Preparation method of novel target molecule TRE1-dsRNA capable of preventing and treating botrytis cinerea through RNAi

Abstract

The invention discloses a preparation method of a novel target molecule TRE1-dsRNA capable of preventing and treating plant botrytis cinerea through RNAi, and provides a dsRNA molecule targeting trehalase TRE1, the dsRNA molecule is used for preventing and treating plant botrytis cinerea, trehalase plays a key role in the growth and development and pathogenic process of botrytis cinerea, and the dsRNA molecule can be used for preventing and treating plant botrytis cinerea. Therefore, the dsRNA targeting the TRE1 gene is expected to become an efficient disease control means, an expression vector containing a TRE1 gene inverted repeat sequence is constructed in escherichia coli, efficient transcription and accumulation of TRE1-dsRNA molecules are achieved under induction of IPTG, the method not only simplifies the production process of the dsRNA, but also improves the yield and purity of the dsRNA, and the application prospect is broad. The possibility is provided for large-scale preparation of the RNAi biopesticide.

Description

Technical Field

[0001] The present invention relates to a method for preparing a novel target molecule TRE1-dsRNA, and more specifically, to a method for preparing a novel target molecule TRE1-dsRNA capable of preventing and controlling plant gray mold pathogens through RNAi, and belongs to the field of protection and treatment of crop gray mold pathogens. Background Art

[0002] In-depth analysis of gray mold and its prevention and control status and innovative application of RNAi technology: Gray mold, a widespread plant fungal disease caused by Botrytis cinerea, poses a serious threat to global agricultural production. The pathogen has a wide range of hosts and can infect a variety of crops such as beans, tomatoes, grapes, strawberries, eggplants, and onions. This pathogen can cause corruption of crops before and after harvest and deteriorate fruit quality, generally causing a 20% to 30% reduction in agricultural production, and more than 50% in severe cases. It not only affects the yield and quality of crops, but also causes a series of problems due to the long-term use of traditional prevention and control methods (mainly relying on chemical fungicides), including the enhancement of pathogen resistance and potential harm to the environment and human health. Therefore, it is particularly important to develop new, sustainable and eco-friendly disease control strategies.

[0003] Application prospects of RNAi technology in the prevention and control of gray mold: RNA interference (RNA silencing or RNA interference, RNAi) is a conservative regulatory mechanism mediated by endogenous or exogenous double-stranded RNA (double stranded RNA, dsRNA) in eukaryotes. It is a technology that can bind to the mRNA of the target gene based on the principle of base complementary pairing, and effectively silence or inhibit the expression of the target gene at the transcriptional level or post-transcriptional level. Applying RNAi technology to plant protection and designing dsRNA targeting key pathogenic genes of pathogens is expected to achieve precise strikes on pathogens and block their pathogenic processes. Compared with chemical pesticides, dsRNA has the characteristics of low toxicity and low residue. It is easily degraded in nature and will not cause long-term pollution to the soil, water and other environments. It is considered to be a safe, reliable and environmentally friendly new green pesticide. Therefore, the development of a large number of dsRNAs targeting different target genes of gray mold for the prevention and control of gray mold is an urgent task to be solved. Although it has been reported that spraying dsRNA solutions targeting BcDCL1 / 2, BcCYP51, BcCHS1, BcEF2, or BcPG1 of Botrytis cinerea on plant surfaces can achieve control effects on Botrytis cinerea, a large number of different target genes still need to be discovered for the development of dsRNAs with strong specificity and high control efficiency, which will provide a large number of available gene resources for the rapid development of efficient RNAi biopesticides to control Botrytis cinerea in the future and lay the foundation for delaying the generation of drug-resistant strains. Summary of the invention

[0004] In order to solve the above-mentioned problems of the prior art, the present invention provides a method for preparing a novel target molecule TRE1-dsRNA for controlling plant gray mold through RNAi, which has the technical characteristics of providing a new and environmentally friendly RNAi biopesticide strategy for controlling gray mold.

