KASP molecular marker of main-effect QTL (Quantitative Trait Loci) of cabbage ball cracking resistance character and application thereof

Abstract

The invention discloses a KASP molecular marker of a main-effect QTL (Quantitative Trait Loci) of a cabbage ball cracking resistance character and application of the KASP molecular marker, and belongs to the field of biochemistry. The technical problem to be solved by the invention is how to identify or assist in identifying the ball cracking resistance of the cabbage and assist in breeding. According to one scheme, the composition for detecting the polymorphism or genotype of the SNP sites in the cabbage genome is applied to identification or auxiliary identification of the cabbage ball cracking resistance. The SNP site is located in a qNLQ3.1 site and is an SNP site in a cabbage genome, the nucleotide type of the SNP site is G or C, and the SNP site is the 91th nucleotide of SEQ ID No.1. The polymorphism of the qNLQ3.1 is directly expressed in the form of DNA, can be detected in each tissue and each development stage of the cabbage, can predict the ball cracking resistance of the cabbage, and accelerates the cultivation process of a new variety of the ball cracking resistant cabbage.

Description

Technical Field

[0001] The invention relates to the field of biochemistry, and in particular to a KASP molecular marker of a major effect QTL of a cabbage head-breaking resistance trait and an application thereof. Background Art

[0002] Cabbage Brassica oleracea L. var. capitata Cabbage (Brassica oleracea L.) is a variety of cabbage species in the genus Brassica of the Cruciferae family whose terminal buds can form a head. The head is an edible organ. It has rich types, diverse shapes, fresh and tender vegetables, and very high nutritional value. In the cultivation process of cabbage, the head is very likely to crack when it is close to maturity or after maturity, which not only seriously affects the appearance quality of the cabbage, but also easily causes diseases and insect pests, resulting in a significant reduction in cabbage yield and storage and transportation resistance, causing huge economic losses to production. In particular, the head cracking phenomenon of spring cabbage, whose planting area accounts for about 50% of the total cabbage area each year, has become one of the biggest problems restricting its production and sales. Therefore, it is of great significance to breed varieties that are resistant to head cracking.

[0003] Cabbage head splitting resistance is a complex quantitative trait that is easily affected by the environment. Therefore, the traditional breeding strategy based on visual investigation and selection of the degree of cabbage head splitting resistance at maturity is not accurate and has extremely low efficiency, which leads to a prolonged breeding cycle and cannot meet the current needs of cabbage breeding. Quantitative trait loci (QTL) mapping is a powerful means to analyze the genetic basis of complex quantitative traits, and is of great significance for the development of molecular markers for assisted selection and accelerated cabbage breeding. So far, only a few major QTLs related to cabbage head splitting resistance have been located using traditional QTL mapping methods, and two SSR molecular markers closely linked to cabbage head splitting resistance-related QTLs have been developed (Pang W, Li X, Choi SR, Nguyen VD, DhandapaniV, Kim YY, Ramchiary N, Kim JG, Edwards D, Batley J, Na J, Kim HR, Lim YP.Mapping QTLs of resistance to head splitting in cabbage ( Brassica oleracea L. var. capitata L.). Molecular Breeding, 2015, 35:126; Su Y, Liu Y, Li Z, Fang Z, Yang L, Zhuang M, Zhang Y. QTL Analysis of head splitting resistance incabbage ( Brassica oleracea L. var. capitata) using SSR and InDel makers based on whole-genome re-sequencing. Plos One, 2015, 10(9):e0138073), which has become the main bottleneck of molecular breeding for cabbage resistant to head splitting. Therefore, it is urgent to further explore the major effect QTL related to cabbage head splitting resistance and develop related molecular markers to provide new options for screening and identifying cabbage varieties resistant to head splitting.

[0004] In recent years, the development of sequencing technology and molecular marker technology has laid the foundation for the rapid discovery of major QTLs controlling the head-breaking resistance trait of cabbage. In particular, the competitive allele-specific PCR (KASP) technology, as a new type of molecular marker technology, has been widely used in crop QTL positioning research and molecular marker-assisted breeding due to its high efficiency, accuracy and independence from gel electrophoresis detection. Combining the second-generation sequencing technology with traditional QTL positioning methods for QTL analysis and developing KASP molecular markers for the major QTL of cabbage head-breaking resistance will promote cabbage molecular-assisted breeding and accelerate the breeding process. Summary of the invention

[0005] A technical problem to be solved by the present invention is how to identify or assist in identifying the resistance to head splitting of cabbage.

