CAPS (cleaved amplified polymorphic sequence) marker detection method for wheat tillering character and application

Abstract

The invention discloses a CAPS marker detection method for wheat tillering characters and application, and relates to the technical field of molecular biology and crop breeding. The invention aims to solve the technical problem of how to quickly identify the tillering phenotype of wheat. Therefore, the invention provides an application of a substance for detecting polymorphism or genotype of an SNP site in a wheat genome, the SNP is a marker in the wheat genome, the nucleotide variety of the SNP is A or G, and the SNP is the 779th nucleotide of SEQ ID NO: 1 and is named OT24. The invention also provides a composition and / or a kit for detecting the SNP. By detecting the SNP genotype, screening and typing of a to-be-detected material can be rapidly realized, rapid auxiliary selection in a seedling stage is realized, improvement of wheat tillering phenotypes is accelerated, and excellent varieties with ideal tillering characteristics are bred.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a CAPS marker detection method and application of wheat tillering traits. Background Art

[0002] Wheat is one of the most important food crops, providing about 20% of the world's food calories. Ensuring its stable and high yield is a key link in ensuring food security (SHIFERAW et al., 2013). Wheat tillering is one of the important traits in wheat high-yield breeding. Since reasonable tillering can optimize the population structure and improve the efficiency of light and nutrient utilization, wheat yield can be increased. Therefore, improving the number of wheat tillers and the occurrence and extinction characteristics is of great significance to increasing yield. Summary of the invention

[0003] The technical problem to be solved by the present application is how to quickly and accurately identify the tillering number or tillering ability of wheat.

[0004] In order to solve the above technical problems, the present application provides an application of a substance for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP is a site in the wheat genome, the nucleotide type of which is A or G, and is the 779th nucleotide of SEQ ID NO: 1, named OT24; the application may be any of the following: A1) Application in identifying or assisting in identifying the tillering number and / or tillering capacity of wheat; A2) Use in the preparation of products for identifying or assisting in identifying the number and / or tillering capacity of wheat; A3) Application in wheat breeding or assisted wheat breeding; A4) Use in preparing products for wheat breeding or assisting wheat breeding.

[0005] In the application, the substance may be the following B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0006] In the above applications, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight measurement, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid sequence or a protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0007] The present invention also provides a method for identifying or assisting in identifying the number of wheat tillers and / or tillering ability, the method comprising detecting the genotype of a SNP site in the wheat genome to be tested, and identifying or assisting in identifying the number of tillers and / or tillering ability to be tested based on the genotype, wherein the SNP site is the above-mentioned SNP site.

[0008] In the above-mentioned method for identifying or assisting in identifying the number of wheat tillers and / or tillering ability, the genotype is AA or AG or GG, the AA is the homozygous type with the SNP site being A, the AG is the heterozygous type with the SNP site being A and G, and the GG is the homozygous type with the SNP site being G. According to the genotype, identification or assisting in identifying the number of wheat tillers and / or tillering ability can be performed such that the number of tillers of the wheat to be tested with the genotype of GG is higher than that of the wheat to be tested with the genotype of AA, and the number of tillers of the wheat to be tested with the genotype of AG is between the two homozygous types.

[0009] The invention also provides application of the method in wheat breeding.

[0010] The present invention also provides a method for wheat breeding, which comprises detecting the genotype of the SNP site in the wheat genome, and selecting wheat whose genotype of the SNP site is AA or GG as a parent for breeding, wherein AA is a homozygous type when the SNP site is A, and GG is a homozygous type when the SNP site is G.

[0011] In the above method, the genotype of the SNP site in the wheat genome is detected by A1) or A2): 1) Sequencing; 2) using the primer pair to perform PCR amplification on the wheat genome DNA to be tested, then digesting the amplified product with restriction endonuclease BmrI, and detecting the number of enzyme digestion product bands: determining the genotype of the SNP site in the wheat genome to be tested according to the number of enzyme digestion product bands.

