Molecular marker for identifying common head cabbage, SNP (Single Nucleotide Polymorphism) primer and application of molecular marker

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to a molecular marker for identifying common head cabbage, an SNP (Single Nucleotide Polymorphism) primer and application of the molecular marker and the SNP primer. According to the invention, the information of related cabbage SNP loci in a vegetable SNP database is subjected to biological information analysis and screening to obtain SNP loci with two distinction degrees, specific primer pairs are designed for the two loci to carry out amplification verification, and through verification and comparison of known materials, the SNP loci with two distinction degrees can be obtained. It is determined that the SNP loci found in the invention have 100% consistency in identification of common head cabbage, and the primer pair of the two SNP loci can be applied to identification of common head cabbage seeds or cabbage varieties independently or in a combined manner.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and in particular, the invention relates to a molecular marker for identifying common cabbage, a SNP primer set and an application thereof. Background Art

[0002] Cabbage vegetables belong to the family Cruciferae, genus Brassica, including cabbage, Brussels sprouts, kale, cauliflower, broccoli and kale. They all have thick, green, waxy leaves with obvious veins. They are all low-temperature, long-day crops with vernalization of chlorotic bodies. Cabbage includes round cabbage, flat-top cabbage, savoy cabbage, purple cabbage, etc. Cabbage is rich in vitamin C, vitamin K, dietary fiber and various minerals (such as calcium, iron, potassium). It can be eaten fresh, pickled, cooked, and widely used in various dishes.

[0003] The commercial use of cabbage is very different from that of cauliflower and broccoli, but the appearance of the seeds of the three is very similar. Cabbage cannot be simply identified by seeds and cotyledons. It can only be distinguished after the plant variety grows true leaves. This method is time-consuming and labor-intensive and cannot meet the needs of rapid identification of varieties. DNA molecular markers refer to genetic markers based on the variation of nucleotide sequences in genetic material between individuals, which is a direct reflection of genetic variation at the DNA level. Most molecular markers of DNA molecular markers are co-dominant, which is very convenient for the selection of recessive agronomic traits; the genome variation is extremely rich, and the number of molecular markers is almost unlimited: at different stages of biological development, DNA from different tissues can be used for marker analysis; molecular markers reveal variations from DNA: they are neutral, do not affect the expression of target traits, and are not linked to undesirable traits; the detection means are simple and rapid. However, there are few studies on molecular markers of cabbage. CN202311143372.5 discloses some KASP molecular markers of cabbage, but its marker molecules include dozens of SNP sites, and the operation and application are complicated. Therefore, it is particularly important to establish a simple and rapid method for identifying common cabbage varieties to provide technical support for the identification of cabbage variety populations. Summary of the invention

[0004] After extensive research, the present invention provides a molecular marker, SNP primer and application thereof for identifying common cabbage, which effectively solves the technical problem of rapid and accurate identification of common cabbage.

[0005] Specifically, the technical solution of the present invention is as follows: In one aspect of the present invention, the present invention provides a molecular marker for identifying common cabbage, wherein the molecular marker is a SNP site at 13766456 on chromosome 2 of a cabbage reference genome (version number Brassica oleracea var. oleracea cultivar TO1000v2.1), the nucleotide base at the site is G or A, i.e., A02_13766456G / A, wherein the A:A homozygous type is the genotype of common cabbage, and the G:G homozygous type is the genotype of non-common cabbage; or, the molecular marker is at 13796934 on chromosome 2, the nucleotide base at the site is C or G, i.e., A02_13796934C / G, wherein the C:C homozygous type is the genotype of common cabbage, and the G:G homozygous type is the genotype of non-common cabbage.

[0006] In one aspect of the present invention, the present invention provides SNP primers for identifying common cabbage, wherein the primers are KASP primer pairs for the SNP of the present invention, and each primer pair includes a first forward primer, a second forward primer and a universal reverse primer. Among them, in the primer pair for the A02_13766456G / A site, the base sequence of the first forward primer is shown as SEQ ID NO.1; the base sequence of the second forward primer is shown as SEQ ID NO.2; the base sequence of the universal reverse primer is shown as SEQ ID NO.3; in the primer pair for the A02_13796934C / G site, the base sequence of the first forward primer is shown as SEQ ID NO.4; the base sequence of the second forward primer is shown as SEQ ID NO.5; the base sequence of the universal reverse primer is shown as SEQ ID NO.6.

