Anti-human MMP-9 antibody and detection kit thereof

Abstract

The invention discloses an anti-human MMP-9 antibody and a detection kit thereof. The antibody comprises a heavy chain variable region and a light chain variable region, amino acid sequences of antigen complementary determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region are respectively shown as SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, and amino acid sequences of antigen complementary determining regions CDR1, CDR2 and CDR3 of the light chain variable region are respectively shown as SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9. In addition, the invention also discloses a detection kit containing the antibody, and the kit has excellent cross reactivity resistance during MMP-9 detection, and the positive-negative coincidence rate of the detection result is good.

Description

Technical Field

[0001] The invention belongs to the field of cellular immunology and molecular biology, and relates to an antibody against human MMP-9 and a detection kit thereof. Background Art

[0002] Matrix Metalloproteinases (MMPs) are widely present in various tissues of the body and are a class of proteins with Ca 2+ ~Zn 2+ An endogenous protease system that is ion-dependent and can hydrolyze the extracellular matrix (ECM). MMPs include collagenase, gelatinase, stromelysin (SL), etc. Collagenase includes MMP-1, MMP-8, MMP-13 and MMP-18; MMP-2 and MMP-9 are gelatinases; stromelysin includes MMP-3, MMP-10 and MMP-11; there are also some membrane-type MMPs and other types of MMPs.

[0003] Gelatinases MMP-2 and MMP-9 are two types of gelatinases in the MMPs family. They are the most widely distributed in the body and are currently the two most studied subtypes. MMP-2 plays a very important role in basement membrane degradation, wound healing and tissue repair. MMP-9 plays an important role in cell differentiation and tissue damage repair. Under physiological conditions, the amount of MMP-2 and MMP-9 expressed in tissues is extremely small, and inflammatory cytokines, hormones, growth factors, etc. can change their transcription levels.

[0004] Dry eye disease is a general term for a variety of diseases characterized by decreased tear film stability due to abnormal tear quality or quantity, or abnormal tear dynamics, accompanied by ocular discomfort and / or ocular surface tissue lesions. This disease can cause ocular discomfort symptoms, visual impairment, and tear film instability that is potentially harmful to the ocular surface, as well as increased tear film osmotic pressure and ocular surface inflammation. The symptoms of dry eye disease are affected by a combination of tear production, tear evaporation rate, and whether there is inflammation. Matrix metalloproteinase (MMP-9) is an inflammatory marker that is continuously elevated in the tears of patients with dry eye. The hyperosmotic environment of the ocular surface triggers the stress-activated protein kinase signaling pathway, causing MMP-9 to be released from corneal epithelial cells, cleaving tight junction proteins (ZO-1) and aggravating the destruction of the corneal epithelium; the MMP-9 levels in patients with moderate and severe dry eye disease are correlated with clinical examination results. Changes in corneal epithelial barrier function are the cause of visual abnormalities and ocular discomfort in dry eye disease. Therefore, a more in-depth study of MMP-9 can help us understand the degree of dry eye treatment and achieve the best treatment effect for patients. In the current study, corneal epithelium and fibroblasts produced MMP-9 in inflammatory response. Ocular surface MMP-9 plays an important role in dry eye and ocular surface diseases by promoting the inflammatory cycle after inducing inflammatory cytokines and inflammatory mediators. Elevated MMP-9 levels are also associated with poor epithelial healing, leading to ocular surface inflammation and dry eye. Other diseases with elevated MMP-9 levels include vernal keratoconjunctivitis, advanced keratoconus, fungal keratitis, and pterygium. In addition, the level of MMP-9 in tears has been shown to be positively correlated with the severity of dry eye.

[0005] At present, the diagnosis of dry eye depends largely on the detection of tear components, among which cytokines, growth factors, hormones, inflammatory factors, lysozyme, etc. play an important role. Matrix metalloproteinases (MMPs) are a type of inflammatory factors, but there are few studies on the content of MMPs in the tears of patients with dry eye in China. Therefore, it is very important to provide a method for rapid detection of MMP content in tear components. Summary of the invention

[0006] In order to make up for the deficiencies of the prior art, the purpose of the present invention is to provide a novel anti-human MMP-9 antibody and a detection kit thereof.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention provides an anti-human MMP-9 antibody or an antigen-binding fragment thereof.

[0009] Further, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises a heavy chain CDR1, a heavy chain CDR2 and a heavy chain CDR3, and the light chain variable region comprises a light chain CDR1, a light chain CDR2 and a light chain CDR3; wherein:

[0010] The amino acid sequences of the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 are shown as SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, respectively; the amino acid sequences of the light chain CDR1, light chain CDR2 and light chain CDR3 are shown as SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, respectively.

[0011] Further, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO:6, or an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:6, or a sequence having one or more amino acid substitutions, deletions or insertions or any combination thereof compared to the amino acid sequence shown in SEQ ID NO:6.

[0012] Further, the light chain variable region comprises the amino acid sequence shown in SEQ ID NO:10, or an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:10, or a sequence having one or more amino acid substitutions, deletions or insertions or any combination thereof compared to the amino acid sequence shown in SEQ ID NO:10.

[0013] In the present invention, the term "antibody" refers to any form of an antibody that exhibits a desired biological activity (e.g., inhibiting the binding of a ligand to its receptor or by inhibiting ligand-induced receptor signal transduction). Therefore, "antibody" is used in its broadest sense and explicitly includes, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies and multispecific antibodies (e.g., bispecific antibodies), fully human, humanized, primatized, chimeric antibodies, single-chain antibodies, etc.

[0014] In the present invention, the term "antigen binding fragment" refers to a portion of an antibody, such as F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, etc. Regardless of its structure, an antibody fragment binds to the same antigen recognized by the intact antibody. The term "antigen binding fragment" includes aptamers, spiegelmers, and bivalent antibodies. The term "antigen binding fragment" also includes any synthetic or genetically engineered protein that acts as an antibody by binding to a specific antigen to form a complex.

[0015] "Complementarity determining region" or "CDR region" or "CDR" or "hypervariable region" is a region of an antibody variable domain that is highly variable in sequence and forms structurally defined loops ("hypervariable loops") and / or contains antigen contact residues ("antigen contact points"). CDRs are primarily responsible for binding to antigen epitopes.

[0016] Based on the variable region amino acid sequence contained in a given antibody or fragment thereof of the present invention, those skilled in the art can routinely determine the CDR contained therein. For example, the CDR in the variable region amino acid sequence is defined using the Kabat scheme, the AbM scheme, the Chothia scheme or the Contact scheme.

[0017] When referring to antibodies defined by specific CDR sequences defined herein, the scope of the antibodies also covers antibodies whose variable region sequences comprise the specific CDR sequences but whose declared CDR boundaries differ from the specific CDR boundaries defined herein due to the application of a different scheme (e.g., a different assignment system rule or combination).