[0006] In order to solve the above technical problems, the present invention provides a composition for detecting the polymorphism or genotype (i.e., allele) of a SNP site in the cabbage genome for use in identifying or assisting in identifying the resistance to head splitting in cabbage; the SNP site is a SNP site in the cabbage genome, located at qNLQ3.1 Inside the site, the nucleotide type is G or C, which is the 91st nucleotide of SEQ ID No. 1; the composition comprises the PCR primer, and the PCR primer is P1 or P2: P1, the PCR primers are a primer set consisting of a single-stranded DNA having a nucleotide sequence of SEQ ID No.2, a single-stranded DNA having a nucleotide sequence of positions 22 to 41 of SEQ ID No.3, and a single-stranded DNA having a nucleotide sequence of positions 22 to 41 of SEQ ID No.4; P2. The PCR primers are a primer set consisting of a single-stranded DNA whose nucleotide sequence is SEQ ID No.2, a single-stranded DNA whose nucleotide sequence is SEQ ID No.3, and a single-stranded DNA whose nucleotide sequence is SEQ ID No.4.

[0007] In order to solve the above technical problems, the present invention also provides a composition for detecting the polymorphism or genotype (i.e., allele) of a SNP site in the cabbage genome for use in preparing or assisting in identifying a cabbage head-breaking resistance product; the SNP site is a SNP site in the cabbage genome, located at qNLQ3.1 Inside the site, the nucleotide type is G or C, which is the 91st nucleotide of SEQ ID No.1; the composition comprises the PCR primer, and the PCR primer is the above-mentioned P1 or the above-mentioned P2.

[0008] In order to solve the above technical problems, the present invention also provides the use of a composition for detecting the polymorphism or genotype (i.e., allele) of a SNP site in the cabbage genome in cabbage breeding or in the preparation of cabbage breeding products; the SNP site is a SNP site in the cabbage genome, located at qNLQ3.1 Inside the site, the nucleotide type is G or C, which is the 91st nucleotide of SEQ ID No.1; the composition comprises the PCR primer, and the PCR primer is the above-mentioned P1 or the above-mentioned P2.

[0009] The breeding objectives include breeding cabbage with resistance to cracking.

[0010] In order to solve the above technical problems, the present invention provides a method for identifying or assisting in identifying the resistance to head splitting of cabbage, comprising detecting the genotype of the cabbage to be tested, and identifying or assisting in identifying the resistance to head splitting of cabbage according to the genotype of the cabbage to be tested; the genotype is the genotype of a SNP site in the cabbage genome; the SNP site is a SNP site in the cabbage genome, located qNLQ3.1 Inside the site, the nucleotide type is G or C, which is the 91st nucleotide of SEQ ID No.1; the detection is performed using PCR primers, and the PCR primers are the above-mentioned P1 or the above-mentioned P2.

[0011] Another technical problem to be solved by the present invention is how to carry out cabbage breeding.

[0012] In order to solve the above technical problems, the present invention provides the following technical solutions: B1. Application of the above method in cabbage breeding.

[0013] The breeding objectives include breeding cabbage with resistance to cracking.

[0014] B2. A method for breeding cabbage, comprising: detecting a polymorphism of a SNP site in a cabbage genome, and selecting a cabbage homozygous for G in the cabbage genome as a parent for breeding; the SNP site is a SNP site in the cabbage genome, located at qNLQ3.1Inside the site, the nucleotide type is G or C, which is the 91st nucleotide of SEQ ID No.1.

[0015] The breeding objectives include breeding cabbage with resistance to cracking.

[0016] Any of the following products 1)-3) containing a composition for detecting the polymorphism or genotype (i.e., allele) of a SNP site in the cabbage genome also falls within the protection scope of the present invention: 1) Products for detecting single nucleotide polymorphisms or genotypes associated with cabbage head-blasting resistance; 2) Products that identify or assist in identifying the resistance of cabbage to head cracking; 3) Products used for cabbage breeding.

