Ssaespecially talaromyces sp. T28 with biocontrol and growth promoting functions and application of Ssaespecially talaromyces sp. T28

Abstract

The invention relates to a talaromyces sayerrensis T28 with biocontrol and growth-promoting functions and application thereof, and belongs to the technical field of agriculture (plant protection). Endophytic fungi are separated from healthy tobacco plants, the biocontrol strain T28 with disease-preventing and growth-promoting functions is screened from the endophytic fungi, and the strain is remarkable in antibacterial effect and growth-promoting effect, can promote development of tobacco root systems, and has a good application prospect. Meanwhile, the tobacco black shank prevention and treatment effect can be effectively improved, the problems of pesticide resistance development of plant pathogenic bacteria, pesticide residues and the like are solved, and a theoretical basis is provided for development and application of a novel biocontrol fungicide.

Description

Technical Field

[0001] The present invention belongs to the technical field of agriculture (plant protection), and aims to effectively promote tobacco growth and control the occurrence of tobacco black shank disease through the application of T28, and solve the problems of the development of plant pathogen resistance and pesticide residues. Background Art

[0002] Tobacco is one of my country's important industrial and cash crops, with a dominant planting area and output in the world. Every year, the taxes paid by China's tobacco industry account for nearly 10% of the country's fiscal revenue, becoming one of the important sources of national fiscal revenue. Tobacco black shank disease is caused by Phytophthora nicotianae ( Phytophthoranicotianae ) caused by soil-borne oomycete disease: It was first discovered and identified in Shandong, my country in 1934, and then expanded to tobacco-producing provinces in the Yellow River Basin, Yangtze River Basin and Pearl River Basin; the disease was first reported in the Huanghuai tobacco area in 1950, and it has been seriously harmful for many years. The typical symptoms of the disease are wilting and yellowing of leaves, dwarfing of plants, and necrosis of roots and stem bases. After the pathogen infects the roots and stem bases, black spots are produced, which quickly spread to the vascular bundles, destroying their structure and function, causing the leaves to turn yellow from bottom to top, and finally the whole plant withers. The disease occurs all year round in the main tobacco-producing areas, affecting the yield and quality of tobacco leaves, and causing huge losses to tobacco production. For a long time, chemical control of black shank disease has been mainly carried out by spraying with agents such as metalaxyl and dimethomorph, but long-term use of chemical agents will cause problems such as pesticide residues and increased resistance of pathogens, which does not meet the requirements of green prevention and control of tobacco diseases and insect pests. With the introduction of the concept of "green plant protection", biological control with the advantages of safety, high efficiency and low toxicity has received widespread attention. Obtaining endophytes from plants as biological control resources is gradually becoming a widely advocated biological control approach.

[0003] Endophytic fungi refer to fungi that live in the intercellular spaces or cells of various tissues and organs of healthy plants at certain stages or all stages of their life cycle, and usually do not cause obvious symptoms of infection in the host. Endophytic fungi can produce biological control agents, plant hormones, and secondary metabolites such as iron carriers and hydrolases. These substances play an important role in the growth and development of plants, promote the growth of plant roots, and improve the absorption and utilization efficiency of nutrients by plants, thereby enhancing the stress resistance and productivity of plants. Endophytic fungi have the same ecological niche as pathogens. They compete with each other for space, nutrition and other resources in the plant body, so that pathogens cannot get normal nutrition supply and die. At the same time, endophytic fungi can also secrete metabolites such as antibiotics and toxins to induce plants to produce systemic resistance, thereby enhancing the ability of plants to resist diseases.

[0004] In order to implement green prevention and control of tobacco black shank, expand the resources of biocontrol bacteria, isolate endophytic fungi from healthy tobacco plants, and screen biocontrol strains with disease prevention and growth-promoting functions, providing a theoretical basis for the development and application of new biocontrol agents.

