Antibiotic resistance gene photoelectric detection sensor as well as preparation method and application thereof

Abstract

The invention provides an antibiotic resistance gene photoelectric detection sensor as well as a preparation method and application thereof, and designs a method of taking a Bi2S3 / ZnIn2S4 heterojunction as a photoelectric material and combining with an aptamer to fix an electron donor to construct a biological sensing system for detecting a resistance gene. The system is composed of a catalytic hairpin self-assembly part and a DNAzyme cracking part. Compared with the prior art, the method has the advantages that the electron donor can be fixed through the aptamer, the target object is circularly amplified through a method of catalyzing hairpin self-assembly, the CTX-M-15 quantitative detection can be realized by utilizing the recognition effect between nucleic acids, the operation is simple, and the sensitivity is high.

Description

Technical Field

[0001] The invention belongs to the technical field of environmental detection, and in particular relates to an antibiotic resistance gene photoelectric detection sensor and a preparation method and application thereof. Background Art

[0002] Antibiotic-resistant bacteria that are difficult to treat are becoming more common and have caused a serious global health crisis. Antibiotic resistance is encoded by specific genes, some of which can be transferred between various bacteria via plasmids. The detection of antibiotic resistance genes (ARGs) has good clinical diagnostic value and can provide a reference for doctors to appropriately treat patients with antibiotic resistance in the early stages of bacterial infection, thereby improving the efficacy of antibiotics.

[0003] As emerging pollutants in the environment, antibiotic resistance genes have attracted widespread attention due to their wide spread ability through horizontal gene transmission and environmental persistence, posing a serious threat to ecological security and human health. Resistance genes have the characteristics of "easy to get, hard to lose" and exist in various environmental media, such as air, soil and wastewater. In addition, different types of resistance genes may often coexist in the same area, leading to the emergence of multi-drug resistant bacteria, posing a greater threat to human health.

[0004] However, existing conventional methods for detecting ARGs mainly rely on metagenomic sequencing and polymerase chain reaction (PCR, such as quantitative PCR and droplet digital PCR). Although they are accurate and reliable measurement methods, these analyses also require expensive instruments, trained professionals, and complex thermal cycles. This hinders the applicability of on-site environmental monitoring, especially in resource-limited areas.

[0005] Photoelectrochemical (PEC) sensing is a new sensing technology that combines the PEC process with the target recognition reaction and has developed rapidly in the field of analytical detection. Therefore, it is necessary to provide a novel, efficient and convenient PEC strategy to achieve photoelectric detection of antibiotic resistance genes. Summary of the invention

[0006] The purpose of the present invention is to provide an antibiotic resistance gene photoelectric detection sensor and a preparation method thereof, wherein an electron donor is fixed by an aptamer, and a target is cyclically amplified by a catalytic hairpin self-assembly method, and the recognition effect between nucleic acids can be used to achieve quantitative detection of CTX-M-15, and the operation is simple, the sensitivity is high, and it is convenient and efficient.

[0007] The present invention also provides an application of an antibiotic resistance gene photoelectric detection sensor for detecting the resistance gene CTX-M-15.

[0008] The specific technical solutions of the present invention are as follows:

[0009] A method for preparing an antibiotic resistance gene photoelectric detection sensor comprises the following steps:

[0010] 1) Bi2S3 / ZnIn2S4 (BZ) material is aminated, dispersed in water to prepare a solution, and then dripped onto an ITO electrode to prepare a BZ / ITO electrode;

[0011] 2) Place the hairpin DNA H P The electrode was placed in a mixed solution containing N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) for activation. Subsequently, the resulting solution was dropped onto the BZ / ITO electrode and incubated to obtain H P / BZ / ITO electrode;

[0012] 3) Add a series of different concentrations of antibiotic resistance genes to the mixture of DNA H1, DNA H2 and DNA H3, and react; then, drop the resulting mixture onto H P / BZ / ITO electrode, reaction;

[0013] 4) reacting the electrode prepared in step 4) with a buffer solution containing 0.1 mL of dopamine DA 20 mM to obtain DA / Apt DA / BZ / ITO electrode;

[0014] 5) Under xenon lamp irradiation, DA / Apt DA The / BZ / ITO electrode was subjected to photoelectrochemical (PEC) detection in Tris-HCl solution to establish a linear relationship between the PEC signal intensity of the electrode and the concentration of antibiotic resistance genes, thereby achieving quantitative detection of antibiotic resistance genes.