[0017] In the above applications, methods and products, the SNP site is a SNP site in the cabbage genome, located qNLQ3.1 Inside the site, the nucleotide type is G or C, which is the 91st nucleotide of SEQ ID No.1. The polymorphism or genotype (i.e., allele) of the SNP site in the cabbage genome can be specifically the nucleotide type of the SNP site. The genotype of the SNP site in the cabbage genome can be GG, CC or GC. The GG is the homozygous type of the SNP site in the cabbage genome being G, the CC is the homozygous type of the SNP site in the cabbage genome being C, and the GC is the heterozygous type of the SNP site in the cabbage genome being G and C.

[0018] In the above method, the head-breaking resistance of the cabbage can be identified or auxiliary identified based on the genotype of the cabbage to be tested. The head-breaking resistance of the cabbage to be tested with a genotype of GG is stronger than or is a candidate stronger than the head-breaking resistance of the cabbage to be tested with a genotype of CC.

[0019] In the above applications, methods and products, the cabbage breeding is to cultivate cabbage with resistance to cracking.

[0020] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP site in the cabbage genome can be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0021] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP site in the cabbage genome is as follows 1), 2) or 3): D1) containing PCR primers for amplifying a genomic DNA fragment of Brassica oleracea including the SNP site; D2) a PCR reagent containing the PCR primers; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).

[0022] In the above applications, methods and products, the PCR primers may be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive markers such as 32 P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative) or, alternatively, can be charge neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., the sequence is directly read). For example, the PCR primers may be a primer set consisting of a single-stranded DNA having a nucleotide sequence of SEQ ID No.2, a single-stranded DNA having a nucleotide sequence of SEQ ID No.3, and a single-stranded DNA having a nucleotide sequence of SEQ ID No.4, wherein SEQ ID No.3 in the sequence list consists of 41 nucleotides, wherein nucleotides at positions 1 to 21 are a FAM linker sequence (as a marker), and nucleotides at positions 22 to 41 are specific sequences; and SEQ ID No.4 in the sequence list consists of 41 nucleotides, wherein nucleotides at positions 1 to 21 are a HEX linker sequence (as a marker), and nucleotides at positions 22 to 41 are specific sequences.

[0023] In the above applications, methods and products, the product may be a reagent or a kit or a system. The system may include a combination product of a reagent or a kit, an instrument and an analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader and an online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), and a combination product consisting of PCR primers, PARMS master mix reagents, an online software SNP decoder and a fluorescence quantitative PCR instrument. The product may include the above-mentioned detection of the gene in the cabbage genome qNLQ3.1 The polymorphism of a locus or the combination of genotypes.

[0024] The invention discloses a novel KASP marker for detecting the resistance to ball splitting of cabbage. The specific primer set provided by the invention consists of a single-stranded DNA shown in SEQ ID No.2, a single-stranded DNA shown in SEQ ID No.3 and a single-stranded DNA shown in SEQ ID No.4, wherein the single-stranded DNA shown in SEQ ID No.3 and the single-stranded DNA shown in SEQ ID No.4 are provided with a fluorescent labelled linker.

[0025] In one embodiment of the present invention, the above primer set with a fluorescently labeled linker was used to amplify 23 inbred lines resistant to ball splitting (the inbred lines used are recorded in the non-patent document "Tai Xiang, Chen Jinxiu, Guo Sanhong, Zhu Xiaowei, Bo Tianyue. Analysis of quality traits of different cabbage inbred lines. Molecular Plant Breeding. 2021, 19 (09)", which can be obtained by the public from the applicant to repeat the experiment of the present invention). The results are shown in Table 2. There are 18 GG alleles, 4 CC alleles, and 1 GC heterozygous type, which indicates that the accuracy of KASP5 marker screening for cabbage resistant to ball splitting selfing is 78.3%. qNLQ3.1 The SNP in the method is a SNP molecular marker associated with head-breaking resistance of cabbage. The specific primer set provided by the present invention can be used to identify or assist in identifying head-breaking resistance of cabbage, can be used for screening cabbage varieties with head-breaking resistance, can be used for cabbage molecular marker-assisted breeding, and can be used for the selection and cultivation of head-breaking-resistant cabbage. qNLQ3.1 The polymorphism of the SNP in the method is directly expressed in the form of DNA and can be detected in various tissues and development stages of cabbage, which is conducive to conveniently and quickly predicting the resistance to head splitting of cabbage. qNLQ3.1 The SNP site polymorphism and genotype substances in the method are combined with other substances (such as substances for detecting other single nucleotide polymorphisms or genotypes related to cabbage head cracking resistance) to prepare a product for identifying cabbage head cracking resistant cabbage varieties. The present invention has important theoretical significance and economic value for the use of molecular markers to assist in the selection of disease-resistant cabbage varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The phenotypes of 'ZF' and '103' in Example 1 of the present invention and the grade distribution of the head-breaking resistance trait of the F2 population in spring 2020 and 2021. Figure 1 a is the phenotype photo of 'ZF'; Figure 1 b is the phenotypic photo of '103'; Figure 1 c is the grade distribution of the head-breaking resistance trait of the F2 population in spring 2020; Figure 1 d is the grade distribution of the head-breaking resistance trait of the F2 population in spring 2021.