[0007] In the present invention, the primer pair for the A02_13766456G / A site can be used alone, or the primer pair for the A02_13796934C / G site can be used alone for identification, or the two primer pairs can be used in combination to form a primer set.

[0008] In one aspect of the present invention, a kit for identifying common cabbage is disclosed, and the kit comprises the primer pair provided by the present invention.

[0009] In the above-mentioned SNP primers for identifying common cabbage, as a preferred embodiment, the 5' ends of the first forward primer and the second forward primer in each KASP primer pair are respectively connected to different fluorescent linkers. FAM (carboxyfluorescein) and HEX (hexachlorofluorescein) fluorescence are preferred. Other fluorescence, such as FITC (fluorescein isothiocyanate), TET (tetrachlorofluorescein), JOE (2',7' dimethoxy-4',5' dichloro-5(6) carboxyfluorescein), etc. can also be selected.

[0010] In one aspect of the present invention, the present invention provides the use of the molecular markers and SNP primers described in the present invention in assisting the breeding of common cabbage varieties or identifying whether a cabbage variety is common cabbage.

[0011] In one aspect of the present invention, the present invention provides a method for identifying common cabbage, comprising the following steps: (1) Extraction of genomic DNA from the cabbage samples to be tested; (2) using the genomic DNA of the cabbage sample to be tested as a template, and performing PCR amplification using each primer pair of the SNP primers described in the present invention; (3) Performing fluorescence detection and analysis on the amplified products to obtain the genotype of the SNP site corresponding to the cabbage sample to be tested, thereby determining whether the cabbage variety to be tested is common cabbage; when the genotype of the A02_13766456G / A site is A:A homozygous, the sample to be tested is common cabbage; when it is G:G homozygous, the sample to be tested is non-common cabbage; or / and, when the genotype of the A02_13796934C / G site is G:G homozygous, the sample to be tested is non-common cabbage; when it is C:C homozygous, the sample to be tested is common cabbage.

[0012] In the above method for identifying common cabbage, as a preferred embodiment, the conditions for PCR amplification are: pre-denaturation at 94°C for 15 minutes, denaturation at 94°C for 20 seconds; annealing at 61°C-55°C for 1 minute, for a total of 10 cycles, 61°C is the annealing temperature of the first cycle, and the annealing temperature is reduced by 0.6°C in each subsequent cycle; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 1 minute, for a total of 26 cycles.

[0013] In the above method for identifying common cabbage, as a preferred embodiment, in the primer set, the concentration ratio of the first forward primer, the second forward primer and the universal reverse primer of each primer pair in the PCR system is 2:2:5.

[0014] In the above method for identifying common cabbage, as a preferred embodiment, the concentration of the genomic DNA of the sample to be tested is 10-30 ng / μL.

[0015] The template of the PCR of the present invention is the genomic DNA of the sample to be tested, the agarose electrophoresis band of which should be single without obvious diffusion, the concentration of which should meet 10-30 ng / μL, and the ratio of A260 / A280 in the ultraviolet spectrophotometry detection should be greater than 1.8.

[0016] Beneficial Effects (1) The present invention screened the SNP sites of cabbage varieties based on the vegetable SNP database (http: / / 8.130.55.37 / ) (VegSNPDB website) and found two markers with very obvious population specificity: A02_13766456G / A and A02_13796934C / G.

[0017] (2) The present invention relates to a specific KASP primer pair targeting A02_13766456G / A and A02_13796934C / G, which is used to identify whether 35 kinds of cabbage vegetables are common cabbage. The homozygous genotype detected is completely consistent with the phenotype, providing strong technical support for identifying whether cabbage vegetables are common cabbage.

[0018] (3) The specific amplification primers developed using the SNP loci of the present invention can efficiently and accurately identify common cabbage, which can significantly improve the efficiency of identifying cabbage variety seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of genotyping or KASP amplification of the 35 cabbage varieties tested in Example 2 using the KASP primer pair of the present invention at the SNP21 site are shown in Figure 2 (genotyping diagram), wherein the genotype is common cabbage (A:A genotype, red dots); the genotype is non-common cabbage (G:G genotype, blue dots).

