Preparation method and application of bivalent feline calicivirus VLP vaccine

Abstract

The invention discloses a preparation method and application of a bivalent feline calicivirus VLP vaccine, an insect cell endogenous molecular chaperone protein HSP60 is creatively utilized to construct a recombinant plasmid co-expressing HSP60 and FCV VP1, and the expression quantity of VP1 is successfully improved, the expression quantity of GII VP1 is improved by 9.2 times, and the expression quantity of GI VP1 is improved by 17 times. By screening assembly buffer solutions with different salt ion concentrations, pH values and components, the assembly conditions of GI VLP and GII VLP are optimized, and the yield and yield of VLP are improved. Animal model evaluation shows that the bivalent VLP vaccine has an immune synergistic effect, the immune effect of the bivalent VLP vaccine is remarkably superior to that of a monovalent VLP vaccine and a commercially available inactivated vaccine, the same immune effect of a high dose can be achieved by a low dose of the bivalent VLP vaccine, the antigen dose demand is reduced by 4-8 times, meanwhile, protection on two FCV types is provided, and a new direction is provided for research and development of FCV vaccines.

Description

Technical Field

[0001] The invention belongs to the technical field of feline calicivirus vaccines and relates to a preparation method and application of a bivalent feline calicivirus VLP vaccine. Background Art

[0002] FCV can infect cats and wild cats of all ages. The main sources of infection are sick cats and latent carriers. In the acute phase, sick cats can excrete a large amount of virus with eye and nasal secretions and excrement, contaminating cages, the ground, etc., and can also be directly transmitted to susceptible cats. Latent carriers generally develop from acute cases. Although clinical symptoms disappear, they can excrete virus intermittently for a long time, which seriously endangers public health. FCV mainly proliferates in the mouth and respiratory tract of infected animals. Healthy cats are usually infected through direct contact with secretions of sick or infected cats or contaminated food, drinking water, etc. The virus persists in the environment for up to 1 month, with a typical incubation period of 3 to 4 days, during which short-term viremia may occur. Feline calicivirus (FCV) can cause upper respiratory tract infections in cats, mainly in kittens under 1 year old, and most classic FCV reported cases are benign. However, recently, ultra-high-virulence strains of FCV have emerged, which can cause severe virulent systemic disease (VSD), which is acute and life-threatening in nature. The main symptoms of VSD are systemic infections such as ulcerative dermatitis, acute arthritis, enteritis, abortion, lameness, etc. The mortality rate of VSD is as high as 50%. VSD poses a serious threat to public health and the safety of felines. FCV is also highly contagious, and sick cats are one of the main sources of infection. However, healthy cats infected with the virus (asymptomatic) can continue to excrete the virus for months to years as carriers, which is one of the main factors leading to the high prevalence of VSD.

[0003] Feline Calicivirus (FCV) belongs to the Caliciviridae family and the Herpesvirus genus. It is a non-enveloped single-stranded positive-stranded non-segmented RNA virus. The diameter of the virus particle is 35nm-39nm, and the nucleocapsid is icosahedral symmetric. The FCV genome size is about 7.7kb and contains three open reading frames (ORFs). Among them, ORF1 encodes non-structural proteins, and ORF2 encodes the VP1 capsid protein precursor, including 6 regions from A to F. Region A is highly conserved (1aa-125aa), while regions B (126aa-397aa), D (402aa-426aa) and F are relatively conservative; region E (427aa-524aa) contains the main B cell epitopes, and its variability is the basis for distinguishing isolates by base sequence. The C region (398aa-401aa) and the E region are hypervariable regions. The E region is divided into three regions, and the central relatively conservative region separates the 5′ hypervariable region and the 3′ hypervariable region. The 5′ hypervariable region and the C region of the E region are involved in the neutralization of the virus, and their variability is the reason why most FCV strains have low cross-protection. The F region (525aa-668aa) is located at the highly conserved carboxyl end of the capsid protein. ORF3 mainly encodes the minor capsid protein VP2. Among them, the VP1 capsid protein of FCV has most of the neutralizing antibody epitopes and is the main antibody immunity point. Since the VP1 capsid protein precursor structure is divided into six regions AF, among which the A region is located at the amino N-terminus of VP1 and is cut off during the formation of the capsid protein, the complete capsid protein VP1 is mainly composed of the BF region (126aa-668aa). Genetic evolution and phylogenetic analysis based on the structural protein VP1 showed that FCV is mainly divided into two genotypes: GI type and GII type. GI genotype strains are ubiquitous worldwide, but all GII genotype strains are from Asia, with obvious geographical characteristics. This may form resistance to FCV prevention in Asia. In vitro neutralization experiments with mouse sera showed that cross-protection was different for different strains. Therefore, it is crucial to develop a bivalent vaccine against GI and GII types, which is conducive to inducing broad-spectrum immunity to FCV, thereby protecting against different epidemic strains and reducing the infection rate of cats to FCV.