[0027] Figure 2 This is the QTL analysis of the ball-breaking resistance trait performed using the QTL-seq method in Example 1 of the present invention. Figure 2 a is the SNP-index of S-bulk; Figure 2 b is the SNP-index of R-bulk; Figure 2 c is the ∆(SNP-index) between S-bulk and R-bulk, and the red arrows on chromosome C03 indicate candidate QTL sites.

[0028] Figure 3 This is the QTL analysis of the ball-breaking resistance trait using the GPS method in Example 1 of the present invention. Figure 3 a is the Ridit analysis result before noise reduction processing; Figure 3 b is the Ratio diagram after noise reduction, and the red arrow on chromosome C03 indicates the candidate QTL site.

[0029] Figure 4 In Example 1 of the present invention qNLQ3.1 QTL mapping. Figure 4 a is the classical QTL analysis of F2 population using linkage mapping method; Figure 4 b is QTL mapping qNLQ3.1 Narrowed to between molecular markers N2-80 and KASP4; Figure 4 c shows that there is a physical distance of 74.6 kb between the molecular markers N2-80 and KASP4. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0031] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0033] In the following embodiment, '103' is an inbred line obtained by systematic selection of the Shanghai local cabbage variety 'Black Leaf Small Flat Head'. Its head is oblate and extremely resistant to head cracking. '103' has been disclosed in the document "Tai Xiang, Chen Jinxiu, Guo Sanhong, Zhu Xiaowei, Bo Tianyue. Analysis of quality traits of different cabbage inbred lines. Molecular Plant Breeding. 2021, 19 (09)" and can be obtained by the public from the applicant.

[0034] In the following embodiments, Dazhengfu (abbreviated as: ZF) is a pointed-head cabbage inbred line introduced from the United Kingdom by the Horticultural Research Institute of Shanghai Academy of Agricultural Sciences and obtained through systematic selection. It is very easy to split the head and has been disclosed in the document "Tai Xiang, Chen Jinxiu, Guo Sanhong, Zhu Xiaowei, Bo Tianyue. Analysis of quality traits of different cabbage inbred lines. Molecular Plant Breeding. 2021, 19 (09)", which can be obtained by the public from the applicant.

[0035] Example 1 '103' is an inbred line obtained by systematic selection of the Shanghai local cabbage variety 'Black Leaf Flat Head'. Its head is oblate and very resistant to head rupture. 'ZF' is an inbred line of cabbage with pointed head obtained by systematic selection from the Institute of Horticulture of Shanghai Academy of Agricultural Sciences from the UK. It is very easy to rupture. With 'ZF' as the female parent and '103' as the male parent, the hybrid combination F1 was prepared, and the F2 was obtained by selfing the F1 individual plants. Individual plants of the genetic population of 'ZF', '103' and F2 were planted at the Zhuangxing Experimental Station of Shanghai Academy of Agricultural Sciences (Shanghai, China).