[0020] Figure 2 The results of genotyping or KASP amplification of the 35 cabbage varieties tested in Example 2 using the KASP primer pair of the present invention at the SNP22 site are shown in Figure 2 (genotyping diagram), wherein the genotype is common cabbage (C:C genotype, red dots); the genotype is non-common cabbage (G:G genotype, blue dots).

[0021] Figure 3 The results of genotyping or KASP amplification of the seeds of 60 tested cabbage varieties in Example 3 using the KASP primer pair of the present invention at the SNP21 site are shown in Figure 3 (genotyping diagram), wherein the genotype is common cabbage (A:A genotype, red dots); the genotype is non-common cabbage (G:G genotype, blue dots); and samples with uncertain genotypes (× dots).

[0022] Figure 4The results of genotyping or KASP amplification of the seeds of 60 cabbage varieties to be tested in Example 3 using the KASP primer pair of the present invention at the SNP22 site are shown in Figure 3 (genotyping diagram), wherein the genotype is common cabbage (C:C genotype, red dots); the genotype is non-common cabbage (G:G genotype, blue dots); and the genotype is a heterozygous sample (A:C genotype, green dots). DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The equipment and reagents used in the embodiments and test examples can be obtained from commercial sources unless otherwise specified. Unless otherwise specified, the reagents used in the present invention are all analytical grade reagents. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0024] Example 1: Obtaining a SNP primer combination for identifying a variety belonging to common cabbage 1.1 Discovery of two SNP loci The present invention is based on the SNP sites of cabbage varieties in the Vegetable SNP Database (VegSNPDB) (http: / / 8.130.55.37 / ) of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences. After bioinformatics analysis and feature screening of perfect SNP sites with MAF>0.3, heterozygosity less than 0.1, deletion rate less than 0.1 and conservative 50bp sequences on both wings (no InDel, no SSR, no other SNP), the SNP frequency difference of 2 SNP sites between common cabbage and other cabbage populations is 1.

[0025] The basic information of the two SNP sites is detailed in Table 1. The location of the SNP sites on the chromosome is based on the cabbage reference genome: Brassica oleracea var. oleracea cultivar TO1000 v2.1. Table 1. Basic information of two cabbage-specific non-synonymous SNP loci

[0026] 1.2. Specific SNP primers for identification of common cabbage Based on the two SNP sites found in step 1.1, two pairs of KASP primers were designed and SNP typing was performed on 200 cabbage varieties with known population attributes. Each primer pair includes a first forward primer, a second forward primer and a universal reverse primer, and their sequences are shown in Table 2 below.

[0027] Table 2. Specific SNP primers used to identify common cabbage

[0028] Note: GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence.

[0029] Example 2: Validity test of SNP primer combination The basic information of the 35 tested cabbage varieties in this embodiment is shown in columns 1 to 3 of Table 3 below. Among the 35 varieties, all are market-collected varieties. According to the phenotype, 12 tested varieties are common cabbages, and 23 tested varieties are other cabbage vegetables (cauliflower or broccoli).

[0030] 2.1. Obtaining genomic DNA of test species The genomic DNA of the seedlings of 35 tested varieties (seedlings containing young roots and cotyledons mixed from 30 seeds) were extracted using the CTAB method to obtain the genomic DNA of the tested varieties.

[0031] The quality and concentration of the genomic DNA of the test variety must meet the PCR requirements. The standards are: agarose electrophoresis shows a single DNA band without obvious diffusion; the A260 / A280 ratio detected by the UV spectrophotometer Nanodrop2000 (Thermo) is around 1.8, and the A260 / A230 ratio is greater than 1.8; the concentration of the genomic DNA of the test variety is 10-30ng / μL.