[0004] The vaccines currently on the market for the prevention and control of feline calicivirus (FCV) are mainly divided into inactivated vaccines and live attenuated vaccines. However, these vaccines have some limitations. Taking the imported cat trivalent vaccine "Miao Sanduo" as an example, the FCV strain used in it has low nucleotide and amino acid homology with the domestic prevalent strain, resulting in its unsatisfactory immune effect on FCV in China. In addition, inactivated vaccines and live attenuated vaccines can only reduce the severity of symptoms of feline herpesvirus and FCV, but cannot prevent infection, which means that even vaccinated cats may still be infected with FCV and continue to excrete the virus to the outside world, becoming a potential source of infection. Although the domestic cat trivalent vaccine selected the domestic prevalent strain during research and development, there may be a problem of insufficient antigenic adaptability, that is, the strain in the vaccine may not match the domestic prevalent FCV strain enough, which may affect the protective effect of the vaccine. In general, the current inactivated vaccines mainly target the GII genotype, but with the evolution of the GI genotype, it is particularly important to develop a bivalent vaccine.

[0005] In contrast, virus-like particle (VLP) vaccines, as a new type of vaccine, have significant advantages. VLP vaccines are immunogenic at low doses and can mimic real virus structures, unlike inactivated vaccines, whose structural proteins may be modified during the inactivation process, resulting in impaired immunogenicity. Compared with live attenuated vaccines, VLP vaccines are more stable and easy to store and transport because they do not need to maintain the activity of active organisms. Since VLPs lack viral genetic material, they are not infectious, which reduces the risk of viral transmission after vaccination. The production process of VLP vaccines can be faster. Compared with traditional vaccines, the synthesis method of VLP vaccines is faster. A new VLP vaccine against a specific strain can be prepared within 8-10 weeks after sequencing the specific strain, while traditional vaccines usually require a 24-32 week manufacturing process. Therefore, VLP vaccines for FCV deserve further development and research as a new type of vaccine.

[0006] In Chinese patent CN108371710A, a method for preparing a combined vaccine for feline infectious rhinoconjunctivitis and feline panleukopenia using a baculovirus expression system is proposed. This method attempts to express the VP1 protein of FCV through Sf9 cells, but the main problem faced is insufficient expression, which poses a challenge to the commercial production and cost control of future vaccines. Another patent, CN113896773B, discloses a method for preparing a VLP vaccine by co-expressing the VP1 and VP2 proteins of FCV using an insect-baculovirus expression system. However, multi-protein co-assembly brings complexity in production and quality control, and studies have shown that a single structural protein VP1 already contains sufficient neutralization sites, so it may be sufficient to express only the VP1 protein. Summary of the invention

[0007] In order to overcome the above technical problems, the present invention provides a preparation method and application of a bivalent feline calicivirus VLP vaccine. Animal model evaluation shows that the bivalent VLP vaccine has an immune synergistic effect, and its immune effect is significantly better than that of a monovalent VLP vaccine and a commercially available inactivated vaccine; further, a low-dose bivalent VLP vaccine can achieve the same immune effect as a high-dose, reducing the antigen dose requirement by 4-8 times; further, the present invention innovatively utilizes the endogenous molecular chaperone protein HSP60 of insect cells to construct a recombinant plasmid that co-expresses HSP60 and FCV VP1, and successfully increases the expression of VP1, of which GIIVP1 increases by 9.2 times and GI VP1 increases by 17 times; further, by screening assembly buffers with different salt ion concentrations, pH values ​​and components, the assembly conditions of GI VLP and GII VLP are optimized, and the yield and yield of VLP are increased; at the same time, protection against two FCV typing is provided, which significantly improves the economy and practicality of the vaccine, provides a new direction for the development of FCV vaccines, and provides an effective strategy for the industrial production and quality control of vaccines.