[0005] Disadvantages and causes: (I) Difficulty in preventing and controlling soil-borne plant diseases In recent years, with the continuous planting of crops and the development of protected areas, soil-borne diseases have become more and more serious year by year, causing huge economic losses to agricultural production. Soil-borne diseases usually have the following characteristics: many types of pathogens, wide host range, strong concealment, fast transmission speed, large damage area, and difficult control. When preventing and controlling soil-borne diseases, using a single, especially targeted, agent is not only difficult to achieve the ideal prevention and control effect, but also makes the pathogens resistant to drugs. In addition, since the soil in the crop cultivation layer weighs 150t / 667m 2 The above mentioned dosage of pesticides required for the prevention and control of these pests is very large. It is difficult to directly kill the pathogens by using contact pesticides because they are difficult to distribute evenly. The pathogens that are not killed will continue to spread harm along with water flow and agricultural operations. Therefore, the prevention and control of soil-borne diseases requires some special measures and methods, and usually requires the help of machinery. It is difficult to achieve continuous control of soil-borne diseases with current technology.

[0006] (II) Application of disease-resistant and disease-tolerant varieties Planting disease-resistant and disease-tolerant varieties is the main prevention and control technology in agricultural production. However, for soil-borne diseases, it is difficult to develop high-quality germplasm resources that are disease-resistant and disease-tolerant due to the strong saprophytic nature of the pathogens and their wide host range. In addition, resistant varieties do not have permanent disease resistance. Under field conditions that are conducive to the occurrence of diseases, resistant genotypes do not always have a complete protective effect. Currently, there are no varieties that are immune or highly resistant to tobacco black shank disease for use in agricultural production.

[0007] 3. Insufficient agricultural prevention and control Agricultural control can reduce the occurrence of diseases, but there are limitations in achieving effective control of diseases. Although meticulous field management, such as timely removal of diseased plant residues, can significantly reduce the source of disease infection, it cannot ensure the complete eradication of pathogens. Although the removal of diseased plant residues can reduce the risk of disease transmission to a certain extent, pathogens may still lurk in the soil, water sources or other plant tissues, and may cause diseases again at any time. In addition, there are many types of pests and diseases, and each has its own unique ecological habits and harm characteristics. Although a specific agricultural control measure may have a significant control effect on a certain pest and disease, it may also inadvertently provide favorable conditions for the breeding of another pest and disease, leading to the rebound or outbreak of another pest and disease. Some diseases have regional and seasonal characteristics, which makes the effect of agricultural ecological control relatively slow. For explosive diseases, it is difficult to respond quickly to sudden outbreaks of diseases. Although agricultural ecological control helps to build a long-term ecological balance, it is often difficult to quickly control the spread of diseases in the short term, which may cause serious losses to agricultural production.

[0008] 4. Disadvantages of chemical control The application of chemical agents is an important way to prevent and control soil-borne plant diseases in agricultural production. However, the large-scale use of chemical agents will cause environmental pollution and increase the amount of drug residues in agricultural products. These residues may pose a potential threat to human health. Long-term use of chemical agents will cause pests and diseases to develop resistance, which will gradually reduce the control effect of pesticides. In order to achieve control effects, farmers may need to use more types of pesticides and higher dosages, which not only increases production costs, but may also pose a greater threat to the environment and human health. Summary of the invention

[0009] The purpose of the present invention is to address the problems of wide occurrence and serious harm of tobacco black shank disease, lack of effective disease-resistant and disease-tolerant varieties, and chemical control that easily causes pesticide residues and enhanced resistance of pathogens. From the perspective of safe and low-toxic biological control, the principle of microbial antagonism is utilized to separate, screen and identify a black shank disease biocontrol strain - Talaromyces sayulitans T28 from tobacco plants, which has significant antibacterial effect and obvious growth-promoting effect.

[0010] In order to achieve the above object, the specific scheme adopted by the present invention is: In the first aspect, a strain of Talaromyces sayulitans T28, classified as Talaromycess ayulitensis , deposited in China General Microbiological Culture Collection Center with the deposit number CGMCC NO.41532.

