Specific PCR (Polymerase Chain Reaction) method for detecting cistanche tubulosa

Abstract

The invention discloses a specific PCR method for detecting cistanche tubulosa, and belongs to the technical field of detection and inspection. The method comprises the following steps: referring to chloroplast genomes of cistanche deserticola (desert) and cistanche tubulosa, obtaining a specific primer pair for identifying cistanche tubulosa through sequence comparison design, extracting genome DNA in a sample to be detected, performing PCR amplification reaction on the extracted genome DNA template by using the specific primer pair, and detecting the chloroplast genomes of cistanche tubulosa and cistanche tubulosa. Finally, PCR amplification obtained through 1% agarose gel electrophoresis is used for detection, and whether the cistanche tubulosa is contained or not is judged according to whether strips exist or not. According to the invention, amplification results of ten representative common foods containing cistanche on the market are investigated, and the specific primer pair disclosed by the invention can be used for identifying cistanche tubulosa from four cistanche without being influenced by other raw materials in the ten investigated common foods; the method can realize detection of cistanche tubulosa in common food containing cistanche tubulosa, and provides an effective means for quality supervision of common food containing cistanche tubulosa raw materials.

Description

Technical Field

[0001] The invention belongs to the technical field of detection and inspection, and relates to a method for detecting whether a sample contains Cistanche tubulosa by using a specific PCR technology, and specifically relates to a method for detecting whether a sample contains Cistanche tubulosa by combining PCR amplification and electrophoresis technology. Background Art

[0002] Cistanche deserticola is a traditional tonic medicinal material in my country. There are two base plants in the current pharmacopoeia, namely Cistanche deserticola YCMa, hereinafter referred to as Cistanche deserticola (desert) for distinction) and Cistanche tubulosa (Schenk) Wight. In November 2023, Cistanche deserticola was included in the catalog of substances that are both food and Chinese medicinal materials, but Cistanche tubulosa, another base plant of medicinal materials, was not included. At present, a large number of ordinary foods containing Cistanche deserticola have been developed and marketed. Among many ordinary foods, due to the disappearance of the medicinal material form, and the similar medicinal material powder and physical and chemical characteristics of the two base plants, the detection method in the current pharmacopoeia cannot test whether Cistanche tubulosa is added to ordinary foods, resulting in a gap in the regulatory means of ordinary food products added with Cistanche deserticola.

[0003] The Chinese invention patent application number 200810009143.3 discloses the application of allantoin in the identification of Cistanche species and its new use in lowering blood lipids. Compared with other Cistanches, Cistanches tubulosa does not contain allantoin. Zhao Jinjin et al. (Zhao Jinjin. Research on host evaluation of desert Cistanches and germplasm screening of Cistanches tubulosa [D]. Hebei Agricultural University, 2023. DOI: 10.27109 / d.cnki.ghbnu.2023.000224.) showed that betaine was not detected in Cistanches tubulosa. However, the above two indicators are not suitable for distinguishing whether ordinary foods contain Cistanche tubulosa, because Cistanche tubulosa does not contain allantoin and betaine, and other common Chinese medicinal materials with medicinal and edible properties, such as wolfberry, contain betaine (Hu Ying, Xu Xin, Zhang Chunyang, et al. Determination and comparative analysis of the content of polysaccharides and betaine in wolfberry from different varieties [J]. Modern Chinese Medicine, 2022, 24(12): 2383-2390. DOI: 10.13313 / j.issn.1673-489 0.20220623008.), and Chinese yam contains allantoin (Lü Hang, Zhang Quanli, Sun Xiangming. Determination of allantoin content in Chinese yam medicinal materials from different origins [J]. Journal of Harbin University of Commerce (Natural Science Edition), 2020, 36(01):13-16.DOI:10.19492 / j.cnki.1672-0946.2020.01.003.). These exceptions undoubtedly make the conclusion of using the above ingredients to judge whether Cistanche tubulosa is added to ordinary foods lack credibility. Therefore, the above two chemical indicators do not have the ability to identify whether Cistanche tubulosa is contained in complex samples.