[0008] The purpose of the present invention can be achieved by the following scheme:

[0009] In a first aspect, the present invention provides a bivalent feline calicivirus VLP vaccine comprising FCV GI VP1 and FCV GI IVP1.

[0010] As an embodiment of the present invention, the amino acid sequence of the FCV GI VP1 is shown as SEQ ID NO: 1, and the amino acid sequence of the FCV GII VP1 is shown as SEQ ID NO: 3.

[0011] As an embodiment of the present invention, the FCV GI VP1 or FCV GII VP1 is obtained by utilizing the molecular chaperone gene of insect cells to construct a recombinant plasmid that co-expresses the molecular chaperone gene of insect cells and FCV GI VP1, or the molecular chaperone gene of insect cells and FCV GII VP1, and then purifying it after transformation, transfection, infection, etc.

[0012] As an embodiment of the present invention, the VLP vaccine further comprises an adjuvant, and the adjuvant comprises aluminum hydroxide.

[0013] Further, the content of FCV GI VP1 is 2.5-20 μg per dose, and the content of FCV GII VP1 is 2.5-20 μg per dose. Preferably, the content of FCV GI VP1 is 2.5-5 μg per dose, and the content of FCV GII VP1 is 2.5-5 μg per dose. More preferably, the content of FCV GI VP1 is 2.5 μg per dose, and the content of FCV GII VP1 is 2.5 μg per dose.

[0014] In a second aspect, the present invention provides a method for preparing a bivalent feline calicivirus VLP vaccine, comprising the following steps:

[0015] S1, cloning the FCV GI VP1 gene and the molecular chaperone gene of insect cells, and the FCV GII VP1 gene and the molecular chaperone gene of insect cells into vectors respectively to obtain recombinant vectors;

[0016] S2, transforming the recombinant vector into DH10Bac cells to obtain recombinant Bacmid;

[0017] S3, transfecting insect cells with the recombinant Bacmid to obtain recombinant virus;

[0018] S4. Infect insect cells with the recombinant virus, freeze and thaw, collect the supernatant by centrifugation, and purify to obtain FCV GI VP1 and FCV GII VP1, which are the VLP vaccines.

[0019] As an embodiment of the present invention, in step S1, the nucleotide sequence of the FCV GI VP1 gene is shown as SEQ ID NO: 2, and the nucleotide sequence of the FCV GII VP1 gene is shown as SEQ ID NO: 4.

[0020] As an embodiment of the present invention, in step S1, the molecular chaperone gene of the insect cell includes any one of HSP70, HSP60, HSP40, Grp75, and Grp78.

[0021] Preferably, the molecular chaperone gene of the insect cell is the HSP60 gene, and the nucleotide sequence of the HSP60 gene is shown in SEQ ID NO:6.

[0022] Furthermore, the amino acid sequence of the protein encoded by the HSP60 gene is shown in SEQ ID NO:5.

[0023] As an embodiment of the present invention, in step S1, the vector includes any one of a pFastBac vector and a pFastBac-Dual vector.

[0024] In step S2 of the present invention, the recombinant Bacmid is identified by using the blue-white screening method.

[0025] As an embodiment of the present invention, in step S3, the insect cells include insect Sf9 cells.

[0026] As an embodiment of the present invention, in step S4, the insect cells include insect H5 cells.

[0027] As an embodiment of the present invention, in step S3, the recombinant virus infects insect cells at an MOI of 0.1-1 to achieve high-level expression of FCV GI VP1 and FCV GII VP1 proteins.

[0028] As an embodiment of the present invention, in step S4, the purification includes preliminary purification and gel filtration chromatography.

[0029] Furthermore, the preliminary purification is performed by precipitation using ammonium sulfate.

[0030] Furthermore, the buffer used in the gel filtration chromatography includes the following components: 25-70 mM Tris-HCl, 100-500 mM NaCl, 0.3-2% Tween 80, and / or 0.5-5 mM EDTA, with a pH of 6.0-8.0.