[0015] The preparation method of the Bi2S3 / ZnIn2S4 material in step 1) is:

[0016] 1-1) Mix 1,3,5-benzenetricarboxylic acid H3BTC and Bi(NO3)3·5H2O, add methanol, heat to react, separate, wash, and dry to obtain Bi-MOFs;

[0017] 1-2) Dispersing Bi-MOFs in a mixed solvent of water and glycerol, stirring and mixing, adjusting the pH value to 2.5, and then sequentially adding InCl3·4H2O, ZnCl2 and thioacetamide, heating for reaction, separating, washing and drying to obtain Bi2S3 / ZnIn2S4 material;

[0018] In step 1-1), the mass ratio of 1,3,5-benzenetricarboxylic acid H3BTC and Bi(NO3)3·5H2O is 5:1;

[0019] In step 1-1), the dosage ratio of 1,3,5-benzenetricarboxylic acid to methanol is 0.012-0.015 g / mL;

[0020] In step 1-1), the heating reaction refers to a reaction at 120° C. for 24 hours; preferably, in a Teflon tube, the reaction is carried out at 120° C. for 24 hours, and the precipitate is collected by centrifugation, washed with methanol, and dried at 60° C. overnight to obtain Bi-MOFs;

[0021] In step 1-2), the volume ratio of water to glycerol is 4:1;

[0022] In step 1-2), the dosage ratio of Bi-MOFs to the mixed solvent of water and glycerol is 0.01 g / mL;

[0023] In step 1-2), the molar ratio of InCl3·4H2O, ZnCl2 and thioacetamide is 2:1:4;

[0024] In step 1-2), the dosage ratio of Bi-MOFs and InCl3·4H2O is 1:4 g / mmol;

[0025] In step 1-2), the heating reaction refers to reacting at 80°C for 2 hours; preferably, the reaction is carried out at 80°C for 2 hours in a Teflon-lined autoclave, and the resulting product is repeatedly washed with deionized water and ethanol, and dried at 60°C overnight to obtain Bi2S3 / ZnIn2S4 material.

[0026] Preferably, the Bi2S3 / ZnIn2S4 material preparation method is:

[0027] 1-1) After mixing 0.75 g H3BTC and 0.15 g Bi(NO3)3·5H2O, 60 mL methanol was added and the mixture was stirred at room temperature for 30 minutes; the reaction mixture was heated to 120°C for 24 hours under sealed conditions; the precipitate was collected by centrifugation, washed with methanol, and dried at 60°C overnight;

[0028] 1-2) 0.1 g Bi-MOFs was dispersed in a mixed solution of 8.0 mL water and 2.0 mL glycerol, stirred for 0.5 h, 1 mM HCl solution was added to adjust the pH to 2.5, and then 0.4 mmol InCl3·4H2O, 0.2 mmol ZnCl2 and 0.8 mmol thioacetamide (TAA) were added in sequence; the mixture was reacted in an oil bath at 80 ° C for 2 h, and then the black solid was collected by centrifugation, washed with deionized water and anhydrous ethanol, and then dried in an oven at 60 ° C overnight to obtain Bi2S3 / ZnIn2S4 material, referred to as BZ.

[0029] The Bi2S3 / ZnIn2S4 material is subjected to amination:

[0030] The Bi2S3 / ZnIn2S4 material is dispersed in N,N-dimethylformamide DMF, (3-aminopropyl)triethoxysilane APTES is added, heated to reflux, the product is collected and dried, and the surface functionalized Bi2S3 / ZnIn2S4 material with amine groups is obtained, referred to as BZ-NH2;

[0031] The dosage ratio of the Bi2S3 / ZnIn2S4 material and N,N-dimethylformamide is 6-7 mg / mL;

[0032] The volume ratio of N,N-dimethylformamide to (3-aminopropyl)triethoxysilane is 75:1;

[0033] The heating reflux refers to reflux reaction at 120°C for 2h;

[0034] Preferably, the Bi2S3 / ZnIn2S4 material is subjected to amination by:

[0035] 100 mg of BZ was dispersed in 15 mL of N,N-dimethylformamide (DMF), and then 200 μL of (3-aminopropyl)triethoxysilane (APTES) was added and refluxed at 120 °C for 2 h. The product was collected and dried at 60 °C for 12 h to obtain surface-functionalized BZ with amine groups (BZ-NH2).

[0036] In step 2), the hairpin DNA P The gene sequence is:

[0037] 5'-COOH-TTTTGCTGCAGTGAGGTGTGGACGCTTACTAT / rA / GCATAGGACCACAGGTCAATGCAGC-3'; the sequence is shown in SEQ ID NO.1; it contains a split aptamer DNA that can specifically recognize dopamine;

[0038] In step 3), the antibiotic resistance gene is CTX-M-15;

[0039] In step 3), in the obtained mixture, the concentrations of DNA H1, DNA H2 and DNA H3 are all 50 nM;

[0040] Step 3) is preferably: H PAfter the / BZ / ITO electrode was lightly washed, a series of different concentrations of CTX-M-15 (from 0.1 fM to 1.0 nM) were added to the mixed solution of DNAH1, DNAH2 and DNAH3, respectively. The concentrations of DNAH1, DNAH2 and DNAH3 in the mixed solution were all 50 nM. The reaction was carried out at 25 °C for 2 h. Subsequently, the obtained mixed solution was dropped onto H P / BZ / ITO electrode and reacted at 25°C for 30 min.