[0012] Furthermore, in the method described in 2), the genotype of OT24 in the wheat genome to be tested is determined according to the number of bands of the enzyme digestion product: If the enzyme digestion product is a 979bp band, the genotype of OT24 in the wheat genome is A / A. If the enzyme digestion product is a 195bp band and a 784bp band, the genotype of OT24 in the wheat genome is G / G. If the enzyme digestion product is a 195bp band, a 784bp band, and a 979bp band, the genotype of OT24 in the wheat genome is A / G.

[0013] In some embodiments of the present application, the method for identifying or assisting in identifying a new allelic variation genotype of a wheat tillering trait comprises the following steps: S1. Extracting the genomic DNA of wheat to be tested, performing PCR amplification on the extracted DNA to obtain an amplified product; the primer sequence used in the PCR amplification is SEQ ID NO: 2 for the upstream primer and SEQ ID NO: 3 for the downstream primer; Primer sequences used for PCR amplification: OT24F: 5'-CAACATATATATGATGTCCTGGCTGCAAT-3' (SEQ ID NO: 2) OT24R: 5'-AAGCAGGGACCTCACACCC-3' (SEQ ID NO: 3) S2. The amplified product is digested with BmrI restriction endonuclease to obtain a digestion product; S3. Analyze the number of bands of the enzyme cleavage product. When three enzyme cleavage products are produced, the corresponding wheat to be tested is a heterozygous material (OT24 genotype is A / G); when the enzyme cleavage product has two electrophoresis bands, the corresponding wheat to be tested is a homozygous multi-tillering material (OT24 genotype is G / G); when the enzyme cleavage product has only one main band, the corresponding wheat to be tested is a homozygous few-tillering material (OT24 genotype is A / A).

[0014] In step S1, the total PCR amplification system is 50 μL, including 2×Phanta Flash Master Mix 25 μL, a total DNA amount of 200 ng, 20 μM upstream primer, 20 μM downstream primer, and ddH2O is added to the 50 μL system; the reaction conditions are: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 5 s, and a total of 34 cycles; and finally, full extension at 72°C for 1 min.

[0015] In step S2, the total enzyme digestion system is 10 μL, including 0.2 μL of BmrI restriction endonuclease, 4 μL of PCR product, 1 μL of 10×NEB buffer, and ddH2O is added to the total system of 10 μL; the reaction conditions are: enzyme digestion temperature 37° C., enzyme digestion reaction time 30 min.

[0016] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is the above-mentioned SNP site, the product contains the above-mentioned substance, and the product may be any of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes of tiller number and / or tillering ability in wheat, C2) Products for identifying or assisting in identifying the number and / or tillering capacity of wheat, C3) Products for wheat breeding, C4) Products obtained by screening or breeding wheat plants, plant lines, strains or varieties according to their tillering characteristics.

[0017] Specifically, the product may be as follows: D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) the product is a kit containing the primer combination described in D1) or the PCR reagent described in D2), D4) The product is a kit containing the primer composition described in D1) and or the PCR reagent described in D2) and restriction endonuclease BmrI.

[0018] In the above, the primer composition may be a primer pair, and the primer pair may consist of primers OT24F and / or OT24R; The primer OT24F is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list, which is 5'-CAACATATATATGATGTCCTGGCTGCAAT-3'; The primer OT24R is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence table, which is 5'-AAGCAGGGACCTCACACCC-3'.

[0019] The kit may also include other reagents required for restriction endonuclease BmrI to digest the amplified product.

[0020] The cleavage site of the restriction endonuclease BmrI is as follows Figure 3 Indicated by the arrow in the .

[0021] In the above applications and methods, the substance for detecting SNP polymorphism or genotype can be a nucleotide type of the SNP site in the wheat genome determined by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0022] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is sequence 1 in the sequence list.

[0023] The application of the above DNA molecules is also within the scope of protection of the present invention, and the application may be any of the following: E1) Use of the DNA molecule in identifying or assisting in identifying the tillering number and / or tillering ability of wheat, E2) Application of the DNA molecule in wheat breeding, E3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying the number of wheat tillers and / or tillering ability, E4) Use of the DNA molecule in preparing wheat breeding products, E5) Use of the DNA molecule in screening or breeding wheat plants, plant lines, strains or varieties according to wheat tillering traits, E6) Use of the DNA molecule in assisting the screening or breeding of wheat plants, plant lines, strains or varieties according to wheat tillering traits.