[0036] 1 Phenotypic identification of the blast resistance trait The head-breaking characteristics of individual plants in the 'ZF', '103' and F2 genetic populations were investigated from 71 days after planting. Individual plants with the same head maturity period in the 'ZF', '103' and F2 genetic populations were selected for observation and record of head-breaking resistance characteristics. The statistical time was a total of 7 weeks. The evaluation of cabbage head-breaking resistance characteristics was divided into 7 levels based on the head-breaking time: 1: 0 days < schistosomiasis time ≤ 7 days; 2: 7 days < blastoderm time ≤ 14 days; 3: 14 days < blastoderm time ≤ 21 days; 4: 21 days < schistosomiasis time ≤ 28 days; 5: 28 days < schistosomiasis time ≤ 35 days; 6: 35 days < schistosomiasis time ≤ 42 days; 7: 42 days < schistosomiasis time ≤ 49 days.

[0037] The head cracking of the head-breaking parent '103' is significantly later than that of the head-breaking parent 'ZF'. Based on the phenotypic survey in Shanghai for two consecutive years, the head-breaking resistance grade of '103' is '5' (28 days < head-breaking time ≤ 35 days), while the grade of 'ZF' is 1 (0 days < head-breaking time ≤ 7 days). The head-breaking resistance trait of individual plants in the F2 population showed continuous phenotypic variation and presented a normal distribution (see Figure 1 ), indicating that the head-breaking resistance trait of '103' is a quantitative trait inheritance.

[0038] 2 Extreme pool construction and whole genome sequencing The genomic DNA of the paternal, maternal and F2 populations was extracted by the modified CTAB method. According to the results of the blast time classification of cabbage plants obtained from the field survey, 20 blast-prone plants and 22 blast-resistant plants were selected from the F2 population for DNA extraction, and then mixed in equal amounts to construct two extreme pools (the blast-prone pool was S-bulk, and the blast-resistant pool was R-bulk). The DNA samples of the two pools and the two parents were sent to Beijing Biomark Biotechnology Co., Ltd. for paired-end sequencing (150 bp×2) using the Illumina NovaSeq 6000 platform.

[0039] After resequencing the two parents and two offspring pools, a total of 69.35 Gb of clean bases were obtained. The effective read lengths of each sample were aligned with the cabbage reference genome. 'ZF' generated 72,111,660 clean reads, with an average sequencing depth of 16× and a 5× genome coverage of 89.73%; '103' generated 70,196,400 clean reads, with an average sequencing depth of 13× and a 5× genome coverage of 87.84%; S-bulk generated 179,595,080 clean reads, with an average sequencing depth of 37× and a 5× genome coverage of 95.32%; R-bulk generated 141,537,678 clean reads, with an average sequencing depth of 30× and a 5× genome coverage of 94.95%. In addition, a total of 418,473 SNP sites were identified between S-bulk and R-bulk.

[0040] 3 QTL-seq analysis Clean reads were obtained by removing the adapter reads, unknown sequence 'N' (reads containing unknown bases > 10%), and low-quality reads (reads containing Q values ​​≤ 10 and greater than 50% of the bases) from the raw reads obtained by sequencing. Clean reads were aligned to the cabbage reference genome (www.ocri-genomics.org / bolbase / index.html) using BWA software (Li and Durbin, 2009). SNP calling was performed using GATK software. The mutation frequency (i.e., SNP-index) of the two progeny pools at each SNP site and the difference ∆(SNP-index) between the two progeny pools were calculated according to the method of Takagi et al. (Takagi H, Abe A, Yoshida K, Kosugi S, Natsume S, Mitsuoka C, Uemura A, Utsushi H, Tamiru M, Takuno S, Innan H, Cano LM, Kamoun S, Terauchi R (2013) QTL-seq: rapid mapping of quantitative trait loci in rice by whole genomeresequencing of DNA from two bulked populations. Plant J 74(1): 174-183.). 2 Mb was selected as the window and 10 kb as the step size. The average value of SNP-index in each window was calculated and the distribution of SNP-index on chromosomes was plotted. The 99% confidence level was selected as the screening threshold, and the windows above the confidence level were selected as candidate QTL loci for cabbage resistance to ball splitting.

[0041] By analyzing the SNP-index of the two progeny pools and the ∆(SNP-index) between them, two regions exceeding the 99% confidence interval were found. They are the QTL loci related to blast resistance, named qNLQ3.1 and qNLQ3.2 . qNLQ3.1 Located in the range of 6.38 Mb to 9.33 Mb (2.95 Mb) on chromosome C03 of cabbage. qNLQ3.2 Located in the range of 13.46 Mb to 14.34 Mb (0.88 Mb) on chromosome C03 of Brassica oleracea (see Figure 2 ).