[0041] In step 3), the gene sequence of DNAH1 is:

[0042] 5'-CATCTCTTCAGCGATGGAAGATACGAAGGTATTAATTCGTATCTTCCAGAATAAGATCACCCATGTTAGTTAGT-3'; the sequence is shown in SEQ ID NO.2;

[0043] In step 3), the gene sequence of the DNA H2 is: 5'-CATCTCTTCACGCGATTACTTATTCTGGAAGATACGAAGAACCAGAATAAGTATAATCC TTCCCACCCATCTTAGT-3'; the sequence is shown in SEQ ID NO.3;

[0044] In step 3), the gene sequence of the DNA H3 is:

[0045] 5'-CATCTCTTCAGCGATGGAAGGATTATACTTATTCTGGTTCACATTAATCCTTCGTATCTTCCAGCACCCAT-3'; the sequence is shown in SEQ ID NO.4;

[0046] In step 4), a buffer solution containing 0.1 mL of dopamine DA20 mM was reacted with the electrode prepared in step 3) for 30 minutes to induce DA-Apt DA Complex generation; preparation of DA / Apt DA / BZ / ITO electrode; then the electrode is thoroughly washed with buffer; the obtained modified electrode can be used for electrochemical and photoelectrochemical measurements.

[0047] In step 5), under irradiation of a xenon lamp at λ>420nm, a Tris-HCl solution of 5mL, 0.1M, pH 7.4 was tested.

[0048] The antibiotic resistance gene photoelectric detection sensor provided by the present invention is prepared by adopting the above method.

[0049] The application of an antibiotic resistance gene photoelectric detection sensor provided by the present invention is used to detect the resistance gene CTX-M-15 and realize quantitative detection. The detection method is:

[0050] The sensor prepared as above is used to detect the sample to be detected, and the quantitative detection of CTX-M-15 is achieved based on the obtained electrical signal and the linear relationship.

[0051] The linear relationship is Y = 1.020X + 8.145, R 2 =0.9916; Y is the photocurrent, the unit is μA, X is the logarithm of the concentration of the target, the concentration unit is nM. The detection range is: 0.1fM to 1.0nM; the detection limit is: 3.24aM.

[0052] In the present invention, all DNA chains were diluted in annealing buffer (150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.4).

[0053] All PEC detection processes were conducted under the irradiation of a xenon lamp with λ>420nm and a Tris-HCl solution of 5mL, 0.1M, pH7.4.

[0054] To achieve PEC detection, in general, the photoelectric conversion efficiency of the material can be improved by adjusting the structure and morphology of the interface or doping. In addition, electron donors such as ascorbic acid (AA) and dopamine (DA) are usually dissolved into the test solution to further accelerate the generation of photoelectrons to obtain a strong PEC signal. However, high concentrations of electron donors are required to overcome the double layer and diffusion effects of the sensing interface. This can lead to unstable photocurrent, high background, reagent waste, and biochemical interface contamination.

[0055] The present invention designs a biosensor system for detecting resistance genes by using Bi2S3 / ZnIn2S4 heterojunction as a photoelectric material and combining it with an aptamer to fix an electron donor. The system consists of two parts: catalytic hairpin self-assembly and DNAzyme cleavage. In the presence of the resistance gene CTX-M-15, it hybridizes with the complementary sequence of H1 and unfolds H1 to produce a T-H1 assembly, and its newly exposed binding domain then opens H2 to produce a T-H1-H2 complex. The newly exposed T-H1-H2 domain can then react with H3 to form a complex with three Mg at the ends of H1, H2 and H3. 2+ The CHA product of the DNA-dependent enzyme can release a large number of initiating T sequences, and each T copy can be used in the reverse direction for the CHA assembly process, generating a continuous positive feedback. Subsequently, the DNA enzyme connects to the H immobilized on the BZ / ITO electrode. p Substrate hairpin hybridization, in Mg 2+ions, can cleave H at the rA site p To release the Split-1 sequence. In addition, trivalent DNAzyme can effectively cleave H p To release a large amount of Split-1, Split-1 can bond with a large number of DA molecules and combine with Split-2 to generate a large amount of current signals for high-sensitivity photoelectrochemical identification of ARGs. The gene sequence of Split-1 is: 5'-COOH-CGACGCCAGTTTGAAGGTTCG-3'; as shown in SEQ ID NO.5; the gene sequence of Split-2 is: 5'-TTCGCAGGTGTGGAGTGACGTCG-3; as shown in SEQ ID NO.6; the gene sequence of the T sequence is: CTTATTCTGGAAGATACGAA, as shown in SEQ ID NO.7.

[0056] The inventors found that it is desirable to introduce electron donors in a reasonable and effective manner to further enhance the PEC signal. Constructing a method based on aptamer-fixed electron donors to enhance the photoelectric signal intensity and using it for the detection of antibiotic resistance genes has broad application prospects. The aptamer-induced spatially confined electron donor provided by the present invention enables the Bi2S3 / ZnIn2S4 heterojunction coating electrode to be used in the photoelectrochemical detection method of antibiotic resistance genes. Enhancing the PEC signal by spatially confining electron donors through aptamers assembled by Bi2S3 / ZnIn2S4 heterojunctions is a novel method that can effectively and sensitively improve the photoelectric conversion efficiency. This progress is expected to stimulate more interest in the development of bioanalysis.