[0024] The product may be a kit.

[0025] The kit comprises a primer combination for amplifying a wheat genomic DNA fragment including the SNP site.

[0026] In the present application, the wheat or the wheat to be tested may be the hybrid offspring of wheat A and wheat B, wherein wheat A is wheat carrying the OT24, and the nucleotide type of the OT24 is G; and wheat B is wheat carrying the OT24, and the nucleotide type of the OT24 is A. The hybrid offspring may be F2 generation and above, such as F2 generation, BC1F2, F3 generation, etc.

[0027] In some embodiments of the present application, the A wheat is wheat Jing 411, and the B wheat is wheat mutant ot2.

[0028] In the present application, the purpose of wheat breeding is to screen wheat with a target tillering number or tillering ability; the indicators of wheat breeding include wheat tillering number and / or tillering ability.

[0029] Furthermore, the purpose of wheat breeding includes cultivating wheat with increased and / or decreased tillering number and / or tillering ability. The increased and / or decreased tillering number and / or tillering ability of wheat means that the tillering number and / or tillering ability of wheat is higher and / or lower than that of the parent.

[0030] In the present application, the tillering trait may be a trait of few tillers or many tillers.

[0031] In the present application, the wheat breeding may be wheat assisted breeding.

[0032] In the present application, the product may be a reagent and / or a kit.

[0033] Compared with the prior art, this application has the following beneficial effects: The present application provides a CAPS marker related to wheat tillering trait and its application. The marker can assist in distinguishing the tillering ability of wheat and help select wheat plants with few tillers or many tillers. The CAPS marker OT24 can be used for molecular marker-assisted breeding of wheat to accelerate the screening and breeding process of ideal plant type wheat.

[0034] This marker is highly correlated with the number of wheat tillers, so it can effectively assist in the selection of materials with few or many tillers during wheat breeding, thereby optimizing the wheat population structure and improving light energy utilization and yield potential.

[0035] The invention discloses an application of a composition of polymorphism or genotype of OT24 in identifying or assisting identification of tillering number or tillering ability of wheat, wherein OT24 is a SNP in the wheat genome, and its nucleotide type is A or G, which is the 779th nucleotide of SEQ ID NO: 1. The present application also provides a composition and / or a kit for detecting the OT24. By detecting the OT24 genotype, the screening and typing of materials to be tested, rapid auxiliary selection at the seedling stage, accelerated improvement of wheat tillering phenotype, and breeding of varieties with excellent tillering characteristics can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The wild type Jing411 (Jing411) and the mutant carrying the mutation site OT24 ot2 Tillering phenotype and agronomic traits.

[0037] Figure 2 The results of restriction digestion of the OT24 locus genotype carried by the F2 individual plants of the isolated population using the CAPS marker OT24.

[0038] Figure 3 Schematic diagram of the cleavage site of restriction endonuclease BmrI. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0040] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0041] The following examples used SPSS11.5 statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0042] Wild type wheat: Jing411 is a known variety that has passed variety approval and was purchased from Beijing Seed Company.

[0043] Wheat oligotillering mutant ot2The Genbank accession number in NCBI is PQ811416.1 (21-FEB-2025, https: / / www.ncbi.nlm.nih.gov / nuccore / PQ811416.1 / ).

[0044] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0045] Example 1. Wild type and oligotillering mutants ot2 Comparison of agronomic traits and selection of CAPS markers The wheat oligotillering-related gene is located on chromosome 1B of the Chinese Spring reference genome v2.1. Through gene fine mapping and differential SNPs between parents, a mutation (G / A) was found at position 650492594, located TraesCS1B03G1131800 Genetically, this site is co-segregated with the wheat trait of more tillers or fewer tillers. A CAPS marker for detecting wheat tillering traits was designed using this mutation site. The marker can effectively distinguish individuals with fewer tillers and more tillers in a wheat population, and is helpful to accelerate the screening of tillering traits in the process of molecular marker-assisted breeding. The marker is named OT24.