[0031] Preferably, the buffer comprises the following components: 50 mM Tris-HCl, 100-500 mM NaCl, 0.3-2% Tween 80, and / or 0.5-5 mM EDTA, with a pH of 6.0-8.0.

[0032] More preferably, the buffer comprises the following components: 50 mM Tris-HCl, 200 mM NaCl, 0.3% Tween 80, pH 7.0;

[0033] Alternatively, the buffer comprises the following components: 50 mM Tris-HCl, 200 mM NaCl, 0.3% Tween 80, 5 mM EDTA, and pH 6.0.

[0034] In a third aspect, the present invention provides a use of the VLP vaccine in the preparation of a medicament for treating and / or preventing bivalent feline calicivirus.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1. When evaluating the bivalent VLP vaccine of the present invention in an animal model, the present invention unexpectedly discovered that the mixture of GI VLP and GII VLP can produce an immune synergistic effect, making the immune effect of the bivalent VLP vaccine significantly better than that of the monovalent VLP vaccine, and surpassing the inactivated vaccines currently on the market.

[0037] 2. Furthermore, the present invention also optimizes the dosage of the bivalent VLP vaccine. Studies have found that even low doses of bivalent VLP vaccines can produce the same immune effect as high doses, and are significantly better than monovalent VLP vaccines. This means that the present invention can reduce the antigen dose by 4-8 times while obtaining a stronger immune response. This optimization not only reduces the antigen dose required for vaccine production, but also provides protection against two FCV typing pathogens, which is of great significance to the economy and practicality of the vaccine.

[0038] 3. Furthermore, the present invention innovatively utilizes the endogenous molecular chaperone protein HSP60 of insect cells and successfully constructs a recombinant plasmid that can co-express HSP60 and FCV VP1 in insect cells. By packaging into a recombinant (baculo) virus, the present invention achieves a significant increase in the expression of VP1, with GII VP1 increased by 9.2 times and GI VP1 increased by up to 17 times.

[0039] 4. Furthermore, the present invention optimizes the assembly conditions of GI VLP and GII VLP by systematically screening assembly buffers with different salt ion concentrations, different pH values ​​and different components, thereby increasing the yield and yield of VLP. This step is crucial to ensure the stability and immunogenicity of VLP.

[0040] 5. The present invention provides an efficient and economical method for preparing FCV VLP vaccine, and verifies its significant advantages in immune effect through experiments, providing a new direction for the research and development of FCV vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0042] Figure 1 This is a schematic diagram of the plasmid construction in Example 1;

[0043] Figure 2 The following are gel electrophoresis diagrams for verifying the restriction digestion of the plasmid in Example 1; wherein A is the electrophoresis result of GI VP1 after restriction digestion, B is the electrophoresis result of GII VP1 after restriction digestion, and C is the electrophoresis result of HSP60 after restriction digestion;

[0044] Figure 3The electrophoresis identification diagrams of protein expression and purification of cells infected with different recombinant baculoviruses in Example 2; wherein A is the SDS-PAGE electrophoresis identification result of the target protein, and B is the SDS-PAGE electrophoresis identification result of the purified protein sample;

[0045] Figure 4 This is a quantitative analysis diagram of the expression of different recombinant viral proteins in Example 2;

[0046] Figure 5 This is a transmission electron microscopy image of the purified VLP in Example 2;

[0047] Figure 6 Graph showing the assembly efficiency of GI and GII VLPs in different assembly solutions in Example 3;

[0048] Figure 7 This is a statistical chart of the OD450 of vaccine sera from different experimental groups in Example 4. DETAILED DESCRIPTION

[0049] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, provide detailed implementation methods and specific operation processes, and will help those skilled in the art to further understand the present invention. It should be pointed out that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made under the premise of the concept of the present invention all belong to the protection scope of the present invention.

[0050] In the embodiments of the present invention, VLP is referred to as VP1.

