Method for increasing L-carnosine yield of escherichia coli by increasing PRPP supply

Abstract

The invention belongs to the technical field of biochemical engineering, and provides a method for increasing L-carnosine yield of escherichia coli by increasing PRPP supply, and the yield and yield of L-carnosine are remarkably increased by up-regulating expression of a prs gene, increasing PRPP content in cells and promoting synthesis of L-histidine. Experiments show that the yield of the L-carnosine in different recombinant strains is increased by 55.56%-140%, and L-histidine and beta-alanine do not need to be added in the production process.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical engineering, and in particular relates to a method for increasing the L-carnosine production of Escherichia coli by increasing the supply of PRPP. Background Art

[0002] L-carnosine is a dipeptide composed of β-alanine and L-histidine, which exists naturally in human skeletal muscle, brain, heart and gastrointestinal tissue. L-carnosine can scavenge free radicals, reduce mitochondrial function damage, resist glycosylation, inhibit telomere shortening, etc. It has antioxidant, anti-aging and anti-tumor functions. Its functions include protecting the nervous system, preventing ulcers, promoting cell energy metabolism, etc. It can be used for the prevention and regulation of diseases such as Alzheimer's disease, peptic ulcers, diabetes, and arteriosclerosis, and is widely used in the fields of medicine, food and cosmetics. At present, L-carnosine is mainly prepared by chemical synthesis and enzyme catalysis. Compared with these two preparation methods, the preparation of L-carnosine by microbial fermentation has the advantages of low cost, mild reaction conditions, high production efficiency and environmental friendliness, and is suitable for large-scale industrial production. Summary of the invention

[0003] The object of the present invention is to provide a method for increasing the production of L-carnosine in Escherichia coli by increasing the supply of PRPP.

[0004] The present invention is conceived as follows: L-carnosine is synthesized in Escherichia coli by a microbial fermentation method, wherein glucose is used to synthesize L-histidine and L-aspartic acid, and L-aspartic acid is synthesized by panD Genetically encoded aspartate-α-decarboxylase catalyzes the production of β-alanine, and L-histidine and β-alanine are pepD The dipeptidase encoded by the gene catalyzes the production of L-carnosine. prs The PRPP synthase encoded by the gene can catalyze the synthesis of PRPP, which is a precursor of L-histidine and can be synthesized through the histidine synthesis operon hisGDCBHAFI Encoding enzyme catalyzed ten-step reaction to generate histidine, on the Escherichia coli genome prs Gene transcription is inhibited by PurR protein and upregulated prs Gene expression is expected to increase PRPP supply and promote L-histidine synthesis, thereby increasing L-carnosine production.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides an Escherichia coli engineered bacterium with high L-carnosine production, wherein the engineered bacterium is produced by genetic engineering means by enhancing the prs The expression of genes is constructed; In the present invention, the Escherichia coli is an Escherichia coli having the ability to produce L-histidine, which expresses the gene fragment shown in SEQ ID NO: 4 hisGDCBHAFI , and Bacillus subtilis ( Bacillus subtilis ) Source panD genes and Serratia marcescens ( Serratia marcescens ) Source pepD Gene.

[0006] Among them, Escherichia coli ( Escherichia coli ) Source prs The reference sequence number of the gene in GenBank is 945772.

[0007] Bacillus subtilis ( Bacillus subtilis ) Source panD The reference sequence number of the gene in GenBank is 939033.

[0008] Serratia marcescens ( Serratia marcescens ) Source pepD The reference sequence number of the gene in NCBI is NZ_JGVB01000108.1, 35564-37024 (-).

[0009] In the present invention, Bacillus subtilis ( Bacillus subtilis ) Source panD The gene can be replaced with Corynebacterium glutamicum ( Corynebacterium g lutamicum ) Source CgpanD gene (GenBank No. 1021120), Serratia marcescens ( Serratia marcescens ) Source pepD The gene can be replaced with Clostridium perfringens ( Clostridium perfringens ) Source CppepD gene (NCBI accession number NZ_CATNWI010000015.1, 3045-4496 (-)).

[0010] Furthermore, the method of enhancing gene expression can be selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

[0011] Furthermore, the strong promoter includes Ptrc promoter (SEQ ID NO: 1).

[0012] Furthermore, the engineered bacteria comprises Ptrc- prs Expression cassette and Ptrc- panD - pepD expression cassette, and hisGDCBHAFI Expression plasmids.

[0013] Among them, Ptrc- prs It is driven by the Ptrc promoter prs Gene expression cassette, the sequence of which is shown in SEQ ID NO: 2; Ptrc- panD - pepD It is driven by the Ptrc promoter panD and pepD The tandem gene expression cassette has a sequence as shown in SEQ ID NO:3.

[0014] Preferably, the starting strain is Escherichia coli MG1655.