[0046] Wild-type Jing411 and oligotillering mutant ot2 In October 2023, the wheat was planted in the experimental field of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Twenty plants were planted in each row, and the row length was 2 meters. When the tillering characteristics of wheat were stable in May of the following year, 5 mutants and 5 wild-type plants were randomly selected to measure the tillering number and statistically analyzed. ot2 The differences in various agronomic traits between 411 and Jing 411 were analyzed using independent samples. t The significance of the difference in the test data was analyzed.

[0047] Extract Beijing 411 and ot2The extracted wheat genomic DNA was amplified by PCR using primers OT24F (single-stranded DNA molecule with nucleotide sequence SEQ ID NO: 2, 29 bp): 5'-caacatatatatgatgtcctggctgcaat-3' and OT24R (single-stranded DNA molecule with nucleotide sequence SEQID NO: 3, 19 bp): 5'-aagcagggacctcacaccc-3' to obtain the amplified product, and the amplified product was digested with BmrI restriction endonuclease to obtain the digested product. The digested product was subjected to DNA agarose gel electrophoresis to detect the number of bands of the target product. The total digestion system was 10 μL, including 0.2 μL of BmrI restriction endonuclease, 4 μL of PCR product, 1 μL of 10×NEB buffer, and ddH2O was added to the total system of 10 μL; the reaction conditions were: digestion temperature 37°C, and digestion reaction time 30 min.

[0048] The cleavage site of the restriction endonuclease BmrI is as follows Figure 3 Indicated by the arrow in , N can be any one of the nucleotides A, T, C and G.

[0049] The results are as follows Figure 1 As shown, Figure 1 The wild-type Jing411 and the mutant carrying the OT24 mutation ot2 Phenotypes and agronomic traits of Jing411 and mutants ot2 The whole plant phenotype at heading stage, B is Jing 411 and mutant ot2 Comparison of grain length and width, C is Jing 411 and mutant ot2 CAPS labeling results, D for Jing411 and mutants ot2 Comparison of tiller numbers, E is Jing 411 and mutant ot2 Comparison of plant height, F is Jing411 and mutant ot2 Comparison of thousand-grain weight.

[0050] Figure 1 The results showed that there were two electrophoretic bands after the wild-type Jing411 amplified product was digested ( Figure 1 Middle C), which is multi-tillering ( Figure 1 Mutants ot2 After enzyme digestion, there is only one band, carrying the new allele of OT24, which is manifested by reduced tiller number, reduced plant height, and reduced thousand-grain weight. Figure 1 C, D, E, F). Mutants carrying OT24 mutations ot2 The tiller number was 1.5±0.9, which was significantly less than the wild type Jing 411 (17±4.4). Figure 1(D). At the same time, compared with wild-type Jing411, the mutant ot2 Grain length, grain width, and 1000-grain weight were reduced, and plant height was also reduced ( Figure 1 (B, D, E, F).

[0051] The PCR amplification product was sent for sequencing. The sequencing results showed that the nucleotide sequence of the PCR amplification product was sequence 1 in the sequence list, and the nucleotide at position 779 was A or G, which was a SNP in the wheat genome and was named OT24. When the Jing 411 wheat genomic DNA was used as the amplification template, the genotype of the OT24 site of the amplification product was homozygous for G, represented by G / G. ot2 When wheat genomic DNA is used as the amplification template, the genotype of the OT24 locus of the amplified product is homozygous A, represented by A / A.