[0011] Secondly, the application of the above-mentioned Talaromyces sayulitans T28 in plant growth promotion and disease control.

[0012] Furthermore, the plant is tobacco, and the disease is black shank.

[0013] In a third aspect, a biological preparation for preventing and treating tobacco black shank disease comprises the above-mentioned Talaromyces sayulitans T28 and / or its fermentation intermediates.

[0014] In a fourth aspect, a method for preventing and controlling tobacco black shank disease is provided, wherein the biological agent is applied to tobacco plants by root irrigation.

[0015] Beneficial effects: The present invention isolates, screens and identifies a black shank disease biocontrol strain - Talaromyces sayulitans T28 from tobacco plants, which has significant antibacterial effect, obvious growth-promoting effect, is green and environmentally friendly, and effectively improves the prevention and control effect of tobacco black shank disease while promoting the development of tobacco root system, making tobacco plants stronger and leaves more luxuriant.

[0016] Description of strain preservation: A strain of Talaromyces saryuritans T28, which belongs to Talaromycess ayulitensis , deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCCNO.41532 and the deposit date of October 9, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a diagram showing the colony morphology and microstructure observation results of the strain to be tested; in the figure: a: front side of the colony; b, c: conidiophores and conidia.

[0018] Figure 2 is based on T28 rDNA- β-tubulin Phylogenetic tree constructed from sequences.

[0019] Figure 3 This is a diagram showing the inhibitory effect of the T28 strain on tobacco phytophthora. In the figure, a: CK; b: T28 confronting the tobacco phytophthora plate.

[0020] Figure 4 This is a diagram showing the plate inhibition effect of the fermentation liquid of the T28 strain on tobacco Phytophthora; in the figure, a: CK; b: plate inhibition effect of the fermentation liquid of T28 on tobacco Phytophthora.

[0021] Figure 5 This is a diagram of the color reaction results of the fermentation broth of the T28 strain; in the figure, a: negative control; b: positive control; c: fermentation broth of the T28 strain.

[0022] Figure 6 This is a diagram showing the separation of root, stem and leaf tissues of tobacco plants with different treatments; in the figure, a: target strain T28; b, c: CK root and stem separation; d, e: PD root and stem separation; f, g: T28 treatment root and stem separation.

[0023] Figure 7 This is a diagram showing the specificity verification results of DNA isolated from roots and stems of tobacco plants after root irrigation of T28. In the diagram, M: Marker; 1: T28 genomic DNA; 2: DNA isolated from roots; 3: DNA isolated from stems.

[0024] Figure 8 This is a diagram of the specificity verification results of DNA in root, stem and leaf tissues of tobacco plants with different treatments; in the figure, M: Marker; 1: T28 genomic DNA; 2, 3, 4: DNA of root, stem and leaf tissues treated with clean water; 5, 6: DNA of root tissue of T28 irrigated root; 7, 8: DNA of stem tissue of T28 irrigated root; 9, 10: DNA of leaf tissue of T28 irrigated root.

[0025] Fig. 9 This is a graph showing the effects of different treatments on seven antioxidant enzymes in the roots of tobacco plants; in the graph, a: SOD activity; b: POD activity; c: CAT activity; d: APX activity; e: PAL activity; f: PPO activity; g: MDA activity.