[0042] 4 Graded Pool-seq (GPS) analysis To further verify the accuracy of QTL-seq loci, GPS analysis was further used to analyze the whole genome resequencing results of S-bulk and R-bulk. The clean reads obtained by genome resequencing were aligned to the parental 'ZF' genome sequence, followed by SNP calling. The Ridit analysis was used to calculate the SNP of each SNP locus according to the method of Wang et al. (Wang C, Tang S, Zhan Q, Hou Q, Zhao Y,Zhao Q, Feng Q, Zhou C, Lyu D, Cui L, Li Y, Miao J, Zhu C, Lu Y, Wang Y, WangZ, Zhu J, Shangguan Y, Gong J, Yang S, Wang W, Zhang J, Xie H, Huang X, Han B (2019) Dissecting a heterotic gene through GradedPool-Seq mapping informs arice-improvement strategy. Nat Commun 10(1):2982.) p The values ​​are followed by -ln( p -value) value is plotted on the y-axis and the chromosome position is plotted on the x-axis p -value graph. Subsequently, the non-overlapping sliding window method was used for noise reduction, and the -ln( p The ratio of the number of loci with a -value greater than 10 to the total number of loci in the sliding window was calculated. The results were presented in the form of a ratio graph, and the peak area represented the interval most associated with the ball-breaking resistance trait.

[0043] The clean reads of S-bulk and R-bulk were aligned to the 'ZF' genome, where 4,015,558 SNP sites were obtained in S-bulk and 4,072,779 SNP sites were obtained in R-bulk. The number of each SNP site was calculated by Ridit analysis. p After the value was calculated and noise reduction was performed, a strong peak region was obtained on the cabbage C03 chromosome, which was between 6.8 Mb and 7.19 Mb, exactly located at qNLQ3.1 Within the range (see Figure 3 Considering the analysis results of QTL-seq and GPS, we will focus on qNLQ3.1 Location.

[0044] 5 Traditional QTL mapping analysis The QTL loci for head-breaking tolerance in cabbage obtained by QTL-seq and GPS qNLQ3.1 To further verify and narrow the positioning interval, traditional QTL positioning was used to verify and narrow the positioning segment. The inventors designed 6 pairs of InDel primers and 5 sets of KASP primers (see Table 1) within the 6.38 Mb to 9.33 Mb interval (2.95 Mb) of Cabbage C03 chromosome, and amplified and detected polymorphisms between parents. The development of InDel and KASP markers was based on the results of parental genome resequencing. InDel and KASP primers were first used to verify polymorphisms between parents, and then the polymorphic marker primers between parents were used to amplify the F2 population.

[0045] Table 1 Primers used for QTL mapping

[0046]

[0047] The PCR reaction system for InDel primer amplification was as follows: total volume 10 μL, template DNA (20 ng / μL) 1 μL, upstream and downstream primers 0.2 μM, 2 × Taq premixed PCR reaction system (including dye) (purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.) 5 μL, ddH2O 3.6 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min; 16℃ storage. The PCR product was detected by 4% agarose gel (agarose 4g, 1 × TAE buffer 100 ml) electrophoresis, 150 V constant voltage electrophoresis for 30 min, and photographed by UV gel imager.

[0048] The PCR reaction system for KASP primer amplification was as follows: total volume 10 μL, template DNA 10-100 nM, Allele Xprimer, Allele Y primer 0.15 μM, Common primer 0.4 μM, 2×PARMS master mix 5 μL, ddH2O to 10 μL. The PCR reaction program was as follows: 94°C pre-denaturation for 20 min; 94°C denaturation for 20 s, 65-57°C extension for 60 s, 0.8°C reduction per cycle, 10 cycles in total; 94°C denaturation for 20 s, 57°C extension for 60 s, 32 cycles in total. After PCR was completed, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder ( http: / / www.snpway.com / snpdecoder / ) Analyze and convert fluorescent signals to obtain clear and intuitive typing diagrams, and output genotype results based on different colors.

[0049] JoinMap4.0 software was used for linkage analysis, and MQM mapping program in MapQTL6.0 was used for QTL analysis.