[0015] In the second aspect, the present invention provides a method for constructing the engineered bacteria, using genetic engineering means to enhance the prs The expression of the gene was used to construct an Escherichia coli engineered bacterium with high L-carnosine production; Wherein, the Escherichia coli is an Escherichia coli having the ability to produce L-histidine, and the gene fragment expressed is as shown in SEQ ID NO:4 hisGDCBHAFI , and Bacillus subtilis panD Genes and Serratia marcescens pepD Gene.

[0016] In a third aspect, the present invention provides the use of the engineered bacteria in fermentation production of L-carnosine or preparation of products containing L-carnosine.

[0017] In a fourth aspect, the present invention provides a method for producing L-carnosine by fermentation, wherein the engineered bacteria are fermented in a culture medium, and L-carnosine is separated from the fermentation product.

[0018] In a fifth aspect, the present invention provides a method for increasing the production of L-carnosine in Escherichia coli by increasing the supply of PRPP. prs Gene expression to increase intracellular PRPP supply and promote L-histidine synthesis, thereby increasing L-carnosine production.

[0019] Furthermore, using Escherichia coli with the ability to produce L-histidine as the starting strain, overexpression prs , panD , pepD Gene and gene fragment as shown in SEQ ID NO:4 hisGDCBHAFI ; in, prs Genes and hisGDCBHAFI The gene fragment comes from Escherichia coli. panD The gene comes from Bacillus subtilis. pepD The gene is derived from Serratia marcescens.

[0020] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention provides a method for increasing the supply of PRPP in Escherichia coli by upregulating prs The expression of the gene increases the intracellular PRPP content and promotes the synthesis of L-histidine, thereby significantly increasing the production and yield of L-carnosine. Experiments have shown that the production of L-carnosine in different recombinant strains can be increased by 55.56%-140%, and there is no need to add L-histidine and β-alanine during the production process. DETAILED DESCRIPTION

[0021] In view of the above-mentioned problem that PRPP supply needs to be increased to promote the synthesis of L-histidine in cells and thus increase the production of L-carnosine, the present invention increases the production of L-carnosine by increasing the PRPP supply. prs Gene expression increases PRPP supply and promotes L-histidine synthesis, thereby significantly increasing L-carnosine production.

[0022] The present invention adopts the following technical solution: The present invention provides a method for increasing L-carnosine by increasing 5-phosphoribosylpyrophosphate (PRPP), the method comprising: (1) Upregulation of PRPP synthase encoding genes in Escherichia coli prs Expression; (2) The above strains were fermented and cultured to detect bacterial growth and L-carnosine production.

[0023] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0024] Example 1 Integration and expression in E. coli prs Gene In this example, the Ptrc promoter (sequence shown in SEQ ID NO: 1) was integrated and expressed at the lacZ site of the Escherichia coli genome. prs Gene. prs Gene, artificially synthesized under the control of Ptrc promoter prs The gene expression module Ptrc-prs, the sequence is shown in SEQ ID NO: 2. Using the genome of Escherichia coli MG1655 (ATCC 700926) as a template, the upstream homology arm lacZ-U was amplified with primers lacZ-UF (gctggttgccaacgatcagatgg, SEQ ID NO: 6) and lacZ-UR (gccggatgattaattgtcaaagcctggggtgcctaatgagt, SEQ ID NO: 7), and the downstream homology arm lacZ-D was amplified with primers lacZ-DF (ctgccatgttcgaacactaataataaccgggcaggccatgtc, SEQ ID NO: 8) and lacZ-DR (aaattcgaaattactgcgacggctg, SEQ ID NO: 9). Overlap extension PCR was performed on lacZ-U, Ptrc-prs and lacZ-D to obtain the target fragment lacZ-Donor. Plasmid pTargeF (purchased from Addgene, plasmid catalog number 62226) was used as a template and primers pTarget-lacZ-F (gcgctgggtcggttacggccgttttagagctagaaatagcaagttaaaataaggctag, SEQ ID NO: 10) and pTarget-lacZ-R (ggccgtaaccgacccagcgcactagtattatacctaggactgagctagctg, SEQ ID NO: 11) were used to amplify to obtain plasmid pTarget-lacZ. The targeting fragment lacZ-Donor, plasmid pTarget-lacZ and plasmid pCas (purchased from Addgene, plasmid catalog number 62225) were transformed into Escherichia coli MG1655 by electroporation, and the obtained recombinant bacteria were named STR01.