[0026] Fig.10 This is a graph showing the greenhouse control effect of different treatments on tobacco black shank disease. In the figure, a: CK treatment; b: PD treatment; c: root irrigation with T28 fermentation liquid; d: Bacillus subtilis spraying. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0028] 1. Isolation and identification of strains 1. Isolation of strains The samples were from healthy tobacco plants in the tobacco fields of Xiaowang Village, Wangjia Village, Shahe Township, Lushi County, Sanmenxia City, and were separated by tissue separation. After cutting the tissue block, it was disinfected with 75% ethanol for 15-30 seconds and then washed with sterile water; disinfected with 3% sodium hypochlorite for 1-3 minutes, washed with sterile water 3 times, and the sodium hypochlorite solution on the surface of the tissue block was cleaned, placed on sterile filter paper to dry, transferred to potato dextrose agar (PDA), and placed in a constant temperature incubator at 25°C for 5-7 days. After the fungal colonies grew from the tissue block, they were transferred to fresh PDA. After the colonies grew uniformly and without contamination, the bacterial cake was taken from the edge of the colony, transferred to a 2mL sterile centrifuge tube, sterilized liquid paraffin was added, and stored at room temperature.

[0029] 2. Identification of morphological characteristics of strains The strain isolated above was transferred to PDA medium, and inserted into a sterilized coverslip at 45° using the insert method and cultured in a 25°C constant temperature incubator for 3-5 days. The growth rate and morphological characteristics of the colony were observed, and the spore production structure, spore morphology and size, hyphae morphology, etc. were observed under a microscope. With reference to the Manual of Fungal Identification, its taxonomic status was preliminarily determined.

[0030] Through observation, the strain grew slowly on PDA medium, with yellow velvety colonies, a circle of yellow-white hyphae on the outside, and no obvious odor ( Figure 1 -a). The spore-producing structure is a symmetrical double whorl of broom-like branches, that is, clusters of similar-sized peduncles are produced at the top of the conidiophores, and clusters of similar-sized lanceolate phialides are produced at the top of the peduncles. The peduncles and phialides are arranged symmetrically, and chain-arranged conidia are produced at the top of the phialides ( Figure 1 -b); conidia are spherical to ellipsoidal with smooth walls ( Figure 1 -c). Colony morphology and characteristics of the genus Talaromyces ( Talaromyces.sp ) Fungi consistent.

[0031] 3. Molecular Biological Identification of the Strains The DNA of the strain was extracted and the primers Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC) were used to amplify the endophytic fungus. β-tubulin Gene fragment. The PCR reaction system was: 2 μL DNA template, 1 μL upstream and downstream primers, 15 μL 2×PCRTaqMasterMix, and ddH2O was added to 25 μL; the PCR amplification program was: 98°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 52°C annealing for 10 s, 72°C extension for 15 s, 35 cycles, and finally 72°C extension for 5 min. The PCR reaction product was detected by 1% agarose gel electrophoresis and sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing results were submitted to the NCBI database for BLAST homology analysis and comparison, and the gene sequences with higher homology similarity were selected. The phylogenetic tree was constructed using the neighbor-joining method using MEGA11.0 software.

[0032] The strains to be tested were obtained β-tubulin Blast analysis of the sequence in the database showed that the strain Talaromycess ayulitensis (MK451267.1, PP596878.1, PP596877.1, PP596874.1, KJ775206.1) sequence similarity is 100.00%, and they are located in the same evolutionary branch, with a node support rate of 97% ( Figure 2 ), combined with morphological characteristics and molecular identification, the strain was classified as Talaromycess ayulitensis, named T28, and deposited in the China General Microbiological Culture Collection Center with the deposit number CGMCC NO.41532.

[0033] 2. Evaluation of plate antibacterial effect of strain T28 1. Initial screening The plate confrontation method was used to determine its inhibitory effect on tobacco phytophthora. 5mm purified endophytic fungi and tobacco phytophthora cakes were inoculated at two symmetrical points 2.5cm away from the center of the plate, with only tobacco phytophthora cakes inoculated as the control. The experiment was repeated three times and incubated at 25℃ for 6-8 days. The diameter of tobacco phytophthora colonies was measured and the inhibition rate was calculated.

[0034] The results showed that T28 had a good plate inhibition effect on tobacco phytophthora ( Figure 3 ), the inhibition rate was 50.12%.