[0032] 2.2 PCR amplification detection of SNP sites The genomic DNA of 35 tested varieties was used as templates, and PCR amplification was performed using the KASP primer pair targeting the SNP site numbered SNP21 (A02_13766456G / A) and the KASP primer pair targeting the SNP site numbered SNP22 (A02_13796934C / G) to obtain the corresponding PCR amplification products. In each PCR reaction system, the concentration ratio of the first forward primer, the second forward primer and the reverse universal primer was 2:2:5.

[0033] The reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, 61°C-55°C (touch down program was used, reducing 0.6°C per cycle) for 1 min, and amplification for 10 cycles; denaturation at 94°C for 20 s, annealing and extension at 55°C for 1 min, and continued amplification for 26 cycles.

[0034] The PCR reagent is: a kit with competitive allele-specific PCR detection capability. In this example, Mastermix of LGC (Part No. KBS-1016-002 for 96 or 384-well plates or Part No. KBS-1016-011 for 1536-well microplates) was used.

[0035] Table 3. PCR reaction system for 384-well plate or 96-well plate

[0036] After completing step 2, when the temperature of each PCR amplification product drops below 40°C, read the fluorescence value through the FAM and HEX beam scanning of the microplate reader (the FAM fluorescent label sequence is observed and read at an excitation light of 485nm and an emission light of 520nm, and the HEX fluorescent label sequence is observed and read at an excitation light of 528nm and an emission light of 560nm). The genotype of each SNP site of the 35 test varieties is determined based on the color of the fluorescent signal. The specific judgment principles are as follows: The PCR results of the sample to be tested based on the SNP21 site: if a blue fluorescent signal is displayed, the genotype of the site is G:G (the same as the last base at the 3' end of the first forward primer of the KASP primer pair at the SNP21 site), and the sample to be tested is judged to be non-ordinary cabbage; if a red fluorescent signal is displayed, the genotype of the site is A:A (the same as the last base at the 3' end of the second forward primer of the KASP primer pair at the SNP21 site), and the sample to be tested is judged to be ordinary cabbage; if a green fluorescent signal is displayed, the genotype of the site is heterozygous, one base is G (the same as the last base at the 3' end of the first forward primer of the KASP primer pair at the SNP21 site), and the other base is A (the same as the last base at the 3' end of the second forward primer of the KASP primer pair at the SNP21 site), and G:A is judged. The statistical results of the genotypes of the 35 test samples based on SNP21 in this embodiment are shown in the fourth column of Table 4 below (part of the results are shown in Figure 1 ).

[0037] When the PCR result of the sample to be tested based on the SNP22 site: a blue fluorescent signal is displayed, the genotype of the site is G:G (same as the last base at the 3' end of the first forward primer of the KASP primer pair at the SNP22 site), and the sample to be tested is judged to be non-ordinary cabbage; a red fluorescent signal is displayed, the genotype of the site is C:C (same as the last base at the 3' end of the second forward primer of the KASP primer pair at the SNP22 site), and the sample to be tested is judged to be ordinary cabbage; a green fluorescent signal is displayed, the genotype of the site is heterozygous, one base is G (same as the last base at the 3' end of the first forward primer of the KASP primer pair at the SNP22 site), and the other base is C (same as the last base at the 3' end of the second forward primer of the KASP primer pair at the SNP22 site), and G:C is judged. The statistical results of the genotypes of the 35 test samples based on SNP22 in this embodiment are shown in the fifth column of Table 4 below (part of the results are shown in Figure 2 ).

[0038] If the fluorescence signal is weak after PCR amplification, which affects data analysis, you can add cycles (denaturation at 94°C for 20 seconds, annealing and extension at 55°C for 1 minute, and 5 cycles) until the fluorescence signal is compactly clustered and the relative fluorescence values ​​of FAM and HEX are between 1 and 2.

[0039] The results shown in Table 4 show that the two primer sets can obtain good typing effects in all 35 tested varieties, and the typing results are highly consistent. For specific consistency data, see Section 2.3 of this Example.

[0040] Table 4. Basic information of 35 tested varieties

[0041] 2.3 Evaluation of the efficiency of two primer pairs in identifying 35 tested varieties as common cabbage (1) Statistics of the genotypes of 35 test varieties based on SNP21.