[0057] Compared with the prior art, the method for detecting antibiotic resistance genes constructed by the method of the present invention can fix the electron donor through the aptamer, and cyclically amplify the target through the method of catalytic hairpin self-assembly, and the quantitative detection of CTX-M-15 can be achieved by utilizing the recognition between nucleic acids, and the operation is simple and the sensitivity is high. The present invention avoids the strong background signal caused by adding high-concentration electron donor reagents to the PEC test solution. The electron donor and aptamer existing alone cannot trigger the catalytic hybrid self-assembly and DNAzyme cleavage reaction. It is a novel method to enhance the PEC signal by spatially restricting the electron donor using the aptamer assembled by Bi2S3 / ZnIn2S4 heterojunction, which can effectively and sensitively improve the photoelectric conversion efficiency. This progress is expected to stimulate more interest in the development of bioanalysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 It is a comparison diagram of the PEC response with and without aptamer limiting the electron donor;

[0059] Figure 2Schematic diagram of the present invention for detecting ARGs by anchoring electron donors on the electrode surface;

[0060] Figure 3 The test diagrams of the products prepared by the present invention include: (A) SEM image of BZ, (B) TEM image of BZ, (C) elemental mapping of BZ, (D) HRTEM image, (E) powder XRD patterns of BS, BZ and ZIS, (F) XPS measurement spectrum of BZ, (G) PEC response of BS, BZ and ZIS;

[0061] Figure 4 To verify the EIS, CV and PEC test diagrams of the electrodes in ASED, the A- and B- diagrams are bare electrode, BZ / ITO, Apt DA / BZ / ITO and DA / Apt DA EIS curve and CV curve of / BZ / ITO, C-bare ITO, BZ / ITO, Apt / BZ / ITO, DA / Apt DA PEC response of / BZ / ITO and DA (5 nM) in solution;

[0062] Figure 5 For detection, calibration, and selectivity testing; A-PEC response in tris-HCl containing different concentrations of DA, and the corresponding calibration curve for DA analysis, (B)-Stability of the PEC sensor in the presence of 8 nM DA with continuous light off for 15 cycles, and (C)-Selectivity of the sensor;

[0063] Figure 6 Electrode test diagram for resistance gene detection experiment; (A) - EIS diagram of different electrodes; (B) - PEC test with Split-2, DA and target T as variables while other detection conditions remain unchanged; and (C) - Polyacrylamide gel electrophoresis verifies the feasibility of the CHA system;

[0064] Figure 7 Detection diagram; (A) - PEC response in tris-HCl containing different concentrations of target (from 0.1fM to 1.0nM), (B) - linear correlation curve of ARGs analysis, inset: corresponding calibration curve of ARGs sensor, (C) - stability of PEC sensor in the presence of 25pM target and continuous switching light for 20 cycles, and (D) - selectivity of the prepared sensor for detection of different targets;

[0065] Figure 8 A possible electron transfer mechanism for the ASED strategy. DETAILED DESCRIPTION

[0066] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0067] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0068] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0069] In the present invention, all DNA chains were diluted in annealing buffer (150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.4) before use. P The solvents of DNAH1, DNAH2 and DNAH3 solutions were all buffer (150 mM NaCl, 10 mM Tris, 10 mM MgCl2·6H2O, pH=7.4).

[0070] All PEC detection processes were conducted under the irradiation of a xenon lamp with λ>420nm and a Tris-HCl solution of 5mL, 0.1M, pH7.4.

[0071] The present invention prepares Bi2S3 and ZnIn2S4 for comparison:

[0072] Method for preparing Bi2S3: 1.82g Bi(NO3)3·5H2O, 1.35g Na2S·9H2O and 1.92g urea are added to 75mL ethylene glycol (EG) solution and stirred vigorously for 20 minutes; the resulting mixture is then transferred to an autoclave lined with Teflon and heated at 180°C for 24 hours; the resulting product is repeatedly washed with deionized water and ethanol and dried at 60°C overnight to obtain Bi2S3, referred to as BS.

[0073] The preparation method of ZnIn2S4 is:

[0074] 1.317 g Zn(C2H3O2)2·2H2O, 2.654 g InCl3, and 2.404 g TAA were dissolved in 500 mL deionized water under ultrasonic treatment for 20 min; then, the obtained solution was sealed and placed in a 100°C oven for 7 h, and the yellow precipitate was collected by centrifugation, washed three times with deionized water, and then dried in a vacuum freeze-drying equipment for 24 h to obtain ZnIn2S4, referred to as ZIS.