[0018] The CDR of the antibody of the present invention can be manually assessed to determine the boundaries according to any scheme or combination thereof in the art. Unless otherwise specified, in the present invention, the term "CDR" or "CDR sequence" encompasses CDR sequences determined in any of the above ways.

[0019] In the present invention, the term "identity" refers to the sequence similarity with the amino acid sequence used in the present invention. In order to determine the sequence identity, a sequence alignment can be performed, which can be performed in the various ways known to those skilled in the art, for example, using BLAST, ALIGN, NEEDLE or Megalign (DNASTAR) software etc. Those skilled in the art can determine the appropriate parameters for comparison, including any algorithm required for realizing optimal comparison in the full-length sequence compared. Therefore, amino acid sequences that are at least 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the sequence of the present invention are within the scope of protection of the present invention.

[0020] In the present invention, the antibody sequence obtained by modification also belongs to the protection scope of the present invention. The term "modification" refers to any chemical modification of the amino acid sequence, such as substitution, deletion, insertion and / or addition of amino acids. The term "substitution" refers to the replacement of one or more amino acids by different amino acids. "Deletion" refers to the reduction of one or more amino acids in the amino acid sequence. "Insertion" or "addition" refers to the change in the amino acid sequence resulting in the increase of one or more amino acids compared to the naturally occurring molecule. It should be noted that in the modified antibodies provided by the present invention, the modification preferably occurs in a region outside the variable region, such as in the framework region or constant region of the antibody, and the modified antibody still retains the desired functional properties of the antibody of the present invention or its antigen-binding fragment, or has improved antigen-binding properties.

[0021] A second aspect of the present invention provides a biomaterial.

[0022] Furthermore, the biomaterial comprises:

[0023] 1) a polynucleotide encoding the antibody or antigen-binding fragment thereof according to the first aspect of the present invention;

[0024] 2) a vector comprising the polynucleotide described in 1);

[0025] 3) A host cell comprising the polynucleotide described in 1) or the vector described in 2).

[0026] Furthermore, the polynucleotide sequence encoding the heavy chain variable region of the antibody or antigen-binding fragment thereof described in the first aspect of the present invention is shown as SEQ ID NO: 14; the polynucleotide sequence encoding the light chain variable region of the antibody or antigen-binding fragment thereof described in the first aspect of the present invention is shown as SEQ ID NO: 18.

[0027] Furthermore, the vector includes linear polynucleotides, plasmids, and viral vectors.

[0028] Furthermore, the host cells include prokaryotic cells and eukaryotic cells.

[0029] In the present invention, the term "polynucleotide" includes sequences of ribonucleotides and deoxyribonucleotides, such as modified or unmodified RNA or DNA, each in single-stranded and / or double-stranded form, linear or circular, or mixtures thereof (including hybrid molecules). Therefore, nucleic acids according to the present invention include DNA (such as dsDNA, ssDNA, cDNA), RNA (such as dsRNA, ssRNA, mRNA, ivtRNA), combinations or derivatives thereof (such as PNA). Preferably, the nucleic acid is DNA or RNA.

[0030] In the present invention, a vector refers to an artificial construct that can deliver and preferably express one or more target genes or sequences in a host cell. The vector of the present invention is not limited and can be an expression vector, a viral vector, etc. In certain embodiments, the vector comprises a target gene, a promoter, a terminator encoding an antibody of the present invention or a precursor thereof, or optionally further comprises a marker gene. The vector can use a known vector or a self-constructed vector. Known vectors include plasmid vectors, lentiviral vectors, adenoviral vectors, AAV viral vectors, etc.

[0031] In the present invention, the term "host cell" refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli, fungal cells such as yeast cells, or fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells or HEK293 cells.

[0032] The third aspect of the present invention provides an antibody derivative.

[0033] Furthermore, the antibody derivative is a complex obtained by modifying the antibody or antigen-binding fragment thereof described in the first aspect of the present invention; the modification includes conjugation modification using a detectable marker, conjugation modification using a therapeutic agent, and conjugation modification using an imaging agent.

[0034] Furthermore, the detectable markers include fluorescent pigments, avidin, paramagnetic atoms, radioactive isotopes, enzyme markers, and colloidal gold.

[0035] Furthermore, the fluorescent pigments include fluorescein, rhodamine, Texas red, phycoerythrin, phycocyanin, allophycocyanin, and peridinin-chlorophyll protein.

[0036] Furthermore, the avidin includes biotin, egg white avidin, streptavidin, egg yolk avidin, and avidin-like.

[0037] Furthermore, the radioactive isotopes include radioactive iodine, radioactive cesium, radioactive iridium, and radioactive cobalt.

[0038] Furthermore, the enzyme markers include horseradish peroxidase, alkaline phosphatase, glucose oxidase, β-galactosidase, lysozyme, and malate dehydrogenase.

[0039] Furthermore, the therapeutic agents include cytotoxic agents, hormone preparations, targeted small molecule preparations, proteasome inhibitors, chemotherapeutic agents, oncolytic drugs, cytokines, activators of co-stimulatory molecules, and inhibitors of inhibitory molecules.

[0040] The term "detectable marker" refers to an agent that is detectable, for example, by spectroscopy, photochemistry, biochemistry, immunochemistry, or chemical means. Useful detectable markers include, but are not limited to, fluorescent dyes, chemiluminescent compounds, radioisotopes, electron-dense reagents, enzymes, colored particles, biotin, or dioxigenin. Detectable markers tend to produce measurable signals, such as radioactivity, fluorescence, color, or enzyme activity. Antibodies coupled to detectable agents can be used for diagnostic or therapeutic purposes. Examples of detectable agents include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron-emitting metals using various positron emission tomography, and non-radioactive paramagnetic metal ions. Detectable substances can be directly connected or coupled to antibodies, or indirectly through intermediates such as joints known in the art, using techniques known in the art. See, U.S. Patent No. 4,741,900, which describes the coupling of metal ions to antibodies for diagnosis. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, and acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, and phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferin and photoluminescent proteins.

[0041] A fourth aspect of the present invention provides a kit for detecting MMP-9.

[0042] Furthermore, the kit comprises the antibody or antigen-binding fragment thereof according to the first aspect of the present invention, the biological material according to the second aspect of the present invention or the antibody derivative according to the third aspect of the present invention.

[0043] Furthermore, the kit also includes magnetic beads coupled to MMP-9 antigen protein and chemiluminescent liquid.

[0044] Furthermore, the chemiluminescent liquid includes an enzymatic reaction luminescent agent, a direct chemiluminescent agent, and an electrochemiluminescent agent.