[0025] Using the genome of Escherichia coli MG1655 as a template, the primers hisG-F (atgacagacaacactcgtttacgcatag, SEQ ID NO: 12) and hisI-R (tcactgatgccgtttacgcagg, SEQ ID NO: 13) were used to amplify the gene fragment hisGDCBHAFI (sequence shown in SEQ ID NO: 4), and the hisGDCBHAFI fragment was connected to the pTrc99a plasmid (purchased from Addgene, plasmid catalog number 155179) backbone to obtain the recombinant plasmid pTrc99a-hisGDCBHAFI. Bacillus subtilis Source panD Genes and Serratia marcescens Source pepD Gene, artificially synthesized under the control of Ptrc promoter panD Genes and pepD Gene expression module Ptrc-panD-pepD, sequence as shown in SEQ ID NO: 3. The Ptrc-panD-pepD fragment was connected to the pCDFDuet-1 plasmid (purchased from Addgene, plasmid catalog number 172718) backbone to obtain the recombinant plasmid pCDF-panD-pepD. The recombinant plasmids pTrc99a-hisGDCBHAFI and pCDF-panD-pepD were transformed into MG1655 by electroporation to obtain the recombinant strain STR02, and the recombinant plasmids pTrc99a-hisGDCBHAFI and pCDF-panD-pepD were transformed into STR01 by electroporation to obtain the recombinant strain STR03.

[0026] Example 2 Overexpression using plasmid in E. coli prs Gene In this example, plasmid overexpression prs Gene. Using the genome of Escherichia coli MG1655 as a template, the gene fragment prs was amplified using primers prs-F (gtgcctgatatgaagctttttgctggt, SEQ ID NO: 14) and prs-R (ttagtgttcgaacatggcagagatcgatt, SEQ ID NO: 15), and the prs fragment was connected to the pBbA1k plasmid (purchased from Addgene, plasmid catalog number 35336) backbone to obtain the recombinant plasmid pBbA1k-prs. The recombinant plasmid pBbA1k-prs was transferred into STR02 by electroporation to obtain the recombinant strain STR04.

[0027] Example 3 Production of L-carnosine by fermentation of recombinant Escherichia coli The recombinant strains STR02, STR03, and STR04 were cultured overnight on LB plates, and single colonies were picked and inoculated into test tubes containing 5 mL of LB medium. The culture was incubated at 37°C, 200 rpm for 12 h, and then inoculated into 500 mL baffled shake flasks containing 50 mL of fermentation medium at a 5% inoculum. The culture was continued at 37°C, 200 rpm until OD 600 to 0.6, add 0.1 mM IPTG and continue culturing for 48 h.

[0028] The fermentation medium formula includes (1L): glucose 20g, magnesium sulfate heptahydrate 0.8g, diammonium phosphate 4g, potassium dihydrogen phosphate 6.67g, potassium citrate 1.35g, 3-morpholinepropanesulfonic acid 20.9g, yeast powder 2.5g, ferrous sulfate heptahydrate 50mg, calcium chloride dihydrate 10mg, zinc sulfate heptahydrate 11mg, manganese sulfate tetrahydrate 2.5mg, copper sulfate pentahydrate 5mg, ammonium molybdate 0.5mg and sodium borate decahydrate 0.1mg.

[0029] During the fermentation process, the product concentration was detected by high performance liquid chromatography, and the growth of the strain was detected by spectrophotometer. The results are shown in Tables 1 and 2. prs After the gene was added, the biomass accumulation of strains STR03 and STR04 was consistent with that of the control strain STR02, and the final yield increased by 1.22 and 1.40 times, respectively. prs The gene increased L-carnosine production without affecting bacterial growth.

[0030] Table 1 Growth of different strains (OD 600 )

[0031] Table 2 L-carnosine production of different strains (g / L)

[0032] Example 4 Using different species sources panD , pepD Production of L-Carnosine Corynebacterium glutamicum ( Corynebacterium g lutamicum ) Source CgpanD gene (GenBank No. 1021120) and Clostridium perfringens ( Clostridiumperfringens ) Source CppepD gene (NCBI accession number NZ_CATNWI010000015.1, 3045-4496 (-)), under the control of the artificial Ptrc promoter panD Genes and pepD The gene expression module Ptrc-CgpanD-CppepD has a sequence as shown in SEQ ID NO:5. The Ptrc-CgpanD-CppepD fragment was connected to the pCDFDuet-1 plasmid (purchased from Addgene, plasmid catalog number 172718) backbone to obtain the recombinant plasmid pCDF-CgpanD-CppepD. The recombinant plasmids pTrc99a-hisGDCBHAFI and pCDF-CgpanD-CppepD were transformed into MG1655 by electroporation to obtain the recombinant strain STR05, and the recombinant plasmids pTrc99a-hisGDCBHAFI and pCDF-CgpanD-CppepD were transformed into STR01 by electroporation to obtain the recombinant strain STR06. The recombinant plasmid pBbA1k-prs was transformed into STR05 by electroporation to obtain the recombinant strain STR07. The fermentation of recombinant strains STR05, STR06, and STR07 produced L-carnosine. The growth of the strains and the product concentrations are shown in Tables 3 and 4. Corynebacterium g lutamicum Source CgpanD Genes and Clostridium perfringens Source CppepD Gene synthesis of L-carnosine, in up-regulated prs After the addition of the gene, the biomass of strains STR06 and STR07 was the same as that of the control strain STR05, and the production of L-carnosine increased by 55.56% and 96.30%, respectively. panD , pepD When L-carnosine is produced, it is upregulated prs The effect of the gene is stable and can increase L-carnosine production without affecting bacterial growth.