[0075] Example 1

[0076] A method for preparing an antibiotic resistance gene photoelectric detection sensor comprises the following steps:

[0077] 1) H3BTC (0.75 g) and Bi(NO3)3 5H2O (0.15 g) were added to a 100 mL reactor; methanol (60 mL) was then added and the mixture was vigorously stirred at room temperature for 30 minutes. The reactor was then placed in a steel shell, sealed, and heated to 120°C for 24 hours. The precipitate was collected by centrifugation, washed three times with methanol, and dried at 60°C overnight to obtain Bi-MOFs;

[0078] 2) The synthesized Bi-MOFs (0.1 g) were dispersed in a mixed solution of 8.0 mL of water and 2.0 mL of glycerol, stirred for 0.5 h, and after adding 1 mM HCl solution to adjust the pH to 2.5, 0.4 mmol InCl3·4H2O, 0.2 mmol ZnCl2, and 0.8 mmol thioacetamide (TAA) were added in sequence; the mixture was reacted at 80 °C in an oil bath for 2 h, and then the black solid was collected by centrifugation, washed with deionized water and anhydrous ethanol, and then dried in an oven at 60 °C overnight; Bi2S3 / ZnIn2S4 (BZ) was obtained; and a one-pot synthesis of BZ heterojunction was achieved;

[0079] 3) 100 mg of BZ was dispersed in 15 mL of N,N-dimethylformamide (DMF), and then 200 μL of (3-aminopropyl)triethoxysilane (APTES) was added and refluxed at 120°C for 2 hours; the product was collected and dried at 60°C for 12 hours to obtain surface functionalized BZ (BZ-NH2) with amine groups, realizing the amination reaction of the BZ heterojunction.

[0080] 4) The BZ-NH2 material was dispersed in deionized water to prepare a Bi2S3 / ZnIn2S4 solution with a concentration of 3 mg / mL. 0.05 mL of the solution was first dripped on an ITO electrode and dried at 60°C, and then 0.05 ml was dripped on an ITO electrode and dried at 60°C to prepare a BZ / ITO electrode.

[0081] 5) Add 60 μL (100 μM) hairpin DNA HP The solution was placed in a 20 mg mL -1 N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and 200 mg mL -1 The mixed solution (1 mL) of N-hydroxysuccinimide (NHS) was activated for 0.5 h at 4 °C to activate the carboxyl groups. Subsequently, the resulting solution was dropped onto the electrode and incubated for 12 h to obtain H P / BZ / ITO electrode;

[0082] 6) H P After the / BZ / ITO electrode was rinsed three times with Tris-HCl buffer solution (0.2mM pH = 7.4), a series of different concentrations (from 0.1fM to 1.0nM) of the target CTX-M-15 were added to the solution containing DNAH1 (50nM), DNAH2 (50nM) and DNAH3 (50nM) (the solvent is annealing buffer solution, 150mM NaCl, 10mM Tris, 10mM MgCl2·6H2O, pH = 7.4), and reacted at 25°C for 2h. Subsequently, 0.1mL of the prepared mixed solution was dropped onto the electrode prepared in step 5) and reacted at 25°C for 30 minutes;

[0083] 7) 0.1 mL of 20 mM Tirs-HCl buffer containing DA (0.2 mM) was reacted with the electrode prepared in step 6) and incubated for 30 minutes to obtain DA / Apt DA / BZ / ITO electrode, wash the electrode thoroughly with buffer.

[0084] 8) The corresponding electrodes were immersed in a solution containing 5.0 mM [Fe(CN)6] 3- / 4- Cyclic voltammetry (CV) was performed at different scan rates in 5 mL Tris-HCl solution containing 0.1 M KCl and 10.0 mM [Fe(CN)6] 3- and [Fe(CN)6] 4- Electrochemical impedance spectroscopy (EIS) was performed on different electrodes in 0.1 M KCl of solution. PEC measurements were performed in Tris-HCl solution (5 mL, 0.1 M, pH 7.4) under irradiation with a xenon lamp (λ>420 nm).

[0085] The aptamer-induced spatially restricted electron donor strategy is called (ASED); the verification of the ASED strategy of the present invention includes the following steps:

[0086] 1) The Bi2S3 / ZnIn2S4 (BZ) material prepared by the same method as above is aminated, dispersed in water to prepare a solution, and then dripped onto an ITO electrode to prepare a BZ / ITO electrode;

[0087] 2) 60 μL (100 μM) of the aptamer Split-1 was placed in a mixed solution (1 mL) containing 20 mg·mL-1 N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and 200 mg·mL-1 N-hydroxysuccinimide (NHS) for activation for 0.5 h to activate the carboxyl group at 4°C. Subsequently, the above solution was dropped onto the electrode and incubated for 12 h;

[0088] 3) 60 μL (100 μM) of aptamer Split-2 buffer was reacted with the electrode prepared in step 2) for 30 min to prepare Apt DA / BZ / ITO electrode;

[0089] 4) 0.1 mL of buffer solution containing different concentrations of dopamine DA (1-14 nM) was reacted with the electrode prepared in step 3) for 30 minutes to induce DA-Apt DA Complex generation; preparation of DA / Apt DA / BZ / ITO electrode. Photoelectrochemical (PEC) detection was carried out in Tris-HCl solution under xenon lamp irradiation to establish a linear relationship between the PEC signal intensity of the electrode and the dopamine concentration, thereby verifying the feasibility of the ASED system.

[0090] Figure 1 The figure shows a comparison of the PEC response diagrams with and without aptamer-restricted electron donors. It can be seen from the figure that compared with adding electron donors to the solution, using aptamers to fix electron donors can effectively enhance the photoelectric signal.