[0004] DNA molecular identification of Cistanche deserticola mainly includes DNA barcoding technology and PCR amplification-based identification technology. Among them, DNA barcoding technology relies on first-generation sequencing technology, using the determined sequence species specificity to perform blastn analysis or the secondary structure characteristics of the sequence to derive species affiliation (Sun Zhiying, Han Jianping, Chen Shilin. DNA barcoding identification of Cistanche deserticola and its adulterants based on ITS2 sequences [C] / / Chinese Society of Botanical Medicine and Phytomedicine Professional Committee, Kunming Institute of Botany, Chinese Academy of Sciences, Abstracts of the 10th National Symposium on Medicinal Plants and Phytomedicines, Institute of Medicinal Plants, Chinese Academy of Medical Sciences and Peking Union Medical College; School of Pharmacy, Shandong University of Traditional Chinese Medicine; 2011:1.) , or determine species affiliation through single nucleotide polymorphisms (SNPs) at special positions in sequencing results (Chinese invention patent with application number 202410967992.9). This method is suitable for single-source medicinal samples, such as decoction pieces, or samples containing plants of the same genus, but it cannot be applied to the detection of complex food samples containing plants from other genera, because during the amplification process, the ITS sequences of other species will also be amplified simultaneously, resulting in the amplification products being not single, and the amplification product mixture cannot be directly analyzed by first-generation sequencing technology, resulting in severe peak overlap and inability to read valid sequences. Therefore, the molecular identification method based on DNA barcoding technology is not suitable for the detection of the original species of Cistanche deserticola in complex food samples.

[0005] Identification techniques based on PCR amplification include specific PCR and PCR-RFLP methods. The Chinese invention patent with application number 200410066785.9 discloses the identification primer sequence and identification method of the traditional Chinese medicine Cistanche deserticola polymerase chain reaction, compares the sequence differences between Cistanche deserticola (desert) and three other Cistanche plants (Cistanche tubulosa, Cistanche sandalis and Cistanche halogenides), and selects a pair of specific identification primers. The identification primers in this patent can identify whether Cistanche deserticola (desert) is present, but cannot determine whether there are other species of Cistanche deserticola in a complex sample. The Chinese invention patent with application number 202411065088.5 discloses a method for identifying the original plant of Cistanche deserticola slices by PCR-RFLP method, but only the specific restriction sites in the amplified sequences of Cistanche deserticola (desert) and Cistanche tubulosa are considered, and the PCR amplification product is digested with a single restriction endonuclease. Whether the PCR amplification product can be cut into two strips is judged whether it contains Cistanche tubulosa. However, because it does not consider whether there are the same restriction sites in the sequences of other species, it cannot meet the requirements of the identification of the original species of Cistanche deserticola in complex samples. Therefore, the rigor of the above two types of DNA molecular identification methods in identifying whether Cistanche tubulosa is contained in complex common food samples containing other medicinal and edible raw materials is not considered, and there are certain design defects.

[0006] In summary, the physicochemical and DNA molecular identification methods reported so far for distinguishing Cistanche deserticola from Cistanche tubulosa have limited adaptability and cannot meet the requirements for the detection of the original species of Cistanche deserticola in highly complex samples, nor can they determine whether Cistanche tubulosa has been added to the samples. Summary of the invention

[0007] In view of the above analysis, the purpose of the present invention is to provide a specific PCR method for detecting Cistanche tubulosa. The present invention can detect Cistanche tubulosa in complex samples and can be used to identify whether ordinary foods or raw materials containing Cistanche tubulosa (desert) raw materials are added with Cistanche tubulosa.

[0008] The object of the present invention is achieved by the following methods:

[0009] In a first aspect, the present invention provides a molecular marker for identifying Cistanche tubulosa, and the nucleotide sequence thereof is shown as SEQ ID NO.3.

[0010] In a second aspect, the present invention provides a specific primer pair for amplifying the above-mentioned molecular marker, and the nucleotide sequence of the specific primer pair is as follows:

[0011] Ct9F: 5'-CACTATCGGACAAACCACCGGA-3' (SEQ ID NO.1),

[0012] Ct11R: 5'-AAGGGGTCCGATGGGTATCT-3' (SEQ ID NO. 2).