[0050] After amplifying 300 F2 plants using the 11 polymorphic markers obtained between parents and performing QTL analysis, the results showed that there was a major QTL locus between InDel marker N2-80 and KASP marker KASP4, with a physical location of 7.07 Mb to 7.14 Mb on chromosome C03 of cabbage. The LOD threshold of this segment was 8.23-9.55, which could explain up to 14% of the phenotypic variation. Finally, qNLQ3.1 The locus was narrowed down to a physical distance of 74.6 kb on B. oleracea chromosome C03 ( Figure 4 ).

[0051] 6 Application of KASP molecular markers for major QTL of head-breaking tolerance in cabbage Located in traditional QTL mapping qNLQ3.1 The KASP5 molecular marker in the LOD peak region amplified the GG allele at a SNP site in '103' and the CC allele at the SNP site in 'ZF'. qNLQ3.1 Inside the site, corresponding to position 91 of SEQ ID No. 1, the nucleotide is either G or C, represented by the letter S. qNLQ3.1 One allele of the locus is GG (i.e., homozygous for nucleotide G at position 91 of SEQ ID No.1); another allele is CC (i.e., homozygous for nucleotide C at position 91 of SEQ ID No.1); and the third allele is GC (i.e., heterozygous for nucleotide G and C at position 91 of SEQ ID No.1). 。

[0052] SEQ ID No.1: GGTTCTCAATCTCCAATCATCATCCGAAGAAATACAACAACCGTTTAAATCAGCTAAACCGGAACCGGAAATTTCGGAAGAATCGTGGTGSCATACCGGGTTTAGTTCCG The position of the KASP5 primer set in the sequence listing is as follows: KASP5F: GGTTCTCAATCTCCAATCATCATC (as shown in SEQ ID No. 2, which is identical to the sequence from positions 1 to 24 of SEQ ID No. 1); KASP5Rc: GAAGGTGACCAAGTTCATGCT CGGAACTAAACCCGGTATGC (as shown in SEQ ID No.3, positions 1-21 are FAM linker sequences, indicated by underscores; positions 22-41 are specific sequences, which are reverse complementary to the sequence of positions 91-110 of SEQ ID No.1 with the nucleotide G at the SNP site); KASP5Rg: GAAGGTCGGAGTCAACGGATT CGGAACTAAACCCGGTATGG (as shown in SEQ ID No.4, positions 1-21 are the HEX linker sequence, indicated by underscores; positions 22-41 are the specific sequence, which is reverse complementary to the sequence of positions 91-110 of SEQ ID No.1 with the nucleotide of SNP site being C).

[0053] The single-stranded DNA molecules shown in SEQ ID No. 2 and SEQ ID No. 3 above amplify the fragment of SEQ ID No. 1 in which the 91st nucleotide is G, and the fluorescent signal of the fluorescent group bound to the FAM sequence can be read by an ELISA reader or a fluorescent quantitative PCR instrument; The single-stranded DNA molecules shown in SEQ ID No. 2 and SEQ ID No. 4 amplify the fragment of SEQ ID No. 1 whose 91st nucleotide is C, and the fluorescent signal of the fluorescent group bound to the HEX sequence can be read by an ELISA reader or a fluorescent quantitative PCR instrument.

[0054] The inventors used the KASP5 marker to amplify 23 inbred lines resistant to ball splitting (the inbred lines used are recorded in the non-patent document "Tai Xiang, Chen Jinxiu, Guo Sanhong, Zhu Xiaowei, Bo Tianyue. Analysis of quality traits of different cabbage inbred lines. Molecular Plant Breeding. 2021, 19 (09)", which can be obtained from the applicant to repeat the experiment of the present invention). The results are shown in Table 2. There are 18 expressing GG alleles, 4 expressing CC alleles, and 1 expressing GC heterozygous, which indicates that the accuracy of KASP5 marker in screening cabbage self-pollination resistant to ball splitting is 78.3%.

[0055] Table 2 Genotyping of KASP5 molecular markers in 23 blastoderm-resistant lines

[0056]

[0057] In summary, qNLQ3.1 The locus is the main effect QTL of cabbage head-breaking resistance. The cabbage varieties with CC alleles in the locus have significantly lower head-breaking resistance than the cabbage varieties with GG genotypes, indicating that qNLQ3.1The SNP locus allele type GG is an excellent allele, and the allele type CC is a non-excellent allele. qNLQ3.1 The cabbage with homozygous G at the SNP site is used as a parent to breed cabbage with resistance to cracking.