[0091] Figure 2 Schematic diagram of the present invention for detecting ARGs by anchoring electron donors on the electrode surface. First, the modified H p (containing Split-1 sequence) containing H p In the presence of the resistance gene CTX-M-15(T), the / BZ / ITO electrode hybridizes with the complementary sequence of H1 and unfolds H1 to produce a T-H1 assembly, whose newly exposed binding domain then opens H2 to produce a T-H1-H2 complex. The newly exposed T-H1-H2 domain can then react with H3 to form a complex with three Mg at the ends of H1, H2, and H3. 2+ The CHA product of the DNA-dependent enzyme can release a large number of initiating T sequences, and each T copy can be used in the reverse direction for the CHA assembly process, generating a continuous positive feedback. Subsequently, the DNA enzyme connects to the H immobilized on the BZ / ITO electrode. p Substrate hairpin hybridization, in Mg 2+ ions, can cleave H at the rA site pTo release the Split-1 sequence and obtain Apt DA / BZ / ITO electrode. In addition, trivalent DNAzyme can effectively cleave H p To release a large amount of Split-1, Split-1 can bind to a large number of DA molecules and combine with Split-2 to form an aptamer-DA complex electrode (DA / Apt DA / BZ / ITO electrode) generates a large amount of current signal, which is used for high-sensitivity photoelectrochemical identification of ARGs.

[0092] Figure 3 The test diagram of the product prepared by the present invention: (A)-SEM image of BZ, (B)-TEM image of BZ, (C)-element mapping diagram of BZ, (D) BZ-HRTEM image, (E)-powder XRD patterns of BS, BZ and ZIS, (F)-XPS measurement spectrum of BZ, (G)-PEC response of BS, BZ and ZIS. Among them, BS material was dispersed in deionized water to prepare BS solution (3 mg / mL), and BS / ITO electrode was prepared. ZIS material was dispersed in deionized water to prepare ZIS solution (3 mg / mL), and ZIS / ITO electrode was prepared for testing.

[0093] Figure 3 In the one-pot synthesis using Bi-MOF as a template, the BZ heterojunction exhibited a columnar morphology composed of thin sheets ( Figure 3 Middle A and Figure 3 (B). The corresponding element mapping image of BZ shows that bismuth, indium, zinc, and sulfur atoms are uniformly dispersed throughout the matrix ( Figure 3 In addition, the high-resolution transmission electron microscopy (HRTEM) image of BZ shows two lattice fringes of 0.188 and 0.359 nm ( Figure 3 D), which are assigned to the (113) crystal plane of ZIS and the (130) crystal plane of BS, respectively. The diffraction peaks of the BZ heterojunction match well with the hexagonal phase of high-purity BS (JCPDS-17-0320), indicating the complete transformation of Bi-MOF to BS. No characteristic peaks of Bi-MOF were found, while the peaks corresponding to ZIS (JCPDS-65-2023) were obvious, reflecting the successful construction of the BZ heterojunction ( Figure 3 E). The composition and chemical state of the chemical elements on the BZ surface were determined by X-ray photoelectron spectroscopy (XPS). The full spectrum of BZ reflects the presence of elements Bi, S, Zn, and In. The above results together confirm that a tight and uniform interface connection is constructed between ZIS and BS. The PEC signal of the BZ electrode is significantly enhanced compared with the pure BS and ZIS electrodes. This may be due to the highest separation efficiency of photogenerated carriers in the BZ heterostructure.

[0094] Figure 4 During the modification process, the impedance gradually increased and the CV gradually decreased, which proved that the DA detection platform was successfully prepared. Compared with the BZ / ITO electrode, DA was confined to the electrode surface, and a larger PEC change could be seen. When DA was added to the test solution, the PEC signal intensity increased relative to the BZ / ITO electrode, but it was still lower than anchoring it on the electrode surface. This shows that modifying the aptamer on the electrode surface can effectively confine the electron donor to the electrode surface, and the distance between the electron donor and the PEC electrode is greatly reduced. This further highlights the advantage of fixed electron donors to the PEC system, and effectively avoids the waste of electron donors, effectively enhancing the PEC signal. Among them, by immersing the corresponding electrode in a solution containing 5.0 mM [Fe(CN)6] 3- / 4- Cyclic voltammetry (CV) was performed at a scan rate of 0.1 mV / s in 5 mL Tris-HCl solution containing 0.1 M KCl. 3- / 4- Electrochemical impedance spectroscopy (EIS) was performed on different electrodes in 0.1 M KCl solution; the process parameters for testing the photocurrent were consistent, and PEC measurements were performed in Tris-HCl solution (5 mL, 0.1 M, pH 7.4) under irradiation with a xenon lamp (λ>420 nm).