[0042] The results show that in Table 4 above, there are 12 test varieties based on the SNP21 genotype of A:A homozygous type, which are determined to be common cabbage. According to the phenotypic statistical results of the test samples in the third column of Table 4 above, 12 of them are common cabbage, and the consistency is 100%. In Table 4 above, there are 23 test varieties based on the SNP21 genotype of G:G homozygous type, which are determined to be non-common cabbage; according to the phenotypic statistical results of the test varieties in the third column of Table 4 above, all of these 23 samples are non-common cabbage, and the consistency is 100%. Therefore, according to Table 4 above, it can be seen that in the identification results of 35 test varieties by using the SNP21 primer pair and based on the genotype of the SNP21 locus in this embodiment, the genotype and the phenotype are all consistent. Therefore, the consistency of the results of the identification of common cabbage in 35 test samples by the KASP primer pair for SNP21 and the phenotype is 100%.

[0043] (2) Statistical analysis of the genotypes of 35 tested varieties based on SNP22.

[0044] The results show that in Table 4 above, there are 12 test varieties based on the SNP22 genotype of C:C homozygous type, which are determined to be common cabbage. According to the phenotypic statistical results of the test samples in the third column of Table 4 above, 12 of them are common cabbage, and the consistency is 100%. In Table 4 above, there are 23 test varieties based on the SNP22 genotype of G:G homozygous type, which are determined to be non-common cabbage; according to the phenotypic statistical results of the test varieties in the third column of Table 4 above, it can be seen that all of these 23 samples are non-common cabbage, and the consistency is 100%. Therefore, according to Table 4 above, it can be seen that in the identification results of 35 test varieties based on the SNP22 locus genotype by using the SNP22 primer pair in this embodiment, the genotype and the phenotype are all consistent. Therefore, the consistency of the results of the identification of common cabbage in 35 test samples by the KASP primer pair for SNP22 and the phenotype is 100%.

[0045] It can be seen that the SNP loci and the dedicated primer pairs developed in Example 1 can efficiently and accurately identify whether the variety to be tested is common cabbage, and the genotype linkage degree of SNP21 and SNP22 loci is very high (the result of identifying whether the variety to be tested is common cabbage based on the genotypes of these two SNP loci is completely consistent with the phenotype). In the identification of whether the seeds of cabbage varieties are common cabbage, the KASP primer pair for SNP21 and the KASP primer pair for SNP22 loci can be used as a primer set to identify common cabbage, complement each other, and further improve the accuracy of identifying common cabbage seeds.

[0046] Example 3 Using the SNP primer combination developed in Example 1 to detect whether the tested variety is common cabbage 3.1. Using the primer combination developed in Example 1 for the SNP21 site and the SNP22 site to detect whether the tested variety belongs to common cabbage (1) Obtaining genomic DNA of the species to be tested After grinding the seeds of the tested varieties with liquid nitrogen, the genomic DNA was extracted using the CTAB method to obtain the genomic DNA of the tested varieties.

[0047] (2) Using the genomic DNA of the tested variety as a template, PCR amplification was performed using the KASP primer pair of SNP21 and the KASP primer pair of SNP22 to obtain the corresponding PCR amplification products. In each PCR reaction system, the concentration ratio of the first forward primer, the second forward primer and the universal reverse primer was 2:2:5. The reaction procedure and reagents were the same as in Example 2.

[0048] (3) After completing step (2), when the temperature of each PCR amplification product drops below 40°C, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent label sequence is observed and read at an excitation light wavelength of 485nm and an emission light wavelength of 520nm, and the HEX fluorescent label sequence is observed and read at an excitation light wavelength of 528nm and an emission light wavelength of 560nm), and the color of the fluorescent signal is obtained. According to the method in Example 2, the genotype of the corresponding SNP site is determined, thereby determining whether the variety to be tested is common cabbage.

[0049] The SNP typing results of the 60 tested varieties using the KASP primer pair for SNP21 are shown in Figure 3 ; The SNP typing results of the 60 tested varieties using the KASP primer pair for SNP22 are shown in Figure 4 .

[0050] The statistical results are shown in columns 2-3 of Table 5. The test varieties based on the A:A homozygous genotype of SNP21 and the C:C homozygous genotype of SNP22 were determined to be common cabbage. The test varieties based on the G:G homozygous genotype of SNP21 and the G:G homozygous genotype of SNP22 were determined to be non-common cabbage.