[0051] Example 1 Target gene construction and verification

[0052] The FCV GI VP1 gene, FCVGII VP1 gene, insect cell molecular chaperone protein HSP60 gene, molecules co-expressing FCV GI VP1 and HSP60, and molecules co-expressing FCV GII VP1 and HSP60 were synthesized by Nanjing GenScript Biotechnology Co., Ltd. after insect cell codon optimization, and cloned into the pFastBac-Dual vector, respectively. The restriction sites for the VP1 gene construction are BamHI and HindIII, and the restriction sites for the molecular chaperone protein HSP60 construction are preferably Xho I and KpnI. The schematic diagram of plasmid construction is shown in Figure 1. The molecular chaperone proteins of insect cells include HSP70, HSP60, HSP40, Grp75 and Grp78. In this embodiment, the molecular chaperone is preferably HSP60. Among them, the FCV GI VP1 amino acid sequence selects the latest prevalent strain, the amino acid sequence is SEQ ID NO: 1, and the optimized codon nucleotide sequence is SEQ ID NO: 2; the FCV GIIVP1 amino acid sequence selects the latest prevalent strain, the amino acid sequence is SEQ ID NO: 3, and the optimized codon nucleotide sequence is SEQ ID NO: 4. The amino acid sequence of the molecular chaperone HSP60 of insect cells is SEQ ID NO: 5, and the optimized codon nucleotide sequence is SEQ ID NO: 6. After the plasmid is constructed, the plasmid is extracted using a plasmid extraction kit, and then enzyme digestion verification is performed, and 1% agarose gel electrophoresis is used for verification. The verification results are shown in Figure 2 . Figure 2 A and Figure 2 B The electrophoresis results after digestion with BamHI and HindIII showed that GI VP1 and GII VP1 were successfully constructed in pFastBac-Dual; Figure 2 C The recombinant plasmid was digested with Xho I and Kpn I, indicating that HSP60 was successfully constructed in pFastBac-Dual.

[0053] Example 2 Screening and protein expression, purification and characterization of recombinant Bacmid

[0054] (1) Transformation of DH10Bac E. coli cells: The pFastBac-Dual vector containing the exogenous gene was transformed into DH10Bac E. coli competent cells (competent cells purchased from Shanghai Weidi Biotechnology Co., Ltd., CAT#: DL1071), which contain a bacmid with a mini-attTn7 target sequence and a helper plasmid.

[0055] (2) PCR screening and identification of single clones. The recombinant bacmid was identified using the blue-white screening method. White colonies were selected from plates treated with less than 1% IPTG and X-gal. Six colonies were selected for each single clone. A single white colony was inoculated into LB medium containing 50 μg / ml kanamycin, 7 μg / ml gentamicin, and 10 μg / ml tetracycline. After overnight culture, a monoclonal bacterial solution was obtained. PCR was used to verify the exogenous gene on the recombinant bacmid. The PCR primer was the M13 upstream primer.

[0056] (CCCAGTCACGACGTTGTAAAACG, SEQ ID NO: 7) and M13 downstream primer (AGCGGATAACAATTTCACACAGG, SEQ ID NO: 8). The PCR reaction system is as follows:

[0057] Table 1 PCR reaction system

[0058] M13 upstream primer (10 μM) 1μL M13 downstream primer (10 μM) 1μL Template (monoclonal bacterial solution) 1μL PCR Mix (5X) 4μL Sterile water (add to a total volume of 20 μL) 13μL

[0059] (3) Bacmid transfection and virus packaging. Insect Sf9 cells were cultured in serum-free medium using Gibco's Grace's insect cell culture medium. When the cells reached an appropriate density (2.5x10 6 cells / mL), the recombinant Bacmid DNA was transfected into insect Sf9 cells using Lipofectin transfection reagent, and the cells were cultured to detect cell survival rate, cell size and other indicators. The primary virus (P1) was collected and filtered using a 0.45μm filter, and used to infect more insect cells to prepare a higher titer virus (P2). After 72-96h, the recombinant virus containing the target gene was collected according to the cell state.