[0013] In a third aspect, the present invention provides a PCR kit for identifying Cistanche tubulosa, comprising the above-mentioned specific primer pair.

[0014] Based on the above technical solution, further, the PCR kit also includes DNA polymerase, dNTPs, reaction buffer, and deionized water.

[0015] In a fourth aspect, the present invention provides a specific PCR method for detecting Cistanche tubulosa in a sample, comprising the following steps:

[0016] (1) extracting genomic DNA from the sample to be tested;

[0017] (2) using the above-mentioned specific primer pairs to perform PCR amplification reaction on the genomic DNA template extracted in step (1);

[0018] (3) Using 1% agarose gel electrophoresis, the PCR amplification obtained in step (2) is detected, and whether Cistanche tubulosa is contained is determined based on the presence or absence of bands.

[0019] Based on the above technical solution, further, the method for extracting genomic DNA in step (1) includes the CTAB method.

[0020] Based on the above technical solution, further, in step (2), the PCR amplification reaction system is 20 μL, including 1-2 μL of each forward and reverse primers, 5-10 μL of reaction buffer, 0.4-200 ng of template, and the remainder is deionized water.

[0021] Based on the above technical solution, further, in step (2), the template concentration is 0.02-10 ng / μl, and the forward and reverse primer concentrations are both 0.1-5 μM.

[0022] Based on the above technical solution, further, the PCR amplification program in step (2) is: pre-denaturation at 93-95°C for 4.5-5.5 min, denaturation at 93-95°C for 25-35 s, annealing at 55-60°C for 25-35 s, extension at 71-73°C for 40-50 s, 30-45 cycles, extension at 71-73°C for 9-11 min, cooling to 4°C, and maintaining for more than 10 min.

[0023] Based on the above technical solution, further, the nucleic acid dyes used in the agarose gel electrophoresis in step (3) include EtBr and Goldview fluorescent dye, and the electrophoresis conditions are: 100-150v, 20min, and the agarose gel is photographed in a UV transilluminator or a gel imaging system.

[0024] Based on the above technical solution, further, in step (3), when a 590 bp characteristic band appears in the amplified product, the sample to be tested contains Cistanche tubulosa; when a 590 bp characteristic band does not appear in the amplified product, the sample to be tested does not contain Cistanche tubulosa.

[0025] The beneficial effects of the present invention compared with the prior art are as follows:

[0026] The present invention can obtain a specific amplification product of about 590 bp of Cistanche tubulosa by specific PCR amplification, and investigates the amplification results of ten representative common foods containing Cistanche tubulosa on the market. The results show that the specific primer pair Ct9F and Ct11R in the present invention can realize the identification of Cistanche tubulosa from four kinds of Cistanche deserticola, and is not affected by other raw materials in the investigated ten kinds of common foods, and can realize the detection of Cistanche tubulosa in common foods containing Cistanche deserticola, thereby providing an effective means for the quality supervision of common foods containing Cistanche deserticola raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention, the drawings related to the embodiments are briefly introduced below.

[0028] Figure 1 The morphology of four types of Cistanche deserticola medicinal materials, including: A: Cistanche tubulosa; B: Cistanche deserticola; C: Cistanche sandalis; D: Cistanche halogenides.

[0029] Figure 2 The results of agarose gel electrophoresis of genomic DNA of four Cistanches amplified with primers Ct9F and Ct11R, including H: Cistanches deserticola, G: Cistanches tubulosa, Y: Cistanches halogenis, and S: Cistanches sandii.

[0030] Figure 3 The agarose gel electrophoresis results of the amplified products of four Cistanches using the Ct9F and Ct11R primer combinations at different annealing temperatures, including: H: Cistanches deserticola, G: Cistanches tubulosa, Y: Cistanches halogenides, and S: Cistanches sandii.

[0031] Figure 4 The agarose gel electrophoresis results of the amplified products of four Cistanches under different cycle numbers using the Ct9F and Ct11R primer combinations, where H: Cistanches deserticola, G: Cistanches tubulosa, Y: Cistanches halogenides, and S: Cistanches sandii.