[0052] The sequence 1 (SEQ ID NO: 1, 979 bp) in the sequence list is as follows, wherein y at position 779 represents nucleotide A or G: 5’-caacatatatatgatgtcctggctgcaatgcctgattcggtcggacggggctcttcggcaccccttgtgtgagggggagccgccggtggtgctccagtatgccgatgacaccctgatcatcatgcgcgctgaggcggggggcgcggcgaggctgcgcgtcatcctcgaccaattcgccaccgctacggggctcgtcatcaacttctcaaaaagcacccttgtccccatgcatgtggacgcagcggtgcttgcggcggtggttgccacgttcggatgcagcgttggcgccttcccgcagacctatttgggcctaccgctgtccagcgacaagctcaaggtcgacgactttgcaccgatgctggccaaggtggacccctatcttgcgggatggcgtgctaggcttctgtcccccgcggggcgcctggtcctcgtcaacgcagtcctggactccctccccacctatgccatggcggccatgcggctcccgccggctgtcctggcgaggctggatgggctgcgacatgcgttcctttcgaacgtggcagggcgggccttcggtgctcagtgcctcgtcgcctgggaccgggtttgccgggctaaggccgaagggggcctgggcgttcgcgatctgggggctcagaacgactgccttctcctaaagcttctccatcgtcttcactccagagttccgtccagatgggcctgctgggtttggggcctgctggacggacgatctctcctgagccctggtcgtccccctctcttgggggagcactggygggccctccttgggctgctccccgtctaccgggcactcacgcgtgttgaggtgggggacgggcgggcgacctcgttctggcacgacgattggctcgcctgtggggtgctccggatggccttccccgccctcttctcccatgctgacagcttggaggtctccgtgtggatggtgcgccggcggggtgtgaggtccctgctt-3’。 Example 2: Screening and identification of isolated populations using CAPS marker OT24 Wild-type Jing 411 was used as the parent and mutant ot2 The wild type Jing 411 was used as the male parent and the mutant ot2 The F1 generation was obtained by hybridization with the female parent. The tiller number of the F1 generation was 10±4.5, which was between Jing 411 and ot2 The number of tillers is between 2 and 3. This indicates that when the genotype of the OT24 locus is heterozygous (A / G), the corresponding number of tillers is heterozygous. The F2 generation was obtained by self-pollination of the F1 generation. 88 F2 generation plants were tested for markers. The genomic DNA extracted from the isolated population was amplified by PCR using primers OT24F and OT24R to obtain PCR products, and the PCR products were digested with restriction endonuclease BmrI. The digested products were separated by 1% agarose gel electrophoresis. The individuals with 2 digested products were wild-type genotypes, and had more tillers. The individuals with 1 digested product were mutants carrying the OT24 mutation, which showed fewer tillers. The individuals with 3 digested products were heterozygous for the OT24 mutation, and the number of tillers was between the wild-type Jing 411 and the mutant. ot2 Between them, separation and identification are required in the next generation.

[0053] The results are as follows Figure 2 As shown, Figure 2 The markers from bottom to top are 100bp, 200bp, 500bp, 1000bp and 2000bp respectively.

[0054] The results showed that: the individual plants in the samples were 1-5, 7-8, 11, 13, 22-24, 26-38, 40, 42, 44-45, 47-48, 51-52, 54-56, 59, 64, 66, 69-74, 76-79, 82, 86-88, 90-93, 95-98, 101-105, 110-116, 118-121, 124-128, 131-135, 137, 143, 146- 147, 149-154, 156-157, 159, 161, 163-164, 166-168, 170-173, 175-178, 180-182, 187, 189-190, 196-197, 204, 206-207, 212-217, 219-220, 224-225, 227-233 are 3 bands, and the genotype of the OT24 locus is A / G, that is, OT24 (nucleotide 779 of SEQ ID NO: 1) is a heterozygous type of A and G ( Figure 2 ), indicating that the OT24 locus was heterozygous (Table 1).

[0055] 6, 9, 12, 14-21, 25, 39, 41, 46, 49-50, 53, 57-58, 60-63, 65, 67-68, 80-81, 83-85, 89, 94, 99-100, 106-109, 117, 122, 129-130, 138-139, 141-142, 144-145, 148, 155, 160, 162, 165, 169, 174, 179, 185-186, 193-194, 201-202, 205, 209, 211, 221-223 and 226 are 1 band, and the genotype of the OT24 locus is A / A, i.e., OT24 (SEQ ID NO: 1's 779th nucleotide) is homozygous for A ( Figure 2 ), This indicates that the OT24 locus is a mutant (Table 1). 10, 43, 75, 123, 136, 140, 158, 183-184, 188, 191-192, 195, 198-200, 203, 208, 210, and 218 are 2 bands, and the genotype of the OT24 locus is G / G, that is, OT24 (nucleotide 779 of SEQ ID NO: 1) is homozygous for G ( Figure 2 ), indicating that the OT24 locus was wild type (Table 1).