[0060] (4) Protein expression and purification. The recombinant virus was inoculated into H5 cells at an MOI of 0.1-1, and the mixture was collected after 4-5 days to obtain a protein mixture expressing GI VP1 and GII VP1, and a protein mixture co-expressing HSP60 and GI VP1, and HSP60 and GIIVP1; SDS-PAGE was used for electrophoresis to identify the target protein ( Figure 3 A). Collect the cell mixture after expression, freeze-thaw the cells once, centrifuge at 5000rpm for 10 minutes to collect the protein supernatant for purification. First use 40% ammonium sulfate for precipitation to aggregate the protein, then centrifuge after 30 minutes to collect the protein precipitate, then use a buffer containing 20% ​​ammonium sulfate (50mM Tris, 200mM NaCl, PH7.4) to resuspend the protein precipitate, then centrifuge at 5000rpm for 10 minutes to collect the protein precipitate, and finally use a buffer (50mM Tris, 200mM NaCl, PH7.4) to dissolve the protein to obtain a crude protein sample. The crude protein sample is then purified by VLP using gel filtration chromatography to remove impurities and free monomeric proteins, and the purified protein sample is identified by SDS-PAGE electrophoresis ( Figure 3 B), the electrophoresis results showed that the purification of GI VLP and GII VLP could reach more than 98%. Then the protein expression under different conditions was quantitatively analyzed ( Figure 4 ).

[0061] (5) VLP characterization and identification. The purified VLP protein was tested for particle size using a Malvern particle sizer. The morphology of the VLP was recorded and photographed using a transmission electron microscope after negative staining. The negative staining method is as follows: dilute the protein sample to a concentration of 100 ng / mL, then drop 3-5 μL of the sample solution onto the hydrophilic treated sample carrier, incubate for 1-1.5 min, wash twice with ultrapure water (5 μL), and then stain with staining solution (5 μL) for 0.5-1 min. Use filter paper to absorb excess solution from the side in each step. After air drying, it can be used for observation on the machine. Figure 4 The experimental data showed that the quantification of proteins showed that the experimental group co-expressing VP1 and HSP60 could increase the expression of GI and GII by 17 and 9.2 times, respectively. Therefore, the subsequent VLP expression preferred the co-expression strategy of VP1 and HSP60. Transmission electron microscopy was used to observe that GI VLP and GII VLP were complete and highly uniform virus-like particles with good dispersibility and uniform particle size ( Figure 5 ). These results confirm the potential of this system in efficient expression and preparation of VLPs, and provide a solid foundation for future vaccine development and biopharmaceutical applications. In this embodiment, the MOI of the recombinant virus co-expressing GI VP1 and HSP60 is 0.6; the MOI of the recombinant virus co-expressing GII VP1 and HSP60 is 0.8. The strategy of co-expressing VP1 and HSP60 preferably uses a pFastBac-Dual vector for simultaneous expression. When the recombinant virus is used to infect insect cells, the insect cells are H5 cells.

[0062] Example 3 Screening of Self-Assembled VLP Buffer Solution

[0063] First, the GI VP1 and GII VP1 samples were crudely stored using the ammonium sulfate precipitation method in step (4) of Example 2, and the crude GI VP1 and GII VP1 samples were equally divided into 18 portions and further purified using gel filtration chromatography (also known as size exclusion chromatography). Gel filtration chromatography separates molecules based on their size. Large molecules cannot enter the gel pores and are eluted first, while small molecules are delayed in elution due to entering the pores. Chromatography was performed under the same conditions using the different solutions listed in Table 2 to find the protein solution that is most suitable for high assembly efficiency of GI VLP and GII VLP. These solutions may contain different buffers, salt concentrations, and pH values ​​to optimize the stability and assembly of VLP. Calculation and statistical analysis of protein peak areas ( Figure 6). The protein peak area data after treatment with different solutions were collected by the chromatography system and statistically analyzed. Then, the efficiency of VLP vaccine assembly was judged by the area of ​​the chromatography peak to determine the buffer that is most conducive to VLP assembly. According to the experimental results, when the assembly buffer of GI VLP is solution 3-2 (50mM Tris-HCl, 200mM NaCl, 0.3% Tween 80, pH7.0) and the assembly buffer of GII VLP is solution 4-1 (50mM Tris-HCl, 200mM NaCl, 0.3% Tween 80, 5mM EDTA, pH6.0), it is conducive to VLP assembly.