[0095] Figure 5 It can be seen that a good linear relationship was obtained when the DA concentration ranged from 1 to 14 nM ( Figure 5 The obtained repetitive photocurrent response for 15 alternating “on-off” cycles of photocurrent shows the good stability of the proposed platform ( Figure 5 (B). Therefore, the PEC platform based on confined aptamers is a promising candidate for enhancing PEC signals. In order to study the selectivity of this PEC sensor, several electron donors such as AA, L-cys, NaCl, resorcinol, H2O2, HQ and GA were selected as interfering analytes. Mix is ​​a mixture of AA, L-cys, NaCl, resorcinol, H2O2, HQ, GA and DA. The concentration of these interfering substances is 20 nM. Figure 5 As shown in C, even at a concentration 2.5 times higher than that of the target DA, the non-target molecules only produced a relatively low photocurrent response, which is basically consistent with the blank group. Therefore, the PEC platform based on confined aptamers on electrodes is a promising candidate for enhancing PEC signals.

[0096] Figure 6 The results in Figure 5A show that bare ITO shows a small Ret. When Hp is fixed on the electrode, Ret increases, which is attributed to the H p The negative charge on the phosphate backbone repels [Fe(CN)6]3- / 4- However, with the addition of CTX-M-15 and DA into the system, Ret gradually increased. The EIS results not only confirmed the successful assembly process but also preliminarily demonstrated the feasibility of this sensing strategy. Figure 6 Figure B is obtained by performing PEC tests with Split-2, DA, and target T as variables, while other detection conditions remain unchanged. This further shows that only when dopamine, target T, and split-2 are present at the same time will a significant photocurrent signal be generated. In contrast, no matter which one is missing, the photocurrent signal has only a small or negligible change. In addition, Figure 6 Figure C shows the feasibility of the CHA system verified by polyacrylamide gel electrophoresis. The mixture of H1, H2 and H3 showed three obvious mixed bands (lane b) because the three hairpins did not hybridize (lane ce). Incubation of T with the mixture of H1, H2 and H3 resulted in the formation of a new band (lane f) with a highly reduced electrophoretic mobility and a reduced intensity of the hairpin band, indicating that T triggered the assembly of the three hairpins. These results indicate that the trivalent DNAzymes structure is capable of ultrasensitive monitoring of T. Among them, at room temperature, in the presence of 5.0 mM [Fe(CN)6] 3- / 4- Electrochemical impedance spectroscopy (EIS) was performed on different electrodes in 0.1 M KCl solution; the process parameters for testing the photocurrent were consistent, and PEC measurements were performed in Tris-HCl solution (5 mL, 0.1 M, pH 7.4) under irradiation with a xenon lamp (λ>420 nm).

[0097] Figure 7 To detect the figure (A) - PEC response in Tris-HCl containing different concentrations of target (from 0.1fM to 1.0nM), (B) - linear correlation curve of ARGs analysis, inset: corresponding calibration curve of ARGs sensor, (C) - stability of PEC sensor in the presence of 25pM target and continuous switching light for 20 cycles, and (D) - selectivity of the prepared sensor for detection of different targets. The PEC response gradually increases with the increase of CTX-M-15 concentration. It was observed that the current has a good linear relationship with the logarithm of the target CTX-M-15 concentration, ranging from 0.1fM to 1.0nM. I (μA) = 1.020lgC was obtained. Target +8.145(R 2 =0.9916), C Target The unit is nm; when the signal-to-noise ratio is 3 (S / N=3), the detection limit drops to 3.24aM.

[0098] Figure 7To demonstrate the reliability of the ASED sensing plane model, the stability of the PEC biosensing platform was investigated. Within 400 seconds, the change in the photocurrent was negligible, providing evidence for the excellent stability of this design strategy. In addition, to investigate the specificity of the proposed biosensor, the PEC response of the biosensor to CTX-M-15 was compared with other ARGs, including tetA, tetC, tetG, tetD, single base mismatch (1-mut), double base mismatch (2-mut), triple base mismatch (3-mut), and a mixture of these sequences under the same experimental conditions. The concentration of other ARGs was 10 times (100nM) that of CTX-M-15 (10pM). The PEC response of other ARGs (except CTX-M-15) showed slight changes compared with the blank (background signal without ARG). However, in the presence of the target, the PEC response increased significantly, indicating that the biosensor has good specificity for the target CTX-M-15. The PEC response values ​​of 1-mut, 2-mut, and 3-mut were nearly 0.75, 0.70, and 0.41 times lower than those of CTX-M-15, respectively, indicating that the developed biosensor was able to distinguish single-base, double-base mismatch, and triple-base mismatch sequences from the target sequence.

[0099] Figure 8 Possible electron transfer mechanisms for the ASED strategy. Under visible light illumination, electron-hole pairs are generated by the BZ heterojunction. The conduction band (CB) of ZnIn2S4 is more negative than that of Bi2S3, which is conducive to the transfer of photogenerated electrons from the CB of ZnIn2S4 to the CB of Bi2S3, and photogenerated holes from the VB of ZnIn2S4 to the VB of Bi2S3. Specifically, the electron donor DA interacts with the accumulated holes on ZnIn2S4, increasing the rate of hole depletion and thus enhancing the photocurrent response.