[0035] 2. Rescreening After the T28 strain was fermented and shake-cultured, the mycelium growth rate method was used to determine the inhibitory effect of its fermentation liquid on tobacco Phytophthora. The calculation method of the inhibition rate was the same as above.

[0036] The results showed that T28 fermentation liquid had a good inhibitory effect on tobacco phytophthora ( Figure 4 ), the inhibition rate was 88.33%.

[0037] 3. Evaluation of IAA production capacity Use a cork puncher to punch the bacterial cake at the edge of the activated T28 colony, inoculate it into PD liquid medium containing L-tryptophan, and shake it at 25℃, 180r / min for 5-6 days. Take 1mL of the fermentation liquid of the endogenous strain and centrifuge it at 8000r / min for 5min, take 100μL of the supernatant and add an equal amount of Salkowski colorimetric solution to mix thoroughly; add the same volume of colorimetric solution to the sterilized PD liquid medium as a negative control, and use 50mg / L indoleacetic acid standard solution as a positive control; leave it at room temperature and avoid light for 30min, and observe the color change. The color changes to pink, indicating the production of indole-3-acetic acid.

[0038] The color development results showed that the color of T28 turned pink in the Salkowski colorimetric solution ( Figure 5 ), indicating that the T28 strain has the ability to produce indole-3-acetic acid and can be used to produce indole-3-acetic acid and promote plant growth.

[0039] 4. Evaluation of the growth-promoting effect of strain T28 on potted tobacco plants A pot experiment was conducted with three treatments: blank control treatment: PD, each plant was irrigated with 10 mL of PD medium; CK, each plant was irrigated with 10 mL of sterile water; treatment group: each plant was irrigated with 10 mL of 1×10 6 CFU / mL of T28 strain fermentation liquid was used for root irrigation, 15 plants were treated in each treatment, and repeated 3 times. Healthy tobacco seedlings with uniform growth were selected for root irrigation. On the 21st day, the maximum leaf length, maximum leaf width, stem diameter, aboveground fresh weight, root fresh weight, chlorophyll, N content and other biomass indicators of tobacco plants were measured according to the tobacco industry standard of the People's Republic of China (YC / T142-2010) for measuring tobacco agronomic traits. The results are shown in Table 1.

[0040] Table 1 Growth-promoting effect of T28 strain fermentation liquid on potted tobacco plants Note: Different lowercase letters after the same column of data in the table indicate differences in P The difference was significant at the <0.05 level.

[0041] From the data results in Table 1, it can be seen that the maximum leaf length, maximum leaf width, stem diameter, aboveground fresh weight, root fresh weight, chlorophyll, N content and other indicators of the tobacco plants in the T28 treatment group were all increased compared with the control group, indicating that the strain T28 had a promoting effect on tobacco growth.

[0042] 5. Colonization of strain T28 in potted tobacco plants 1. Strain Reisolation Method Randomly select 5 tobacco seedlings from the potted experiment, divide them into three parts: root, stem and leaf, and separate them by tissue separation method. After 5-7 days of cultivation, observe the growth of colonies.

[0043] The results are as follows Figure 6 As shown, colonies were isolated from leaves of the three treatments, no target colonies were isolated from roots and stems of CK and PD treatments, and target colonies were isolated from roots and stems of T28 treatment.

[0044] 2. Specific primer detection method T28 strain β-TubulinThe gene sequence was used as a template to design specific primers TS28F (CAATCGGTGCTGCTTTCTGG) and TS28R (CGGACTGGCCGAAAACAAAG). The target colony DNA isolated from the roots and stems was extracted for specific amplification. The PCR reaction system was: 2 μL DNA template, 1 μL upstream and downstream primers, 15 μL 2×PCRTaqMasterMix, and ddH2O was added to 25 μL. The PCR amplification program was: 98°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 52°C annealing for 10 s, 72°C extension for 15 s, 35 cycles, and finally 72°C extension for 5 min. The PCR reaction products were detected by 1% agarose gel electrophoresis.