[0005] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0006] The present invention discloses a method for preparing a novel target molecule TRE1-dsRNA that can prevent and control plant gray mold fungi through RNAi, and the method comprises the following steps:

[0007] Step 1) Synthesis of DNA template encoding antibacterial RNA molecule: introducing an Xba I restriction site upstream of the DNA sequence encoding TRE1-dsRNA, and introducing a reverse complementary sequence of the T7 promoter and a Hind III restriction site 5'-CCTATAGTGAGTCGTATTAGAAGCTT-3' downstream, and chemically synthesizing this template DNA sequence encoding the antibacterial RNA molecule;

[0008] Step 2) constructing a prokaryotic expression vector for expressing RNA molecules: inserting the chemically synthesized template DNA molecule between the Xba I and Hind III restriction sites of the plasmid vector pET28a(+) to obtain a recombinant plasmid that can be induced to express in Escherichia coli to obtain TRE1-dsRNA molecules;

[0009] Step 3) Induced expression and separation and purification of TRE1-dsRNA molecules: The above-mentioned recombinant plasmid was transformed into Escherichia coli HT115, and the positive recombinant clone was picked and expanded at 37°C using LB liquid medium until the OD value reached 0.4, IPTG was added for induction for 4 hours, and the bacteria were collected by centrifugation, 1 / 10 volume of RNA extraction solution was added, and an equal volume of water-saturated phenol was added to lyse the bacteria and denature proteins. After centrifugation for 10 minutes, the supernatant was taken to a new tube, an equal volume of chloroform was added to mix, and then centrifuged for 10 minutes, and the supernatant was taken to obtain the TRE1-dsRNA molecule.

[0010] Preferably, the coding DNA sequence of the TRE1-dsRNA is as follows:

[0011] TCCTCTCGGAACCGCTACCTCGAACGGATTTAGAAGATACGACATTCGCGGGACTTATATGCTATCAA

[0012] ATCTTTTACAGGAGTTGACTTTAGCAAAGGAAAATGGCAGAGAACAAATTATCTTGGACGAATCTCGC

[0013] CTCAACGAGAATCCTGTCAATCGCCTCTCAAGATTGATTCAGGGCTCATTCTGGGATGGCCTGACTCG

[0014] TAGAATCGATGGCTCGGTGATTGAAATTGCTGGGCGTGATCCTAAGGATTGGACCGACGATCCCGTC

[0015] CACGTATCTACATACCACGGGGTGCACCTGAACAGCATGCATACTATACCAAAGTGGC.

[0016] Preferably, the Hind III restriction site is 5'-CCTATAGTGAGTCGTATTAGAAGCTT-3'.

[0017] Preferably, the control of Botrytis cinerea is achieved by silencing the expression of TRE1 by RNAi.

[0018] Preferably, a new target gene for controlling gray mold, trehalase TRE1 gene, is used for RNAi to control gray mold, so as to achieve control of gray mold by silencing the expression of TRE1 through RNAi.

[0019] Beneficial effects: The present invention not only simplifies the production process of dsRNA, but also improves its yield and purity, thus making it possible to prepare RNAi biopesticides on a large scale, and providing a new and environmentally friendly RNAi biopesticide strategy for the prevention and control of gray mold. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the blank control chart in Example 1.

[0021] Figure 2 This is a diagram showing the inhibitory effect of BcDCL1 / 2-dsRNA treatment on the germination of Botrytis cinerea spores in Example 1.

[0022] Figure 3 This is a diagram showing the inhibitory effect of BcTRE1-dsRNA treatment on the germination of Botrytis cinerea spores in Example 1.

[0023] Figure 4 It is the blank control chart in Example 2.

[0024] Figure 5 This is a diagram showing the inhibitory effect of BcDCL1 / 2-dsRNA on the mycelial growth of Botrytis cinerea in Example 2.

[0025] Figure 6 This is a diagram showing the inhibitory effect of BcTRE1-dsRNA on the mycelial growth of Botrytis cinerea in Example 2.

[0026] Figure 7 It is a statistical histogram of colony diameters of gray mold hyphae growth in Example 2.

