under different nitrogen forms.

8. The use according to claim 7, characterized in that: The gene test includes αTUB / EF1α or αTUB / EFβ.

9. The use according to claim 6, characterized in that: The different nitrogen forms are treated by any one of NH4NO3, (NH4)2SO4, Ca(NO3)2 or no addition of N source.

10. The use according to claim 6, characterized in that: The different tissues include any one of roots, stems or leaves.

Images