[0045] Furthermore, the enzymatic reaction luminescent agent includes an enzymatic reaction enzyme and a luminescent substrate of the enzymatic reaction enzyme.

[0046] Furthermore, the enzymatic reaction enzymes include horseradish peroxidase, alkaline phosphatase, glucose oxidase, β-galactosidase, lysozyme, and malate dehydrogenase.

[0047] Furthermore, the luminescent substrate of the enzyme-catalyzed reaction enzyme includes a luminescent substrate of horseradish peroxidase, a luminescent substrate of alkaline phosphatase, a luminescent substrate of glucose oxidase, a luminescent substrate of β-galactosidase, a luminescent substrate of lysozyme, and a luminescent substrate of malate dehydrogenase.

[0048] Furthermore, the luminescent substrate of the horseradish peroxidase includes luminol or its derivatives, and p-hydroxyphenylacetic acid.

[0049] Furthermore, the luminescent substrate of alkaline phosphatase includes AMPPD and 4-methylumbelliferyl phosphate.

[0050] Furthermore, the direct chemiluminescent agent includes a reagent that does not require the catalytic action of an enzyme and can emit light only by changing the pH conditions of the solution.

[0051] Furthermore, the electrochemiluminescent agent includes a substance that emits light by undergoing an electrochemical reaction on the surface of an electrode.

[0052] A fifth aspect of the present invention provides any of the following methods, comprising:

[0053] (1) A method for producing the antibody or antigen-binding fragment thereof according to the first aspect of the present invention, the method comprising the following steps: culturing the host cell according to the second aspect of the present invention to obtain a culture product, and isolating and purifying the antibody or antigen-binding fragment thereof according to the first aspect of the present invention from the culture product;

[0054] (2) A method for detecting MMP-9 or a fragment thereof in a sample for non-diagnostic and non-therapeutic purposes, the method comprising the following steps: contacting the sample with the antibody or antigen-binding fragment thereof according to the first aspect of the present invention or contacting the sample with the antibody derivative according to the third aspect of the present invention, and detecting the formation of a complex between the antibody or antigen-binding fragment thereof or the antibody derivative and MMP-9 or a fragment thereof;

[0055] (3) A method for preparing the host cell according to the second aspect of the present invention, the method comprising the following steps: introducing the polynucleotide molecule according to the second aspect of the present invention or a vector containing the same into the host cell;

[0056] Furthermore, the introduction method includes calcium phosphate transfection, DEAE, dextrose-mediated transfection, electroporation, and phage infection.

[0057] A sixth aspect of the present invention provides any of the following applications, comprising:

[0058] 1) Use of the antibody or antigen-binding fragment thereof according to the first aspect of the present invention, the biomaterial according to the second aspect of the present invention, or the antibody derivative according to the third aspect of the present invention in the preparation of a product for detecting, identifying or screening MMP-9 protein;

[0059] 2) Use of the antibody or antigen-binding fragment thereof according to the first aspect of the present invention, the biomaterial according to the second aspect of the present invention, the antibody derivative according to the third aspect of the present invention, or the kit according to the fourth aspect of the present invention in the preparation of a product for diagnosing inflammatory diseases, cardiovascular diseases, nervous system diseases, or ophthalmic diseases caused by abnormal MMP-9 levels;

[0060] Furthermore, the inflammatory diseases caused by abnormal MMP-9 levels include rheumatoid arthritis and inflammatory bowel disease; the cardiovascular diseases caused by abnormal MMP-9 levels include atherosclerosis and heart failure; the nervous system diseases caused by abnormal MMP-9 levels include multiple sclerosis and ischemic stroke; the ophthalmic diseases caused by abnormal MMP-9 levels include dry eye disease, neovascular eye disease, vernal keratoconjunctivitis, and infectious keratitis.

[0061] The seventh aspect of the present invention provides a pharmaceutical composition for treating diseases caused by abnormal MMP-9 levels, the pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen-binding fragment thereof described in the first aspect of the present invention, or the antibody derivative described in the third aspect of the present invention.

[0062] Furthermore, the diseases caused by abnormal MMP-9 levels include cancer, inflammatory diseases, cardiovascular diseases, nervous system diseases or ophthalmic diseases.

[0063] Furthermore, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients.

[0064] Beneficial effects of the present invention:

[0065] The present invention provides an anti-human MMP-9 antibody or an antigen-binding fragment thereof and a kit for detecting MMP-9. The kit comprising the anti-human MMP-9 monoclonal antibody in the present application has good stability, a qualified recovery rate, good system linearity and repeatability, and excellent anti-cross-reactivity when proteins with high homology, similar sequences or similar detection significance are present; the detection result of human MMP-9 protein has a good positive-negative coincidence rate, and the detection result can be used to more accurately reflect whether a subject suffers from dry eye disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 This is the PCR electrophoresis diagram of the MMP-9 target gene;

[0067] Figure 2 This is the electrophoresis diagram of the restriction enzyme digestion of pET-28a-MMP-9 vector;

[0068] Figure 3This is the SDS-PAGE polyacrylamide gel electrophoresis diagram of the target protein MMP-9. DETAILED DESCRIPTION

[0069] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and are not to be construed as limiting the present invention. It will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and purposes of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. The experimental methods for which specific conditions are not specified in the following examples are usually tested under conventional conditions or under conditions recommended by the manufacturer.

[0070] Example 1 Preparation and purification of recombinant human matrix metalloproteinase-9 (MMP-9) protein

[0071] 1. Perform PCR reaction to amplify the MMP-9 target gene according to the following reaction system and reaction conditions:

[0072] (1) Preparation of PCR reaction system:

[0073] cDNA 4 μl, MMP-1 upstream primer 2 μl, MMP-2 downstream primer 2 μl, 2× reaction mixture 25 μl, ddH2O 17 μl, a total of 50 μl.

[0074] (2) PCR reaction conditions:

[0075] First, pre-denaturation was performed at 94°C for 5 minutes, followed by 30 cycles of reaction, including denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 2 minutes, and finally extension at 72°C for 7 minutes.

[0076] The 2× reaction mixture solution is 2×TransTaq-TPCR SuperMix (Cat. No. AS122) produced by Beijing Quanshijin Biotechnology Co., Ltd., and its main components include DNA polymerase, dNTP and reaction buffer. The upstream primer of MMP-1 and the downstream primer of MMP-2 are based on the gene coding region sequence of human MMP-9 registered in NCBI (accession number NM_004994.3), and the gene fragment 1-2336bp is selected for cloning and recombination. Primer-primer 5.0 primer design software was used for primer design, and BamHI and XhoI restriction enzyme sites were added to the 5' end of the upstream primer and the downstream primer, respectively, and then synthesized by Beijing Bomade Gene Technology Co., Ltd. The primer sequences are as follows:

[0077] MMP-1 upstream primer (5'-3'): GGATCCATGGAGACCGACGGGGACG (SEQ ID NO: 1);

[0078] MMP-1 downstream primer (5'-3'): CTCGAGGCTGTCCTCAGGGCACTGCT (SEQ ID NO: 2).