[0033] Table 3 Growth of different strains (OD 600 )

[0034] Table 4 L-carnosine production of different strains (g / L)

[0035] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0036] References: 1、Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang,S. (2015) Multigene editing in the Escherichia coligenome via the CRISPR-Cas9system. Appl Environ Microbiol 81: 2506–2514. 2、Budiardjo SJ, Stevens JJ, Calkins AL, Ikujuni AP, Wimalasena VK,Firlar E, Case DA, Biteen JS, Kaelber JT, Slusky JSG. Colicin E1 opensitshinge to plug TolC. Elife. 2022 Feb 24;11. pii: 73297. doi: 10.7554 / eLife.73297. 3、Tong Y, Jorgensen TS, Whitford CM, Weber T, Lee SY. Aversatilegenetic engineering toolkit for E. coli based on CRISPR-primeediting. Nat Commun. 2021 Sep 1;12(1):5206. doi: 10.1038 / s41467-021-25541-3. 4、Lee TS, Krupa RA, Zhang F,hajimorad M,holtz WJ, Prasad N, Lee SK,Keasling JD. BglBrick vectors and datasheets: A synthetic biology platformforgene expression. J Biol Eng. 2011 Sep 20;5:12.

Claims

1. An engineered Escherichia coli bacterium that produces high levels of L-carnosine, characterized in that: The engineered bacteria are obtained by genetic engineering to enhance prs The expression of genes is constructed; Wherein, the Escherichia coli is an Escherichia coli having the ability to produce L-histidine, and the gene fragment expressed is as shown in SEQ ID NO:4 hisGDCBHAFI , and Bacillus subtilis ( Bacillus subtilis ) Source panD genes and Serratia marcescens ( Serratia marcescens ) Source pepD Gene; Escherichia coli ( Escherichia coli ) Source prs The reference sequence number of the gene in GenBank is 945772.

2. The engineered bacteria according to claim 1, characterized in that The method of enhancing gene expression is selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

3. The engineered bacteria according to claim 2, characterized in that The strong promoter includes the Ptrc promoter.

4. The engineered bacteria according to claim 3, characterized in that The engineered bacteria comprises Ptrc- prs Expression cassette and Ptrc- panD - pepD expression cassette, and hisGDCBHAFI Expression plasmids; Among them, Ptrc- prs It is driven by the Ptrc promoter prs Gene expression cassette, the sequence of which is shown in SEQ ID NO: 2; Ptrc- panD - pepD It is driven by the Ptrc promoter panD and pepD The tandem gene expression cassette has a sequence as shown in SEQ ID NO:

3.

5. The engineered bacteria according to any one of claims 1 to 4, characterized in that The starting strain was Escherichia coli MG1655.

6. The method for constructing the engineered bacteria according to any one of claims 1 to 5, characterized in that: By using genetic engineering to enhance the prs The expression of the gene was used to construct an Escherichia coli engineered bacterium with high L-carnosine production; Wherein, the Escherichia coli is an Escherichia coli having the ability to produce L-histidine, and the gene fragment expressed is as shown in SEQ ID NO:4 hisGDCBHAFI , and Bacillus subtilis panD Genes and Serratia marcescens pepD Gene; Said prs The gene is as described in claim 1; The method of enhancing gene expression is selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

7. Use of the engineered bacteria according to any one of claims 1 to 5 in fermentation production of L-carnosine or preparation of products containing L-carnosine.

8. A method for producing L-carnosine by fermentation, characterized in that: The engineered bacteria according to any one of claims 1 to 5 are fermented in a culture medium, and L-carnosine is separated from the fermentation product.

9. A method for increasing the production of L-carnosine in Escherichia coli by increasing the supply of PRPP, characterized in that: By enhancing the prs Gene expression to increase intracellular PRPP supply and promote L-histidine synthesis, thereby increasing L-carnosine production.

10. The method according to claim 9, characterized in that Using Escherichia coli with the ability to produce L-histidine as the starting strain, overexpression prs , panD , pepD Gene and gene fragment as shown in SEQ ID NO:4 hisGDCBHAFI ; in, prs Genes and hisGDCBHAFI The gene fragment comes from Escherichia coli. panD The gene comes from Bacillus subtilis. pepD The gene is derived from Serratia marcescens.

Images