[0058] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a composition for detecting the polymorphism or genotype of a SNP site in a cabbage genome in identifying or assisting in identifying the resistance to head splitting of cabbage; characterized in that: The SNP site is a SNP site in the cabbage genome, the nucleotide type of which is G or C, and is the 91st nucleotide of SEQ ID No.1; the composition comprises a PCR primer, and the PCR primer is P1 or P2: P1, the PCR primers are a primer set consisting of a single-stranded DNA having a nucleotide sequence of SEQ ID No.2, a single-stranded DNA having a nucleotide sequence of positions 22 to 41 of SEQ ID No.3, and a single-stranded DNA having a nucleotide sequence of positions 22 to 41 of SEQ ID No.4; P2. The PCR primers are a primer set consisting of a single-stranded DNA whose nucleotide sequence is SEQ ID No.2, a single-stranded DNA whose nucleotide sequence is SEQ ID No.3, and a single-stranded DNA whose nucleotide sequence is SEQ ID No.

4.

2. Use of a composition for detecting the polymorphism or genotype of a SNP site in a cabbage genome in the preparation of a product for identifying or assisting in identifying cabbage resistance to ball splitting; characterized in that: The SNP site is a SNP site in the cabbage genome, the nucleotide type of which is G or C, and is the 91st nucleotide of SEQ ID No.1; the composition comprises a PCR primer, and the PCR primer is P1 described in claim 1 or P2 described in claim 1.

3. Use of a composition for detecting polymorphism or genotype of a SNP site in a cabbage genome in cabbage breeding or in preparing a cabbage breeding product, characterized in that: The SNP site is a SNP site in the cabbage genome, the nucleotide type of which is G or C, and is the 91st nucleotide of SEQ ID No.1; the composition comprises a PCR primer, and the PCR primer is P1 described in claim 1 or P2 described in claim 1.

4. A method for identifying or assisting in identifying the resistance to head splitting of cabbage, comprising detecting the genotype of the cabbage to be tested, and identifying or assisting in identifying the resistance to head splitting of cabbage according to the genotype of the cabbage to be tested; characterized in that: The genotype is the genotype of a SNP site in the cabbage genome, the nucleotide type is G or C, and it is the 91st nucleotide of SEQ ID No.1; the detection is performed using PCR primers, and the PCR primers are P1 described in claim 1 or P2 described in claim 1.

5. Application of the method according to claim 4 in cabbage breeding.

6. A method for cabbage breeding, characterized in that: The method comprises: detecting the polymorphism of the SNP site in claim 1 in the cabbage genome, and selecting homozygous cabbage with the SNP site G in the cabbage genome as a parent for breeding.

7. A product containing a composition for detecting the polymorphism or genotype of the SNP site in claim 1 in the cabbage genome, which is any one of products 1) to 3): 1) Products for detecting single nucleotide polymorphisms or genotypes associated with cabbage head-blasting resistance; 2) Products that identify or assist in identifying the resistance of cabbage to head cracking; 3) Products used for cabbage breeding.

8. The use according to any one of claims 1 to 3 and 5, the method according to claim 4 or 6 or the product according to claim 7, characterized in that: The cabbage breeding is to cultivate cabbage with resistance to cracking.

9. The use according to any one of claims 1 to 3, 5 and 8, the method according to claim 4, 6 or 8 or the product according to claim 7 or 8, characterized in that: The composition for detecting the polymorphism or genotype of the SNP site in claim 1 in the cabbage genome is as follows (D1), D2) or D3): D1) containing PCR primers for amplifying a genomic DNA fragment of Brassica oleracea including the SNP site described in claim 1; D2) a PCR reagent containing the PCR primers; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).

10. The use, method or product according to claim 9, characterized in that: The PCR primers are a primer set consisting of the single-stranded DNA shown in SEQ ID No. 1 in the sequence list, the single-stranded DNA shown in SEQ ID No. 2 in the sequence list, and the single-stranded DNA shown in SEQ ID No. 3 in the sequence list.

Images