[0027] Figure 8 This is a diagram showing the size of tobacco lesions in Example 3.

[0028] Fig. 9 It is the statistical histogram of the diameter of tobacco leaf spots in Example 3. DETAILED DESCRIPTION

[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Innovative application and preparation method of TRE1-dsRNA: In view of the problem that the types of dsRNA used for the prevention and treatment of gray mold in current RNAi technology are limited, the present invention proposes a dsRNA (TRE1-dsRNA) molecule targeting trehalase (Cytosolic neutral trehalase, TRE1) for the prevention and treatment of plant gray mold. Trehalase plays a key role in the growth and development and pathogenicity of Botrytis cinerea, so dsRNA targeting the TRE1 gene is expected to become an efficient disease prevention and control method. By constructing an expression vector containing the inverted repeat sequence of the TRE1 gene in Escherichia coli, and achieving efficient transcription and accumulation of TRE1-dsRNA molecules under IPTG induction. This method not only simplifies the production process of dsRNA, but also improves its yield and purity, making it possible to prepare RNAi biopesticides on a large scale.

[0031] like Figure 1-9 The present invention shows a specific embodiment of a method for preparing a novel target molecule TRE1-dsRNA that can control plant gray mold fungus through RNAi, the method comprising:

[0032] Step 1: Synthesis of DNA template encoding antibacterial RNA molecules

[0033] When synthesizing a DNA template encoding an antibacterial RNA (e.g., TRE1-dsRNA), the DNA sequence needs to be precisely designed to ensure that it can be transcribed into the desired RNA molecule. The key to this step is to introduce restriction sites and promoter sequences at specific locations in the DNA sequence.

[0034] Xba I restriction site: The introduction of Xba I restriction site upstream of the DNA sequence is to facilitate the subsequent insertion of this DNA into a specific position in the vector. Restriction site is a DNA sequence that can be recognized by a specific restriction endonuclease, which allows scientists to cut DNA at a precise location.

[0035] Reverse complementary sequence of T7 promoter: T7 promoter is a commonly used promoter of RNA polymerase, which can drive RNA synthesis in vitro or in vivo. The reverse complementary sequence of T7 promoter is introduced downstream of DNA sequence to ensure that RNA polymerase can accurately recognize and initiate RNA synthesis in the subsequent transcription process.

[0036] Hind III restriction site: Similar to the Xba I restriction site, the Hind III restriction site is also used to insert DNA into the vector. These two restriction sites are used together to ensure that the DNA fragment is inserted into the vector in the correct direction and position.

[0037] When chemically synthesizing this DNA template, it is necessary to ensure the accuracy of the sequence to avoid producing erroneous RNA or protein during subsequent transcription and translation.

[0038] Step 2: Construction of prokaryotic expression vector for RNA molecule expression

[0039] The purpose of constructing a prokaryotic expression vector is to insert a DNA template encoding an antibacterial RNA into a vector that can be expressed in prokaryotes (such as Escherichia coli).

[0040] Plasmid vector pET28a(+): a prokaryotic expression vector containing multiple elements, such as replication origin, selection marker, multiple cloning site, etc. These elements enable the plasmid to replicate stably in the host cell and facilitate scientists to screen and identify.

[0041] Enzyme digestion and ligation: The chemically synthesized DNA template is digested with Xba I and Hind III, and then ligated with the pET28a(+) vector that has also been digested with enzymes. The ligation reaction is usually carried out using DNA ligase, which can connect the ends of the two DNA fragments.

[0042] Further screening and identification can be performed: through the transformation, screening and identification steps, it can be ensured that the obtained recombinant plasmid is correct and can express the desired RNA molecule in the host cell.

[0043] Step 3: Induction expression and purification of TRE1-dsRNA molecules

[0044] After the recombinant plasmid is transformed into Escherichia coli HT115, induction expression and separation and purification steps are required to obtain the desired TRE1-dsRNA molecule.