[0079] 2. Perform agarose gel electrophoresis on the PCR amplification reaction products. The electrophoresis results are shown in Figure 1 The amplified DNA band size was 2250 bp, which was consistent with the 2334 bp position of the MMP-9 target gene fragment. The PCR amplification product was recovered using the agarose gel recovery kit (Cat. No. H41118) produced by Beijing Quanshijin Biotechnology Co., Ltd. according to the manufacturer's instructions.

[0080] 3. Use the T vector ligation kit (Cat. No. H20724) from Beijing Quanshijin Biotechnology Co., Ltd. According to the instruction manual, the DNA recovery product was ligated with the pEASY-T1 Simple vector at 25ºC for 15 minutes. 10μl of the ligation product was transformed and added to 50μl of E. coli DH5α competent cells, incubated on ice for 30 minutes, and heat-stressed at 42ºC for 90 seconds. Immediately place on ice for 2 minutes, add 500μl of LB liquid culture medium, and culture at 37ºC at 200-250 rpm for 45 minutes. Then, apply the bacterial solution on the ampicillin resistance screening culture plate. After the plate is placed in the forward direction for 10 minutes, the residual bacterial solution is dried, the plate is inverted, and cultured overnight at 37ºC.

[0081] 4. Randomly pick 6 single colonies in step 3 and place them in 3ml LB medium for overnight expansion at 37ºC. Use the bacterial solution as a cDNA template and perform PCR identification of the bacterial solution. Select clones 2, 3, and 6 and send them to Beijing Bomade Gene Technology Co., Ltd. for DNA sequencing. The feedback sequencing report is compared with the gene coding region sequence of human MMP-9 registered in NCBI (accession number NM_004994.3) by Blast. The gene sequence of clone 3 is completely consistent with the target gene sequence.

[0082] 5. Use restriction endonucleases BamHI (Cat. No. R0136V) and XhoI (Cat. No. R0146V) produced by New England Biotechnology (Beijing) Co., Ltd. to double digest the MMP-9-pEASY-T1 plasmid and the prokaryotic expression vector pET-28a plasmid to make them have complementary sticky ends according to the manufacturer's instructions. Use the agarose gel recovery kit (Cat. No. H41118) produced by Beijing Quanshijin Biotechnology Co., Ltd. to perform DNA recovery from the target gene product with complementary sticky ends and the restriction-cut vector fragment respectively. Use the T4 DNA Ligase kit (Cat. No. D2011A) produced by Dalian TaKaRa Company to connect the target gene product with complementary sticky ends and the restriction-cut vector fragment in a 16ºC water bath for 12 hours according to the manufacturer's instructions. Add all the ligation products to 50μl E. coli DH5α competent cells and incubate on ice for 30min; after 90s of heat stress at 42ºC, immediately place on ice for 2min; add 500μl LB liquid culture medium and shake culture at 37ºC 200-250 rpm for 45min; apply the bacterial solution on a culture plate with kanamycin sulfate resistance screening, place the plate in the positive direction for 10min, and dry the residual bacterial solution; invert the plate and culture at 37ºC overnight. Randomly pick 2 pET-28a-MMP-9 single colonies in 3ml LB culture medium and expand them overnight at 37ºC. Use the small amount of plasmid DNA extraction kit (Cat. No. H41105) produced by Beijing Quanshijin Biotechnology Co., Ltd. and operate according to the instructions of the kit to extract plasmid DNA from pET-28a-MMP-9. The extracted DNA was double-digested with restriction endonucleases BamHI (Cat. No. R0136V) and XhoI (Cat. No. R0146V) produced by New England Biotechnology (Beijing) Co., Ltd. The digestion products were subjected to agarose gel electrophoresis. The electrophoresis results are shown in Figure 2 The size of the restriction fragment is about 2250 bp, which is consistent with the size of the target gene MMP-9 (2334 bp).

[0083] 6. For the prokaryotic expression plasmid pET-28-MMP-9 constructed in step 5, transform the BL21 (DE3) competent cells, pick a single clone colony and culture it in 5 ml of LB liquid medium (containing kanamycin) at 220 rpm and 37ºC overnight. Transfer the overnight cultured bacteria to fresh LB liquid medium at a ratio of 1:100, culture at 220 rpm and 37ºC, and add IPTG to start induction when the bacterial liquid concentration OD600≈0.6 (the final concentration of IPTG is 0.25mM); induction at 28ºC and 220 rpm for 4h to collect the bacteria; centrifuge at 9500 rpm and 4ºC for 2min to collect the bacteria. Add 20 ml of pre-cooled loading buffer (300 mM NaCl, 50 mM NaH2PO4, 10 mM imidazole, 10 mM Tris base, pH 8.0), resuspend the cells, and disrupt the cells by ultrasound: 7 seconds per treatment for 3 seconds, ultrasound for 20 min, output power 50%. Centrifuge at 9500 rpm, 4ºC for 20 min to separate the supernatant and precipitate. Filter the supernatant with a 0.22μm pore size filter membrane before loading. Prepare Ni 2+ -NTA affinity chromatography column, slowly eluted with deionized water, pre-equilibrated with 10 column volumes of loading buffer; the filtered sample was passed through the column and the effluent was collected; rinsed with 20 column volumes of wash buffer (300 mM NaCl, 50 mM NaH2PO4, 20 mM imidazole, 10 mM Tris base, pH 8.0), and the filtrate was collected. Eluted with 5 column volumes of elution buffer (300 mM NaCl, 50 mM NaH2PO4, 300 mM imidazole, 10 mM Tris base, pH 8.0), the target protein was collected, and the target protein was dialyzed into 0.01M PBS buffer system. The BCA protein quantification kit (Cat. No. PP0102) produced by Beijing Bomed Gene Technology Co., Ltd. was used to quantify the pET-28-MMP-9 recombinant antigen according to the manufacturer's product instructions. The protein concentration was about 1.5 mg / ml, and 4 mg was finally obtained. The pET-28-MMP-9 recombinant antigen was subjected to SDS-PAGE polyacrylamide gel electrophoresis. The electrophoresis results are shown in Figure 3 The target protein is between 80 kd in size, which is consistent with the size of the target protein MMP-9 (85 kd). The protein purity is greater than 90%. The purified protein is used as the immunogen in Example 2 and the product calibrator in Example 3.