[0032] Figure 5 This is the amplification effect of different concentrations of genomic DNA from Cistanche tubulosa as template.

[0033] Figure 6 The results of amplifying genomic DNA from common foods related to Cistanche deserticola using primer pairs Ct9F and Ct11R.

[0034] Figure 7 Amplification results of common food genomic DNA supplemented with Cistanche tubulosa genomic DNA using the Ct9F and Ct11R primer pairs. DETAILED DESCRIPTION

[0035] The present invention is described in detail below with reference to the embodiments, but the embodiments of the present invention are not limited thereto. Obviously, the embodiments described below are only partial embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative labor all fall within the protection scope of the present invention.

[0036] Example 1

[0037] The dried products of Cistanche deserticola, Cistanche tubulosa, Cistanche sandalis and Cistanche halogenides were extracted by CTAB method. Figure 1) was used as a template and Ct9F and Ct11R were used as primers (refer to the chloroplast genome of Cistanche deserticola and Cistanche tubulosa, and primers were designed by sequence alignment, Ct9F: 5'-CACTATCGGACAAACCACCGGA-3', Ct11R: 5'-AAGGGGTCCGATGGGTATCT-3') for PCR amplification reaction. The amplification system and conditions are shown in Table 1-2.

[0038] Table 1 PCR amplification reaction system

[0039]

[0040] Table 2 PCR amplification reaction conditions

[0041]

[0042] Take 5 μl of the obtained PCR product and perform 1% agarose gel electrophoresis. The nucleic acid dye is EtBr. The electrophoresis conditions are: 120V, 20min. The agarose gel is observed and photographed in a UV transilluminator or a gel imaging system.

[0043] The experimental results are shown in Figure 2 The results showed that only Cistanche tubulosa could obtain a specific amplification product band with a length of 590bp. The nucleotide sequence of the product obtained by amplifying Cistanche tubulosa using Ct9F-Ct11R as a specific primer pair is as follows:

[0044] CACTATCGGACAAACCACCGGATACTTGGCCCAATATTAGTTGGATCACTTA

[0045] GCCACGTTTCATAATTTGAAAAAAAAAAACGAGTATCGTGAAAATAAATGCCAC

[0046] TCAGCCAACGAAATATGATGGAGAGTTGACCAAAATGGACACTAAATATTTTTT

[0047] GAGAGATCTTCACTGATATAGCTATAGAAATCGTGAGCATCGGCATGTAGGTTC

[0048] CAGATCCAAGTGGTAGTAGTTGGATCCTTAGCTATTGTTCTTGAGAAATGACCT

[0049] GGTTTGGCCCATTCCTCGAAAGAAACTTTTACTTCCGGTTCAGGCGAACAAATAA

[0050] TCATTGAGTACTCCTCTTTCCGGACAACACATACAAACAAAGAGACCTGCCAAC

[0051] AGTCAAAATAATTAGTAAACCTTTGAGAAAGATTTATATAATTAGTTTATTGTTC

[0052] TTCTATTTTTCTATTCCATTTATATATTTCTTTTAGTCCTTTACTATATTTTAC

[0053] TATAATTACTATAACAATTATGACTTGGAAGTTGATCTGGGATAAGTGTTTGGAT

[0054] TTATTATGACTATGACATAGTCATCAGATACCCATCGGACCCCTT (SEQ ID NO. 3).

[0055] Example 2

[0056] The experimental process of this embodiment is the same as that of embodiment 1, except that the annealing temperatures are set to 55°C, 56°C, 57°C, 58°C, 59°C, and 60°C, respectively. Figure 3 Among the four Cistanches, only Cistanches tubulosa had a band at around 590 bp, while the other Cistanches had no bands, indicating that the primers were specific.

[0057] Example 3

[0058] The experimental process of this embodiment is the same as that of embodiment 1, except that the number of cycles is set to 30, 34, 38, and 42 times respectively. Figure 4 The results showed that only Cistanche tubulosa could obtain specific amplification products.