[0100] Example 2

[0101] The application of an antibiotic resistance gene photoelectric detection sensor provided by the present invention is used to detect resistance genes, specifically:

[0102] The sensor prepared in the above embodiment is used to detect the sample to be detected. According to the obtained electrical signal, the linear relationship is used to achieve the quantitative detection of CTX-M-15. The detection results are shown in Table 1. Table 1 The actual sample detection table of the resistance gene in different water samples determined by the method of the present invention

[0103]

[0104] This invention reports for the first time an aptamer-induced spatially restricted electron donor strategy for enhancing the biosensing of PEC signals. First, the present invention successfully synthesized a porous layered heterojunction functional material Bi2S3 / ZnIn2S4 (BZ) with enhanced interfacial charge transfer capability. As a conductive layer, the BZ heterojunction has a large number of active sites, providing excellent electronic conductivity, superior electronic absorption and transport properties, and broadening the absorption range of light. Through the design of the material and the introduction of the ASED strategy, it is demonstrated that this method can effectively enhance the photoelectric signal by about 22 times. In addition, in order to expand the universality of the ASED strategy, the catalytic hairpin assembly (CHA) and DNAzyme were combined and successfully applied to the detection of antibiotic resistance genes (ARGs). BZ as a PEC material combined with the ASED strategy achieves ultrasensitive detection of ARGs.

[0105] The present invention integrates aptamer-fixed electron donors, catalytic hybrid self-assembly and DNAzyme cleavage reaction, which not only proves that aptamer-fixed electron donors can effectively enhance photoelectric signals, but also, compared with other detection technologies, the anchored donor strategy can overcome the shortcomings of traditional PEC detection, reduce the detection background, shorten the distance between the sacrificial agent and the semiconductor, amplify the photocurrent signal, and improve the stability of the PEC system.

[0106] The description of the above embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. A method for preparing an antibiotic resistance gene photoelectric detection sensor, characterized in that: The preparation method comprises the following steps: 1) After Bi2S3 / ZnIn2S4 material is aminated, it is dispersed in water to prepare a solution, and then dripped onto an ITO electrode to prepare a BZ / ITO electrode; 2) Place the hairpin DNA H P The electrode was placed in a mixed solution containing N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide for activation. Subsequently, the obtained solution was dropped onto the BZ / ITO electrode and incubated to obtain H P / BZ / ITO electrode; 3) Add a series of different concentrations of antibiotic resistance genes to the mixture of DNA H1, DNA H2 and DNA H3, and react; then, drop the resulting mixture onto H P / BZ / ITO electrode, reaction; 4) reacting the electrode prepared in step 4) with a buffer solution containing 0.1 mL of dopamine DA 20 mM to obtain DA / Apt DA / BZ / ITO electrode; 5) Under xenon lamp irradiation, DA / Apt DA The / BZ / ITO electrode was used for photoelectrochemical detection in Tris-HCl solution to establish a linear relationship between the PEC signal intensity of the electrode and the concentration of antibiotic resistance genes, thereby achieving quantitative detection of antibiotic resistance genes.

2. The preparation method according to claim 1, characterized in that: The preparation method of the Bi2S3 / ZnIn2S4 material in step 1) is: 1-1) Mix 1,3,5-benzenetricarboxylic acid H3BTC and Bi(NO3)3·5H2O, add methanol, heat to react, separate, wash, and dry to obtain Bi-MOFs; 1-2) Disperse Bi-MOFs in a mixed solvent of water and glycerol, stir and mix, adjust the pH value to 2.5, then add InCl3·4H2O, ZnCl2 and thioacetamide in sequence, heat to react, separate, wash and dry to obtain Bi2S3 / ZnIn2S4 material.

3. The preparation method according to claim 1, characterized in that: The Bi2S3 / ZnIn2S4 material is subjected to amination: The Bi2S3 / ZnIn2S4 material is dispersed in N,N-dimethylformamide DMF, (3-aminopropyl)triethoxysilane APTES is added, heated to reflux, the product is collected and dried, and a surface functionalized Bi2S3 / ZnIn2S4 material with an amine group is obtained.

4. The preparation method according to claim 1, characterized in that: In step 2), the hairpin DNA P The gene sequence is shown in SEQ ID NO.

1.

5. The preparation method according to claim 1, characterized in that: In step 3), the gene sequence of the DNAH1 is shown as SEQ ID NO.

2.

6. The preparation method according to claim 1, characterized in that: In step 3), the gene sequence of DNAH2 is shown as SEQ ID NO.

3.

7. The preparation method according to claim 1, characterized in that: In step 3), the gene sequence of the DNA H3 is shown as SEQ ID NO.

4.

8. The preparation method according to claim 1, characterized in that: The linear relationship in step 4) is Y=1.020X+8.145, R 2 =0.9916; Y is the photocurrent, the unit is μA, and X is the logarithm of the target concentration.

9. An antibiotic resistance gene photoelectric detection sensor, prepared by the preparation method according to any one of claims 1 to 8.

10. An application of an antibiotic resistance gene photoelectric detection sensor for detecting the resistance gene CTX-M-15 to achieve quantitative detection. The detection method is: using the sensor prepared as above to detect the sample to be detected, and based on the obtained electrical signal, using a linear relationship to achieve quantitative detection of CTX-M-15.

Images