[0084] Example 2 Preparation of anti-human MMP-9 mouse monoclonal antibody

[0085] 1. Select three female Balb / c mice of 6 weeks old and weighing about 20g. Take the recombinant protein prepared in Example 1 for immunization. For the first immunization, take 100 μg of protein and add 0.01M PBS to 500 μl, emulsify with an equal volume of Freund's complete adjuvant, and perform subcutaneous multi-point injection after sufficient emulsification. The second and third immunization doses were the same as the first immunization on the 14th and 35th days, respectively, and emulsified with Freund's incomplete adjuvant, and subcutaneous multi-point injection was performed after sufficient emulsification. One week after the three immunizations, the tail vein blood of the mice was taken, and the serum titer was detected by indirect Elisa method using the recombinant antigen. The results are shown in Table 1. The spleen of the mouse with the highest titer (mouse A) was selected for cell fusion. Three days before fusion, boost immunization was performed, and a dose of 20 μg of recombinant protein was dissolved in 100 μl 0.01M PBS and injected into the tail vein of the mouse; 3 days later, the spleen was taken for cell fusion.

[0086] Table 1 Results of serum titer test by indirect Elisa method

[0087]

[0088] 2. Take mice that were boosted with immunization 3 days in advance, kill them by pulling their necks, and remove the spleen aseptically. Wash once with 10 ml of RMPI-1640 (1802-E) serum-free culture medium produced by Beijing Neutech Biotechnology Co., Ltd. Grind the spleen and pass it through a 200-mesh cell sieve. Transfer the spleen cells to a 10 ml centrifuge tube and centrifuge at 800 rpm for 10 min. Wash the cells twice with 10 ml of culture medium, resuspend the cells in 5 ml of serum-free culture medium, and count the cells under a microscope. A total of about 1×10 8 Mouse myeloma SP2 / 0 cells in the logarithmic growth phase were harvested, washed twice with 10 ml serum-free culture medium, resuspended in 5 ml serum-free culture medium, and counted under a microscope. A total of about 5 × 10 7 The SP2 / 0 cell suspension is ready for use.

[0089] 3. Cell fusion: Mix myeloma cells and spleen cells in a ratio of 1:2, wash once with serum-free incomplete culture medium in a 50ml centrifuge tube, centrifuge at 1200rpm for 8min; discard the supernatant and use a pipette to remove the remaining liquid to avoid affecting the concentration of polyethylene glycol (PEG). Gently tap the bottom of the centrifuge tube to loosen the cell pellet slightly. Add 1ml of 50% (0.5g / 1ml) PEG (molecular weight 4000) solution pre-warmed at 37℃, and shake it slightly while adding. Incubate in a 37℃ water bath for 90s. Add incomplete culture medium pre-warmed at 37℃ to terminate the PEG action, and add 1ml, 2ml, 3ml, 4ml, 5ml and 6ml every 2min. Centrifuge at 800 rpm for 6 min, discard the supernatant, and resuspend in culture medium containing 20% ​​(v / v) premium fetal bovine serum and 1×HAT medium additive Hybri-Max (Sigma Product No. H0262), and plate the cell suspension into a 96-well cell culture plate, adding 200 μl to each well. Place the culture plate in a 37°C, 5% CO2 incubator.

[0090] 4. After 10 days of cell fusion, observe under a microscope. When the hybridoma cell clones cover 1 / 5 of the bottom of the well, the indirect Elisa method can be used to detect the culture supernatant and screen for positive cell clones with secretory resistance. Dilute the recombinant protein to 5 μg / ml with 0.05M carbonate buffer, coat the 96-well ELISA plate with 100 μl / well, and incubate at 4°C overnight. Pour out the liquid in the wells of the ELISA plate, add PBST, and repeat washing three times; add 200μl / well of insulation solution (0.5% BSA, diluted with PBST) for blocking, place at 37°C for 1 hour, and pat dry for use. Add 100μl of cell culture supernatant, add fusion mouse immune serum diluted with 1:1000 insulation solution as the positive control, and add SP2 / 0 culture supernatant as the negative control. The blank is washing solution and stand at 37°C for 45 minutes. Wash the plate with 200μl / well PBST and repeat washing three times. Add 100μl / well of 1:5000 diluted HRP-labeled goat anti-mouse secondary antibody and let stand at 37ºC for 45 minutes. Wash the plate with 200μl / well PBST and repeat the wash three times. Add 100μl / well of substrate reaction solution and react in the dark at 37ºC for 10 minutes. Add 50μl / well of H2SO4 (2mol / L) to terminate the reaction. Detect the absorbance value at 450nm with an ELISA reader, compare the positive control OD value, and select the cloning wells with OD values ​​greater than or equal to the positive control for cloning.

[0091] 5. After screening the positive clones, the hybridomas were cloned by limiting dilution. The hybridoma cells to be cloned were gently blown dry from the culture wells with a selection medium containing 20% ​​(v / v) special fetal bovine serum and 1×HT culture medium additive (Sigma H0137). The cells were counted and adjusted to 5 cells / ml. 200μl of diluted cells were added to each well and cultured in a 37ºC, 5% CO2 incubator. Cell clones were formed in 10 days. The culture supernatant of the monoclonal cell wells was taken for indirect Elisa detection, and the strongest positive monoclonal clone was cloned again until the monoclonal cell positive rate reached 100%. The cell lines were then fixed and expanded for culture and cell cryopreservation. After three rounds of cloning, a total of three cell lines were retained, with clone numbers 6F8, 5H2, and 8A9.

[0092] 6. Intraperitoneally inject 500 μl of paraffin oil into Balb / c mice. Seven days later, the three hybridoma cells obtained in step 5 were cultured at 1×10 6 The cells were injected intraperitoneally at a concentration of 100 μg / mL and the ascites was collected 10 days later. Protein G Sepharose 4 Fast Flow manufactured by GE Healthcare China was used to purify the ascites by affinity chromatography according to the product instructions.

[0093] 7. Dilute human matrix metalloproteinase protein 9 to 0.5μg / ml with 0.05M carbonate buffer, coat 96-well ELISA plate with 100μl / well, incubate at 4ºC overnight, pour out the liquid in the wells of the ELISA plate, add PBST, and repeat washing three times; add 200μl / well of warm solution (0.5% BSA in PBST) for blocking, place at 37ºC for 1 hour, and pat dry for later use. Use HRP to label 3 anti-MMP-9 mouse monoclonal antibodies. The dry eye samples were tested by competition method, and the results are shown in Table 2. The antibody preliminarily determined is 5H2.