[0059] Example 4

[0060] The experimental process of this embodiment is the same as that of Example 1, except that the genomic DNA of Cistanche tubulosa was used as a template, and the effects of different template concentrations on the amplification product were investigated (1× was 10.0 ng / μl, 10× was 1.0 ng / μl, 100× was 0.1 ng / μl, 200× was 0.05 ng / μl, 500× was 0.02 ng / μl, 1000× was 0.01 ng / μl, and 5000× was 0.002 ng / μl).

[0061] The experimental results are shown in Figure 5 The results showed that Cistanche tubulosa could be detected in the template concentration range of 0.02-10ng / μl. In a 20μl reaction system, adding 0.4ng template could achieve effective amplification, which could achieve the purpose of identifying whether there was Cistanche tubulosa in the sample.

[0062] Example 5

[0063] Ten commercially available common foods containing Cistanche deserticola (see Table 3 for ingredients) were collected and tested. Among them, for liquid preparations (Cistanche deserticola concentrate, Cistanche deserticola puree, Huahong Alashan Cistanche deserticola essence drink and Cistanche deserticola wine), appropriate amounts of samples were taken for nitrogen blowing treatment to obtain product extracts, and then DNA was extracted; for Cistanche deserticola polyphenol tablets, the product was a compressed candy, and its sugar coating was removed and then ground; for the remaining solid products, the products were ground into powder and then DNA was extracted.

[0064] Table 3 Names and ingredient information of ten common foods containing Cistanche deserticola on the market

[0065]

[0066] No specific bands of Cistanche tubulosa were detected in the above ten common foods containing Cistanche deserticola. Figure 6 ), but in the genomic DNA of representative common foods containing Cistanche deserticola (serial numbers 1, 3, 4, 5 and 9) to which Cistanche tubulosa was added, specific bands were detected ( Figure 7 ).

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker for identifying Cistanche tubulosa, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

3.

2. A specific primer pair for amplifying the molecular marker according to claim 1, characterized in that: The nucleotide sequence of the specific primer pair is shown in SEQ ID NO.1-2.

3. A PCR kit for identifying Cistanche tubulosa, characterized in that: Comprising the specific primer pair described in claim 2.

4. A specific PCR method for detecting Cistanche tubulosa in a sample, characterized in that: The steps include: (1) extracting genomic DNA from the sample to be tested; (2) using the specific primer pair described in claim 2 to perform a PCR amplification reaction on the genomic DNA template extracted in step (1); (3) Using 1% agarose gel electrophoresis, the PCR amplification obtained in step (2) is detected, and whether Cistanche tubulosa is contained is determined based on the presence or absence of bands.

5. The method according to claim 4, characterized in that The method for extracting genomic DNA in step (1) includes the CTAB method.

6. The method according to claim 4, characterized in that The PCR amplification reaction system in step (2) is 20 μL, including 1 to 2 μL of each forward and reverse primer, 5 to 10 μL of reaction buffer, 0.4 to 200 ng of template, and the remainder is deionized water.

7. The method according to claim 6, characterized in that In step (2), the template concentration is 0.02-10 ng / μl, and the forward and reverse primer concentrations are both 0.1-5 μM.

8. The method according to claim 4, characterized in that The PCR amplification program in step (2) is: pre-denaturation at 93-95°C for 4.5-5.5 min, denaturation at 93-95°C for 25-35 s, annealing at 55-60°C for 25-35 s, extension at 71-73°C for 40-50 s, 30-45 cycles, extension at 71-73°C for 9-11 min, cooling to 4°C and maintaining for more than 10 min.

9. The method according to claim 4, characterized in that The nucleic acid dyes used in the agarose gel electrophoresis in step (3) include EtBr and Goldview fluorescent dye. The electrophoresis conditions are: 100-150V, 20min, and the agarose gel is photographed in a UV transilluminator or a gel imaging system.

10. The method according to claim 4, characterized in that In step (3), when a 590 bp characteristic band appears in the amplified product, the sample to be tested contains Cistanche tubulosa; when a 590 bp characteristic band does not appear in the amplified product, the sample to be tested does not contain Cistanche tubulosa.

Images