[0064] Table 2 Summary of the composition of different solutions

[0065]

[0066]

[0067] Example 4 Evaluation of the immunogenicity of a bivalent FCV VLP vaccine

[0068] (1) Sample preparation: After protein quantification, FCV GI VLP and FCV GII VLP were mixed with aluminum hydroxide adjuvant in a 1:1 ratio to achieve a protein concentration of 250 μg / mL in the vaccine. It is expected that each injection will immunize 20 μg of VLP protein. At the same time, different vaccine doses were set for different bivalent vaccines for comparison.

[0069] (2) Animal model selection: Thirty female BALB / c mice aged 6-8 weeks were selected and randomly divided into 7 groups, with 6 mice in each group. The grouping is shown in Table 3.

[0070] Table 3 Vaccine grouping

[0071] Group No. Group content G1 PBS group G2 GI VLP (20 μg) + adjuvant G3 GII VLP (20 μg) + adjuvant G4 GI VLP(20μg)+GII VLP(20μg)+adjuvant G5 GI VLP(10μg)+GII VLP(10μg)+adjuvant G6 GI VLP(5μg)+GII VLP(5μg)+adjuvant G7 GI VLP(2.5μg)+GII VLP(2.5μg)+adjuvant G8 Myoglobin inactivated vaccine group.

[0072] (3) Immunization procedure: Mice were immunized subcutaneously on days 0 and 14 to simulate the actual vaccination procedure.

[0073] (4) Sample collection: On the 21st day, blood was collected from the eyeball and centrifuged at 2000 rpm for 5 minutes to collect serum samples for subsequent antibody level testing.

[0074] (5) ELISA test (antibody levels of vaccines in different groups; ELISA is a qualitative or quantitative detection technique that uses antibodies to bind and determine target molecules and is suitable for single sample detection or high-throughput screening): 1 μg / mL of GIVLP and GII.2VLP were coated on 96-well ELISA plates, respectively, with a coating buffer of 0.05 M carbonate buffer (pH 9.6), 100 μL per well, and incubated at 4°C overnight; on the next day, the coating solution was discarded, all ELISA wells were filled with washing solution, and the plates were wrapped with gauze and toilet paper to dry, and washed three times; 250 μl of blocking solution (pH 9.6, 0.05 mol / L carbonate buffer containing 2.0% BSA) was added to each well of the ELISA plate, and the plate was placed in a wet box, or incubated at 37°C for 2 h; the blocking solution was discarded, and the plates were washed three times as above; the sera from different groups were diluted with antibody diluent (0.02 mol / L PBS + 0.2% BSA, PH7.4) was diluted 10000 times, and then 100 μL was added to each well of a 96-well plate, and a blank group was set up at the same time, and incubated at 37°C for 1 hour; washed 3 times, as above; 100 μL of enzyme-labeled secondary antibody (sheep anti-mouse) diluted at a multiple of 1:3000 was added to each well, and incubated in a humidified box at 37°C for 1 hour; washed 3 times, as above; 50 μL of A and B solution were added to each well, and the enzyme-linked plate was placed in a humidified box to avoid light for about 3 minutes, and the negative control well was terminated when it showed blue-green color. At the end, 50 μL of 2 mol / L concentrated sulfuric acid was added to each well; after termination, the OD405 value of each well of the enzyme-linked plate was quickly measured with an enzyme reader and counted ( Figure 7 ).

[0075] Experimental results analysis:

[0076] (1) Experimental data showed that the ELISA test of monovalent GI VLP and GII VLP at a dilution of 1:10000 showed that their OD450 values ​​were much higher than those of the inactivated vaccine group. This result indicated that the VLP vaccine has high immunogenicity and can effectively activate humoral immunity.

[0077] (2) Synergistic effect of bivalent vaccines. More significantly, the OD450 levels of the bivalent vaccine groups (G4, G5, G6, and G7) were much higher than those of the monovalent vaccine groups. This result suggests that the bivalent VLP vaccines may have a synergistic effect after mixing and can significantly enhance the immune response.

[0078] (3) Dose effect analysis. There was no significant statistical difference between different doses of the bivalent vaccine, indicating that even a low dose of the bivalent vaccine can induce a stronger immune response than the monovalent vaccine. This finding means that the cost of the vaccine can be reduced while maintaining the immune effect.