[0045] The amplification results are as follows Figure 7 As shown, after amplification, the target colony DNA isolated from the root and stem showed specific bands, which were identical to the T28 genomic DNA fragment, indicating that the isolated colony was T28.

[0046] In order to further verify that T28 can colonize in tobacco, DNA from the root, stem and leaf tissues of tobacco plants after root irrigation with T28 fermentation liquid was extracted and PCR amplification was performed using specific primers in the same manner as above.

[0047] The amplification results are as follows Figure 8 As shown, no bands were amplified from the roots, warps and leaves of tobacco plants that were not irrigated with T28 fermentation solution, while no bands were amplified from the leaves of tobacco plants that were irrigated with fermentation solution. Bands were amplified from the roots and stems, and were identical to the T28 genomic DNA fragments, indicating that the T28 strain colonized the roots and stems of tobacco.

[0048] 6. Evaluation of the physiological parameters of the root system of potted tobacco seedlings by strain T28 Superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX), phenylalanine ammonia lyase (PAL), polyphenol oxidase (PPO), malondialdehyde (MDA) are the main antioxidant enzymes in plants, playing an important role in active oxygen scavenging, biological antioxidant, normal plant growth and development, and resistance to pathogens. The activities of the seven enzymes in this test were determined using kits (provided by Beijing Solebow Technology Co., Ltd.).

[0049] The roots of tobacco seedlings in the potted experiment were rinsed clean and placed on filter paper to absorb moisture. 0.5 g of roots of 5 plants were randomly selected for each treatment, cut into pieces and mixed evenly, and the activities of 7 enzymes were measured in sequence according to the instructions of the kit. The measurement was repeated 3 times and the average value was taken.

[0050] The results are as follows Fig. 9It can be seen that the fermentation broth of strain T28 can significantly increase the activities of seven enzymes, including SOD, POD, CAT, APX, PAL, PPO, and MDA, in tobacco roots.

[0051] 7. The efficacy of T28 strain against tobacco black shank in greenhouse A pot experiment was conducted with four treatments: treatment 1: PD, each plant was irrigated with 10 mL of PD medium; treatment 2: CK, each plant was irrigated with 10 mL of sterile water; treatment 3: each plant was irrigated with 10 mL of T28 fermentation liquid with a concentration of 1×106 CFU / mL; treatment 4: Bacillus subtilis microcapsule granules (Chengdu Tepu Biotechnology Co., Ltd., production batch number: T23L00825), with an active ingredient content of 100 million CFU / g, 400-600 g / mu sprayed on the stem base. Each treatment had 15 plants and was repeated 3 times. After 21 days, the disease was investigated. The disease classification standard was based on the national standard of the People's Republic of China (GB / T23222-2008) for tobacco pests and diseases classification and investigation methods to record the degree of disease in tobacco plants, and calculate the incidence rate, disease index and control effect.

[0052] Incidence rate = (number of diseased plants / total number of plants investigated) × 100% Disease index = [Σ (number of diseased plants or leaves at each level × value of the disease level) / (total number of plants or leaves investigated × highest level value)] × 100 Prevention effect = (disease index of control area - disease index of treated area) / disease index of control area × 100% The greenhouse control effect of T28 on tobacco black shank disease showed that the tobacco plants treated with CK and PD were significantly shorter and had dry leaves, while the plants treated with root irrigation with T28 fermentation liquid and spraying with Bacillus subtilis were strong and had slightly yellow leaves ( Fig.10 ). The results showed that root irrigation with T28 fermented liquid reduced the incidence of black shank disease, and the control effect reached 80.08%.