[0094] Table 2 Dry eye sample test results

[0095]

[0096] 8. Sequencing of monoclonal antibodies: Clone 5H2 was sent to Nanjing GenScript Biotechnology Co., Ltd. for sequencing. Its heavy chain amino acid sequence is shown in SEQ ID NO: 19, its light chain amino acid sequence is shown in SEQ ID NO: 20, its heavy chain nucleotide sequence is shown in SEQ ID NO: 21, and its light chain nucleotide sequence is shown in SEQ ID NO: 22. Its variable region sequence information is shown in Table 3.

[0097] Table 3 5H2 monoclonal antibody sequence information

[0098] Example 3 Preparation of human matrix metalloproteinase chemiluminescence kit

[0099] 1. Preparation of magnetic bead-coupled MMP-9 antigen:

[0100] 1) Magnetic separation: Place the magnetic bead-coupled container in a magnetic field and perform magnetic separation for at least 2 minutes (the supernatant is clear and transparent), then discard the supernatant.

[0101] 2) Magnetic bead washing: Add (0.1x) ml of magnetic bead coupling buffer-1 to the magnetic bead coupling container, mix for 10 seconds, place the magnetic bead coupling container in a magnetic field for magnetic separation for at least 2 minutes (the supernatant is clear and transparent), and discard the supernatant. Repeat this washing step twice.

[0102] 3) Preparation of 10mg / ml EDC solution: According to the amount (0.01x)ml required for the magnetic bead activation step, weigh (y)mg of EDC (y≥0.1x and y≥1), add (0.1y)ml magnetic bead coupling buffer-1 to make a concentration of 10mg / ml (this solution must be prepared before use).

[0103] 4) Activation of magnetic beads: Add 0.1 ml of the above EDC solution for every 10 mg of magnetic beads, accurately pipette (0.01x) ml of EDC solution into the magnetic bead coupling container, and then add magnetic bead coupling buffer-1 to make the total volume (0.1x) ml; place the magnetic bead coupling container on a mixer and mix at room temperature for 30 minutes.

[0104] 5) Magnetic separation: Place the magnetic bead-coupled container in a magnetic field, perform magnetic separation for 2 minutes, and discard the supernatant.

[0105] 6) Calculation of antigen dosage: The weight ratio of magnetic beads to antigen is 20:1. The amount of antigen added (0.05x) mg is calculated based on the amount of magnetic beads (x) mg, and the volume of antigen to be added (0.05x / cantigen) ml is calculated based on the concentration of antigen (cantigen) mg / ml; based on the volume of antigen to be added, the volume of magnetic bead coupling buffer to be added is calculated (0.1x-0.05x / cantigen) ml.

[0106] 7) Coupling reaction: first add the supplementary volume of magnetic bead coupling buffer, mix well and then add the antigen, place the magnetic bead coupling container on a mixer, and react at 18℃-26℃ overnight (more than 4h).

[0107] 8) Dilute the magnetic beads coupled to MMP-9 antigen to 0.2 mg / ml with magnetic bead diluent-1, mix well and store at 2-8°C for later use.

[0108] 2. Preparation of enzyme-labeled antibodies: a) Weigh 1 mg of horseradish peroxidase (HRP, purchased from Sigma) and dissolve it in 300 μl of distilled water.

[0109] b) Add 0.6 μl of freshly prepared 0.1 M NaIO4 solution to the supernatant and stir for 20 minutes at room temperature in the dark.

[0110] c) Place the above solution into a dialysis bag and dialyze against 1 mM sodium acetate buffer (pH 4.4) at 4°C overnight.

[0111] d) Add 20 μl of 1M pH 9.5 carbonate buffer to raise the pH of HRP to 9.0 to 9.5, then immediately add 5 mg of the MMP-9 monoclonal antibody of the present application (in 1 ml of 0.01 M carbonate buffer) and gently stir at room temperature for 2 hours in the dark.

[0112] e) Add 0.05 ml of freshly prepared 4 mg / ml NaBH4 solution, mix well, and incubate at 4°C for 2 hours.

[0113] f) Place the above solution into a dialysis bag and dialyze using 0.2M pH 7.4 PBS at 4°C overnight.

[0114] g) Add an equal volume of glycerol and store at -20°C. The final concentration of the horseradish peroxidase-labeled antibody is 1 mg / ml.

[0115] 3. Preparation of sample diluent: 1000 ml sample diluent includes 30.0 g sodium chloride, 25.0 ml goat serum, 5.0 ml Tween-20, and 0.5 ml Proclin-300.

[0116] 4. Preparation of two-component chemiluminescent solution: Chemiluminescent solution A contains luminol and a luminescence enhancer, and chemiluminescent solution B contains peroxide and a luminescence enhancer.

[0117] 5. Preparation of enzyme working solution: Dissolve the horseradish peroxidase monoclonal antibody prepared in step 2 in 5.8 g / L disodium hydrogen phosphate, 0.59 g / L sodium dihydrogen phosphate, 9.0 g / L sodium chloride, 1.0% bovine serum albumin, 1.0% casein, 1.0 g / L enzyme stabilizer and 1 ml / L Proclin-300 at a ratio of 1:1000. The final concentration of the horseradish peroxidase labeled monoclonal antibody is 1 mg / L.

[0118] Example 4 Method for using the human MMP-9 magnetic microparticle chemiluminescence kit

[0119] 1. Sample collection

[0120] 1.1 Shake the reaction tube down several times to allow the reagent reaction solution in the tube to sink to the bottom of the tube, then tear off the sealing film on the tube and put the lid aside.

[0121] 1.2 Collect human conjunctival samples using the following steps: 1) Prepare physiological saline and sterile sampling swabs;

[0122] 2) Tear open the outer packaging of the swab and pre-moisten the sterile sampling swab with 4-5 drops of normal saline;

[0123] 3) When sampling (try not to use anesthetics), ask the patient to look upward, turn over the lower eyelid, expose the bulbar conjunctiva and inferior fornix conjunctiva below, and use a sterile swab moistened with saline to gently wipe the conjunctival sac and the surface of the palpebral conjunctiva from the inner canthus to the outside (be careful not to miss the inner eyelid), avoid contact with the eyelashes and eyelid margin, and use an eyelid speculum or other instruments when necessary;

[0124] 4) Move the collection swab to the inner corner of the eye and gently rotate, slide and squeeze 5 times to fully absorb the tear sample.

[0125] 1.3 Insert the collection swab into the bottom of the reaction tube, rotate the swab along the inner wall of the tube at least 3 times, and place the swab in the reaction solution for 1 minute.

[0126] 1.4 After 1 minute, push the swab head into the bottom of the reaction tube, then pinch the inner wall of the test tube when pulling out the swab to squeeze out the liquid.