[0079] (4) Antigen dose optimization. Taking the G6 and G7 groups as an example, the bivalent VLP vaccine can reduce the antigen dose by 4-8 times compared with the monovalent vaccine, but can obtain a better immune response. This not only reduces the required antigen dose, but also provides protection against two types of pathogens, which is of great significance to the economics and practicality of the vaccine.

[0080] In summary, the experimental results of the present invention not only confirm the advantages of the bivalent FCV VLP vaccine in immune response, but also provide important data support for future vaccine development and application. These findings emphasize the potential of the bivalent VLP vaccine in reducing costs and improving immune effects, laying a solid foundation for the further development and clinical application of the vaccine.

[0081] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A bivalent feline calicivirus VLP vaccine, characterized in that Contains FCV GI VP1, FCV GII VP1.

2. The VLP vaccine according to claim 1, characterized in that The amino acid sequence of the FCV GI VP1 is shown in SEQ ID NO: 1, and the amino acid sequence of the FCV GII VP1 is shown in SEQ ID NO: 3; the FCV GI VP1 or FCVGII VP1 is obtained by utilizing the molecular chaperone gene of insect cells to construct a recombinant plasmid that co-expresses the molecular chaperone gene of insect cells and FCVGI VP1, or the molecular chaperone gene of insect cells and FCV GII VP1, and then purifying it after transformation, transfection, infection, and purification.

3. The VLP vaccine according to claim 1, characterized in that The VLP vaccine further comprises an adjuvant, which comprises aluminum hydroxide; the content of the FCV GI VP1 is 2.5-20 μg per dose, and the content of the FCV GII VP1 is 2.5-20 μg per dose.

4. The VLP vaccine according to claim 3, characterized in that The content of the FCV GI VP1 is 2.5-5 μg per dose, and the content of the FCV GII VP1 is 2.5-5 μg per dose.

5. A method for preparing the VLP vaccine according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1, cloning the FCV GI VP1 gene and the molecular chaperone gene of insect cells, and the FCV GII VP1 gene and the molecular chaperone gene of insect cells into vectors respectively to obtain recombinant vectors; S2, transforming the recombinant vector into DH10Bac cells to obtain recombinant Bacmid; S3, transfecting insect cells with the recombinant Bacmid to obtain recombinant virus; S4. Infect insect cells with the recombinant virus, freeze and thaw, collect the supernatant by centrifugation, and purify to obtain FCV GI VP1 and FCVGII VP1, which are the VLP vaccines.

6. The preparation method according to claim 5, characterized in that: In step S1, the nucleotide sequence of the FCV GI VP1 gene is shown in SEQ ID NO: 2, and the nucleotide sequence of the FCV GII VP1 gene is shown in SEQ ID NO: 4; the molecular chaperone gene of the insect cell includes any one of HSP70, HSP60, HSP40, Grp75, and Grp78.

7. The preparation method according to claim 6, characterized in that: The molecular chaperone gene of the insect cell is the HSP60 gene, the nucleotide sequence of the HSP60 gene is shown in SEQ ID NO:6, and the amino acid sequence of the protein encoded by the HSP60 gene is shown in SEQ ID NO:

5.

8. The preparation method according to claim 5, characterized in that: In step S3, the insect cells include insect Sf9 cells; In step S4, the insect cells include insect H5 cells; In step S4, the purification includes preliminary purification and gel filtration chromatography, and the buffer used in the gel filtration chromatography includes the following components: 25-70mM Tris-HCl, 100-500mM NaCl, 0.3-2% Tween 80, and / or 0.5-5mM EDTA, with a pH of 6.0-8.

0.

9. The preparation method according to claim 8, characterized in that: The buffer comprises the following components: 50 mM Tris-HCl, 200 mM NaCl, 0.3% Tween 80, pH 7.0; Alternatively, the buffer comprises the following components: 50 mM Tris-HCl, 200 mM NaCl, 0.3% Tween 80, 5 mM EDTA, and pH 6.

0.

10. Use of a VLP vaccine as described in any one of claims 1 to 4, or a VLP vaccine obtained by the preparation method as described in any one of claims 5 to 9 in the preparation of a medicine for treating and / or preventing bivalent feline calicivirus.

Images