[0053] Table 2 The greenhouse control effect of T28 strain fermentation liquid on tobacco black shank 8. Field growth promotion effect of strain T28 and field control effect on tobacco black shank disease (1) Effects of strain T28 on agronomic traits of tobacco In May 2024, a plot with serious tobacco black shank disease last year was selected in Shicun Village, Gaocun Town, Yiyang County, Luoyang City, Henan Province for experiment. The tobacco variety was Western Zhongyan 100. There were 3 treatments in the experiment. Treatment 1, clean water control (CK); Treatment 2, culture medium control (PD); Treatment 3, T28 fermentation liquid root irrigation; Treatment 4, Bacillus subtilis microcapsule granules (Chengdu Tepu Biotechnology Co., Ltd., production batch number: T23L00825), active ingredient content 100 million CFU / g, 400-600 g / mu sprayed on the stem base. 55 plants per treatment, repeated 3 times. The plot was arranged in random blocks, with a row spacing of 110 cm and a plant spacing of 55 cm. Root irrigation was performed when the tobacco seedlings were transplanted, 10 mL per plant.

[0054] Agronomic traits survey: plant height, stem diameter, maximum leaf length, maximum leaf width, chlorophyll content, and N content were measured according to the tobacco industry standard of the People's Republic of China (YC / T 142-2010), and surveyed once at the clustering stage and the vigorous growth stage.

[0055] The growth promotion results are shown in Table 3. Root irrigation with T28 fermented liquid at both the clustering stage and the vigorous growth stage increased the plant height, maximum leaf length, maximum leaf width, stem diameter, chlorophyll and N content of tobacco plants, and there were significant differences compared with the control.

[0056] Table 3 Effects of T28 strain fermentation broth on agronomic traits of tobacco plants Note: Different lowercase letters after the same column of data in the table indicate differences in P The difference was significant at the <0.05 level.

[0057] (2) Effect of strain T28 on tobacco leaf yield Tobacco leaves from each treatment were collected at the harvesting period, their fresh weights were measured, and after being fixed at 105°C for 30 min, they were dried at 65°C to a constant mass, their dry weights were measured, and tobacco leaf yields were calculated.

[0058] Compared with CK, PD and Bacillus subtilis treatments, T28 treatment significantly increased the fresh weight and dry weight of tobacco leaves and increased tobacco leaf yield.

[0059] (3) Field efficacy of strain T28 against tobacco black shank Field disease occurrence survey: disease surveys were conducted during the peak disease period. All tobacco plants were surveyed in each plot and the number of diseased tobacco plants was recorded. Disease grading standards were based on the National Standard of the People's Republic of China (GB / T 23222-2008) on tobacco disease and pest grading and survey methods. The disease severity of tobacco plants was recorded and the incidence rate, disease index and control effect were calculated.

[0060] Incidence rate = (number of diseased plants / total number of plants investigated) × 100% Disease index = [Σ (number of diseased plants or leaves at each level × value of the disease level) / (total number of plants or leaves investigated × highest level value)] × 100 Prevention effect = (disease index of control area - disease index of treated area) / disease index of control area × 100% Table 4 The control effect of T28 strain fermentation liquid on tobacco black shank disease The field control effect of T28 on tobacco black shank is shown in Table 4. The results show that root irrigation with T28 fermentation liquid reduced the incidence of black shank disease, and the control effect reached 77.51%.

[0061] Table 5 Comparison between the present invention and the prior art It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. A strain of Talaromyces sayulitans T28, classified and named Talaromyces sayulitensis , deposited in China General Microbiological Culture Collection Center with the deposit number CGMCC NO.41532.

2. Use of the Talaromyces sayulitans T28 according to claim 1 in plant growth promotion and disease control.

3. The use according to claim 2, characterized in that: The plant is tobacco.

4. The use according to claim 2, characterized in that: The disease is black leg disease.

5. A biological agent for preventing and treating tobacco black shank disease, characterized in that: The biological preparation comprises the Talaromyces sarutus T28 described in claim 1 or / and its fermentation intermediates.

6. A method for preventing and treating tobacco black shank disease, characterized in that: The biological preparation according to claim 5 is applied to tobacco plants by root irrigation.

Images