[0127] 2. Preparation Procedure

[0128] 2.1 Prepare needle washing solution according to the following formula: weigh 0.725g Na2HPO4•12H2O, 0.074g NaH2PO4•2H2O and 2.25g NaCl, measure 0.125mL Tween-20, dissolve it in purified or distilled water, mix thoroughly and make up to 1000mL.

[0129] 2.2 Place the refrigerated reagent at 18℃~25℃ for more than 20 minutes to allow each component to equilibrate to 18℃~25℃.

[0130] 2.3 Dilute the 20 times concentrated cleaning solution 20 times with purified water or distilled water to make 1× cleaning solution for use. Prepare 1× cleaning solution according to the required amount and put it into the corresponding cleaning solution bucket after preparation.

[0131] 2.4 Place the components in the kit at the corresponding reagent positions on the instrument and put the needle wash solution into the corresponding needle wash solution bucket.

[0132] 2.5 Place each liquid pipeline into the corresponding bucket.

[0133] 2.6 Place the sample to be tested into the sample position.

[0134] 3. Calibration process: According to the instrument operation process, measure the built-in calibrator in the kit and fit the calibration curve.

[0135] 4. Inspection process: Test the samples to be tested according to the instrument operation process, and the instrument automatically outputs the sample test results.

[0136] 4.1 Add samples: Add 25uL of calibrator, quality control or sample; 50uL of enzyme working solution and 50uL of magnetic bead working solution to the reaction cup.

[0137] 4.2 Mixing and incubation: After mixing, react at 37°C for 10 min.

[0138] 4.3 Cleaning: After the reaction is completed, perform magnetic separation and wash three times with 300uL / well 1× washing solution. Perform magnetic separation after each wash.

[0139] 4.4 Reading: Add 50uL chemiluminescent solution A and 50uL chemiluminescent solution B to the reaction cup, mix well and read the value.

[0140] 4.5 Calculation: The instrument can automatically fit the concentration value of the quality control product or sample (in ng / mL) based on the built-in fitting calibration curve.

[0141] The linear equation is log(RLU) = -1.31 -2.83 log(concentration); r = 0.993.

[0142] Table 4 RLU values ​​detected by the standard curve of the MMP-9 magnetic microparticle chemiluminescence kit

[0143]

[0144] Example 5 Methodological indicators of human MMP-9 chemiluminescence kit

[0145] 1. Accuracy: The recovery rate should be between 85% and 115%;

[0146] 2. Linearity of the measurement system: Linear correlation coefficient r≥0.9900 in the range of 0.5ng / ml to 50ng / ml.

[0147] 3. Repeatability: The intra-batch coefficient of variation (CV) should not exceed 10%;

[0148] 4. Inter-batch difference: The inter-batch coefficient of variation (CV) should not exceed 15%. The test results of the kit accuracy, system linearity and repeatability are shown in Table 5.

[0149] Table 5 Accuracy, system linearity and repeatability test results

[0150]

[0151] 5. Stability: The parameter test results of the components of the kit after being stored at 37ºC for 3 days, 6 days, 9 days and 12 days are shown in Table 6. The kit has good storage stability and can be stored at 37ºC for 12 days.

[0152] Table 6 37°C storage stability test results

[0153]

[0154] 6. Analytical specificity:

[0155] 6.1 Cross-reaction: Cross-reactants are usually proteins with high homology, sequence similarity or similar detection significance to the substance to be tested. If these cross-reactants are present in the sample, the antibody may recognize and bind to these cross-reactants, resulting in false positives. Therefore, the cross-reactivity of the diagnostic kit is an important indicator. This is very important for the reliability of clinical results. The human MMP-9 negative sample N1 and the positive sample P1 were tested separately. Three concentration gradients of cross-reactants were added to the N1 and P1 samples respectively, and the cross-reaction of the cross-reactants to the MMP-9 detection was tested: when the concentrations of human matrix metalloproteinase 1, human matrix metalloproteinase 2, human matrix metalloproteinase 3, human matrix metalloproteinase 8, human matrix metalloproteinase 10, human matrix metalloproteinase 13 and human matrix metalloproteinase 18 were not greater than 30ng / ml, there was no obvious effect on the detection results of human MMP-9. The excellent anti-cross-reactivity of the disclosed kit is demonstrated.

[0156] 6.2 Analysis of interfering substances: Three concentration gradients of interfering substances were added to the N1 and P1 samples respectively to detect the effects of interfering substances on the MMP-9 detection reagent at different concentrations:

[0157] 6.2.1 Exogenous interfering substances: The concentration of olopatadine hydrochloride is not higher than 0.5%, the concentration of emedastine fumarate is not higher than 0.2%, the concentration of fluorometholone is not higher than 0.5%, the concentration of pranoprofen is not higher than 0.5%, the concentration of acyclovir is not higher than 0.5%, the concentration of ganciclovir is not higher than 0.5%, the concentration of levofloxacin is not higher than 1.5%, the concentration of tobramycin is not higher than 1.5%, the concentration of chlortetracycline hydrochloride is not higher than 2.5%, the concentration of carteolol is not higher than 10%, the concentration of brinzolamide is not higher than 5%, the concentration of sodium hyaluronate is not higher than 0.5%, the concentration of azelastine hydrochloride is not higher than 0.5%, and the concentration of pemirolast potassium is not higher than 0.5%. There is no obvious effect on the detection results of human MMP-9 antigen.

[0158] 6.2.1 Endogenous interfering substances: When the concentration of human lysozyme is no higher than 20 mg / ml, the concentration of human IgA is no higher than 20 IU / ml, the concentration of human IgE is no higher than 50 IU / ml, and the concentration of human lactoferrin is no higher than 30 mg / ml, there is no significant impact on the detection results of human MMP-9 antigen.

[0159] Example 6 Comparison results of the chemiluminescence kit for human MMP-9 with the gold standard

[0160] All patients with dry eye underwent tear secretion test (Schirmer I test) and fluorescein sodium staining for tear film break-up time (FBUT) according to the methods described in the "Chinese Expert Consensus on the Clinical Diagnosis and Treatment of Dry Eye (2024)". Clinical diagnosis of dry eye can be made if one of the following two criteria is met:

[0161] 1. FBUT ≤ 5 s or Schirmer I ≤ 5 mm / 5 min without surface anesthesia, and there is one of the subjective symptoms such as dryness, foreign body sensation, burning sensation, fatigue, discomfort, and vision fluctuation in the eyes, then dry eye can be diagnosed.

[0162] 2. 5 s < FBUT ≤ 10 s or 5 mm / 5 min < Schirmer I ≤ 10 mm / 5 min without surface anesthesia, and there is one of the subjective symptoms such as dryness, foreign body sensation, burning sensation, fatigue, discomfort, and vision fluctuation in the eyes, and at the same time, corneal and conjunctival fluorescein staining is positive, then dry eye can be diagnosed.