[0051] Table 5. Whether the 60 tested varieties belong to common cabbage

[0052] 3.2. Based on the phenotype, determine whether the variety to be tested is common cabbage.

[0053] The phenotypic statistical results are shown in the fourth column of Table 5.

[0054] The results of this example show that the identification results of the SNP primer combination developed in this experiment are completely consistent with the phenotypic identification results. It can be seen that the SNP primer combination developed in this experiment can detect whether the variety to be tested belongs to common cabbage.

[0055] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the scope of protection determined by the claims submitted for the present invention.

Claims

1. A molecular marker for identifying common cabbage, characterized in that: The molecular marker is a SNP site at 13766456 on chromosome 2 of the cabbage reference genome, and the nucleotide base at the site is G or A, i.e., A02_13766456G / A, wherein the A:A homozygous type is the genotype of common cabbage, and the G:G homozygous type is the genotype of non-common cabbage; or, the molecular marker is at 13796934 on chromosome 2 of the cabbage reference genome, and the nucleotide base at the site is C or G, i.e., A02_13796934C / G, wherein the C:C homozygous type is the genotype of common cabbage, and the G:G homozygous type is the genotype of non-common cabbage.

2. A SNP primer for identifying common cabbage, characterized in that: The primers are KASP primer pairs for the SNP site described in claim 1, and each primer pair includes a first forward primer, a second forward primer and a universal reverse primer; wherein, in the primer pair for the A02_13766456G / A site, the base sequence of the first forward primer is shown as SEQ ID NO.1; the base sequence of the second forward primer is shown as SEQ ID NO.2; the base sequence of the universal reverse primer is shown as SEQ ID NO.3; in the primer pair for the A02_13796934C / G site, the base sequence of the first forward primer is shown as SEQ ID NO.4; the base sequence of the second forward primer is shown as SEQ ID NO.5; and the base sequence of the universal reverse primer is shown as SEQ ID NO.

6.

3. A kit for identifying common cabbage, characterized in that: The kit comprises the primer pair according to claim 2.

4. The use of the molecular marker for identifying common cabbage according to claim 1 and the SNP primer according to claim 2, characterized in that: The molecular marker or SNP primer is used to assist in breeding common cabbage varieties or to identify whether a cabbage variety is a common cabbage.

5. A method for identifying common cabbage, characterized in that: The method comprises: (1) Extraction of genomic DNA from the cabbage samples to be tested; (2) using the genomic DNA of the cabbage sample to be tested as a template, and performing PCR amplification using each primer pair in the primer set forth in claim 2; (3) Performing fluorescence detection and analysis on the amplified product to obtain the genotype of the SNP site corresponding to the tested cabbage sample, thereby determining whether the tested cabbage variety is common cabbage.

6. The method for identifying common cabbage according to claim 5, characterized in that: When the genotype of the A02_13766456G / A site is A:A homozygous, the sample to be tested is common cabbage; when it is G:G homozygous, the sample to be tested is non-common cabbage; or / and, when the genotype of the A02_13796934C / G site is G:G homozygous, the sample to be tested is non-common cabbage; when it is C:C homozygous, the sample to be tested is common cabbage.

7. The method for identifying common cabbage according to claim 5, characterized in that: The conditions for the PCR amplification are as follows: pre-denaturation at 94°C for 15 minutes, denaturation at 94°C for 20 seconds; annealing at 61°C-55°C for 1 minute, for a total of 10 cycles, 61°C is the annealing temperature of the first cycle, and the annealing temperature is reduced by 0.6°C in each subsequent cycle; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 1 minute, for a total of 26 cycles.

8. The method for identifying common cabbage according to claim 5, characterized in that: The concentration ratio of the first forward primer, the second forward primer and the universal reverse primer of the primer pair in the PCR system is 2:2:

5.

9. The method for identifying common cabbage according to claim 5, characterized in that: The concentration of the genomic DNA of the sample to be tested is 10-30 ng / μL, and the ratio of A260 / A280 in ultraviolet spectrophotometry is greater than 1.8.

Images