[0056] The OT24 locus genotype obtained by CAPS combined with phenotypic identification was consistent with the results of sequencing verification.

[0057] The above experiments show that OT24 site mutation can significantly reduce the number of tillers, and CAPS marker OT24 can be used for molecular marker-assisted selection to achieve high-throughput, rapid assisted selection at the seedling stage, and accelerate the breeding of wheat varieties with ideal tillering phenotypes.

[0058] Table 1 Detailed data of OT24 genotype and tiller number in segregating population

[0059]

[0060]

[0061]

[0062] Table 2 Results of significant differences analysis among the three genotypes

[0063] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. The use of a substance for detecting polymorphism or genotype of a SNP site in a wheat genome, characterized in that: The SNP is a site in the wheat genome, the nucleotide type of which is A or G, and is the 779th nucleotide of SEQ ID NO: 1, named OT24; the application is any of the following: A1) Application in identifying or assisting in identifying the number and / or tillering capacity of wheat, A2) Use in the preparation of a product for identifying or assisting in identifying the number and / or tillering capacity of wheat, A3) Application in wheat breeding or assisted wheat breeding, A4) Use in preparing products for wheat breeding or assisting wheat breeding.

2. The use according to claim 1, characterized in that: The substance is as follows (B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for identifying or assisting in identifying the number of wheat tillers and / or tillering capacity, characterized in that: The method comprises detecting the genotype of the SNP site in the wheat genome to be tested, and identifying or assisting in identifying the number of tillers and / or tillering ability to be tested according to the genotype, wherein the SNP site is the SNP site described in claim 1.

4. Application of the method according to claim 3 in wheat breeding.

5. A method for wheat breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the wheat genome, and selecting wheat whose genotype of the SNP site is AA or GG as a parent for breeding, wherein AA is a homozygous type when the SNP site is A, and GG is a homozygous type when the SNP site is G.

6. A product for detecting polymorphism or genotype of SNP sites in wheat genome, characterized in that: The SNP site is the SNP site described in claim 1, the product contains the substance described in claim 1, and the product is any one of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes of tiller number and / or tillering ability in wheat, C2) Products for identifying or assisting in identifying the number and / or tillering capacity of wheat, C3) Products for wheat breeding, C4) Products obtained by screening or breeding wheat plants, plant lines, strains or varieties according to their tillering characteristics.

7. The product according to claim 6, characterized in that The product is as follows (D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) the product is a kit containing the primer combination described in D1) or the PCR reagent described in D2), D4) The product is a kit containing the primer composition described in D1) and or the PCR reagent described in D2) and restriction endonuclease BmrI.

8. The use according to claim 2 or the product according to claim 7, characterized in that: The primer composition is a primer pair, and the primer pair consists of primers OT24F and / or OT24R; The primer OT24F is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list, The primer OT24R is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list.

9. A DNA molecule, characterized in that The nucleotide sequence of the DNA molecule is sequence 1 in the sequence list.

10. The use of the DNA molecule according to claim 9, wherein the use is any of the following: E1) Use of the DNA molecule in identifying or assisting in identifying the tillering number and / or tillering ability of wheat, E2) Application of the DNA molecule in wheat breeding, E3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying the number of wheat tillers and / or tillering ability, E4) Use of the DNA molecule in preparing wheat breeding products, E5) Use of the DNA molecule in screening or breeding wheat plants, plant lines, strains or varieties according to wheat tillering traits, E6) Use of the DNA molecule in assisting the screening or breeding of wheat plants, plant lines, strains or varieties according to wheat tillering traits.

Images