[0163] Negative samples were samples of patients diagnosed as non-dry eye patients by the test institution (including samples of healthy people with normal results in hospital physical examinations and samples of patients with other diseases diagnosed as non-dry eye patients). A total of 300 samples were collected in the early stage, among which 50 were dry eye samples diagnosed by the above method, and the remaining 250 were diagnosed as non-dry eye samples.

[0164] Among the 50 positive samples detected by the gold standard, the kit of the present disclosure was able to detect 46 positive samples; among the 250 samples of non-dry eye patients, the kit of the present disclosure was able to detect 241 as negative.

[0165] Taking the gold standard test result as the standard: The positive coincidence rate of the kit of the present disclosure: 46 / (46 + 4) × 100% = 92.0%; The negative coincidence rate of the kit of the present disclosure: 241 / (241 + 9) × 100% = 96.4%; The total coincidence rate is: (46 + 241) / (46 + 241 + 4 + 9) × 100% = 95.67%; Kappa coefficient = 0.863 > 0.85.

[0166] As described above, the test results of the kit of the present disclosure have good positive and negative coincidence rates compared with the clinical diagnosis gold standard.

[0167] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. An anti-human MMP-9 antibody or an antigen-binding fragment thereof, characterized in that: The antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises a heavy chain CDR1, a heavy chain CDR2 and a heavy chain CDR3, and the light chain variable region comprises a light chain CDR1, a light chain CDR2 and a light chain CDR3; wherein: The amino acid sequences of the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 are shown as SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, respectively; the amino acid sequences of the light chain CDR1, light chain CDR2 and light chain CDR3 are shown as SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, respectively.

2. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO:6, or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:6, or a sequence having one or more amino acid substitutions, deletions or insertions, or any combination thereof, compared to the amino acid sequence shown in SEQ ID NO:6; The light chain variable region comprises the amino acid sequence shown in SEQ ID NO:10, or an amino acid sequence that has at least 90% identity with the amino acid sequence shown in SEQ ID NO:10, or a sequence having one or more amino acid substitutions, deletions or insertions, or any combination thereof, compared to the amino acid sequence shown in SEQ ID NO:

10.

3. A biomaterial, characterized in that: The biological material comprises: 1) A polynucleotide encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2; 2) a vector comprising the polynucleotide described in 1); 3) A host cell comprising the polynucleotide described in 1) or the vector described in 2).

4. The biomaterial according to claim 3, characterized in that The polynucleotide sequence encoding the heavy chain variable region of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2 is shown in SEQ ID NO: 14; the polynucleotide sequence encoding the light chain variable region of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2 is shown in SEQ ID NO: 18; The vectors include linear polynucleotides, plasmids, and viral vectors; The host cells include prokaryotic cells and eukaryotic cells.

5. An antibody derivative, characterized in that: The antibody derivative is a complex obtained by modifying the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2; the modification includes modification by conjugation with a detectable marker, modification by conjugation with a therapeutic agent, and modification by conjugation with an imaging agent.

6. The antibody derivative according to claim 5, characterized in that The detectable markers include fluorescent pigments, avidin, paramagnetic atoms, radioisotopes, enzyme markers, and colloidal gold; The therapeutic agents include cytotoxic agents, hormone agents, targeted small molecule agents, proteasome inhibitors, chemotherapeutic agents, oncolytic drugs, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules.

7. A kit for detecting MMP-9, characterized in that: The kit comprises the antibody or antigen-binding fragment thereof according to any one of claims 1-2, the biological material according to any one of claims 3-4, or the antibody derivative according to any one of claims 5-6.

8. The kit according to claim 7, characterized in that The kit also includes magnetic beads coupled to MMP-9 antigen protein and chemiluminescent liquid; The chemiluminescent liquid includes an enzymatic reaction luminescent agent, a direct chemiluminescent agent, and an electrochemiluminescent agent; The enzymatic reaction luminescent agent includes an enzymatic reaction enzyme and a luminescent substrate of the enzymatic reaction enzyme; The enzymatic reaction enzymes include horseradish peroxidase, alkaline phosphatase, glucose oxidase, β-galactosidase, lysozyme, and malate dehydrogenase; The luminescent substrates of the enzyme-catalyzed reaction enzyme include luminescent substrates of horseradish peroxidase, luminescent substrates of alkaline phosphatase, luminescent substrates of glucose oxidase, luminescent substrates of β-galactosidase, luminescent substrates of lysozyme, and luminescent substrates of malate dehydrogenase; The direct chemiluminescent agent includes a reagent that does not require the catalytic action of an enzyme and can emit light by simply changing the pH conditions of the solution; The electrochemiluminescent agent includes a substance that undergoes an electrochemical reaction on the surface of an electrode to emit light.

9. Any of the following methods, comprising: (1) A method for producing the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, characterized in that the method comprises the following steps: culturing the host cell according to any one of claims 3 to 4 to obtain a culture product, and isolating and purifying the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2 from the culture product; (2) A method for detecting MMP-9 or a fragment thereof in a sample for non-diagnostic and non-therapeutic purposes, characterized in that the method comprises the following steps: contacting the sample with the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2 or contacting the sample with the antibody derivative according to any one of claims 5 to 6, and detecting the formation of a complex between the antibody or antigen-binding fragment thereof or the antibody derivative and MMP-9 or a fragment thereof; (3) A method for preparing the host cell according to any one of claims 3 to 4, characterized in that the method comprises the following steps: introducing the polynucleotide molecule according to any one of claims 3 to 4 or a vector containing the same into the host cell; The introduction methods include calcium phosphate transfection, DEAE, dextrose-mediated transfection, electroporation, and phage infection.

10. Any of the following applications, characterized in that: The applications include: 1) Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, the biomaterial according to any one of claims 3 to 4, or the antibody derivative according to any one of claims 5 to 6 in the preparation of a product for detecting, identifying or screening MMP-9 protein; 2) Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, the biomaterial according to any one of claims 3 to 4, the antibody derivative according to any one of claims 5 to 6, or the kit according to any one of claims 7 to 8 in the preparation of a product for diagnosing inflammatory diseases, cardiovascular diseases, nervous system diseases, or ophthalmic diseases caused by abnormal MMP-9 levels; The inflammatory diseases caused by abnormal MMP-9 levels include rheumatoid arthritis and inflammatory bowel disease; the cardiovascular diseases caused by abnormal MMP-9 levels include atherosclerosis and heart failure; the nervous system diseases caused by abnormal MMP-9 levels include multiple sclerosis and ischemic stroke; the ophthalmic diseases caused by abnormal MMP-9 levels include dry eye disease, neovascular eye disease, vernal keratoconjunctivitis, and infectious keratitis.

Images