[0045] Induced expression: Under appropriate growth conditions (temperature, pH value, nutrients are set according to actual needs), IPTG (isopropylthiogalactoside) is used as an inducer to stimulate E. coli to express TRE1-dsRNA molecules. IPTG can bind to the lactose operon on the vector, thereby relieving the inhibition of RNA polymerase and initiating RNA synthesis.

[0046] Isolation and purification: Collect the induced expression E. coli cells and use RNA extraction solution for cell lysis and RNA extraction. Through centrifugation and precipitation steps, cell debris, proteins and other impurities can be removed to obtain a relatively pure TRE1-dsRNA molecule.

[0047] In the above process, it is necessary to control the experimental conditions to ensure that the quality and quantity of RNA molecules meet the needs of subsequent experiments. In addition, strict quality control and verification steps are required to ensure that the obtained RNA molecules have the expected antibacterial activity.

[0048] Example 1: Inhibitory effect of TRE1-dsRNA on spore germination of Botrytis cinerea

[0049] Take 100uL of the diluted spore suspension in a 1.5mL EP tube, add dsRNA solution at the same time, the working concentration of dsRNA solution is 150ng / μL, culture at 25℃ for 12h, and use an optical electron microscope to determine the germination of gray mold spores. The experiment was divided into 3 groups: the blank control group added 100uL of conidia suspension, 100μL of dsRNA extract, and 300μLPDA liquid culture medium, and experimental group 1 replaced the dsRNA extract with an equal amount of comparative dsRNA (BcDCL1 / 2-dsRNA) solution. Experimental group 2 replaced the dsRNA extract with an equal amount of BcTRE1-dsRNA solution. After continuing to culture for 12h, observe the germination of conidia under a light microscope. The results are as follows Figure 1-3 As shown, most of the gray mold spores did not germinate after being treated with BcDCL1 / 2-dsRNA and BcTRE1-dsRNA solutions, while the spores in the control group without drug treatment had extremely high germination efficiency and grew well. These results show that the application of BcDCL1 / 2-dsRNA and BcTRE1-dsRNA has a significant inhibitory effect on the germination of gray mold spores.

[0050] In-depth analysis and expansion of the experiment on inhibition of spore germination of Botrytis cinerea:

[0051] This experiment aims to investigate the effect of specific double-stranded RNA (dsRNA) molecules on the germination of Botrytis cinerea spores in order to evaluate their potential as biopesticides. Botrytis cinerea is a widespread plant pathogen that causes serious diseases to a variety of crops. Although the use of traditional chemical pesticides is effective, it can easily lead to the development of drug resistance and environmental pollution. Therefore, it is particularly important to develop new and environmentally friendly disease prevention and control strategies. As an emerging gene regulation method, dsRNA technology shows broad application prospects in plant disease prevention and control.

[0052] The experiment used a control group and an experimental group design to compare the effects of different dsRNA solutions on the germination of Botrytis cinerea spores. During the experiment, the reliability and repeatability of the experimental results were ensured by precisely controlling the amount of spore suspension and dsRNA solution added, the culture temperature and time.

[0053] Experimental results and analysis: The experimental results showed that after being treated with BcDCL1 / 2-dsRNA and BcTRE1-dsRNA solutions, most of the Botrytis cinerea spores did not germinate, while the spores in the control group without drug treatment had extremely high germination efficiency and grew well. This result shows that the application of BcDCL1 / 2-dsRNA and BcTRE1-dsRNA has a significant inhibitory effect on the germination of Botrytis cinerea spores.

[0054] It can be seen that BcDCL1 / 2 and BcTRE1 are key pathogenic genes of Botrytis cinerea, and their expression may be affected by dsRNA, which may affect the growth and pathogenicity of Botrytis cinerea. This discovery provides strong evidence for the use of RNAi technology to prevent and control Botrytis cinerea.

[0055] Experimental significance and extension: This experiment not only verifies the effectiveness of dsRNA technology in the prevention and control of gray mold diseases, but also provides ideas for further screening and optimization of RNAi target genes. Technicians can also expand the experiment in the following aspects:

[0056] 1. Screen more target genes: Continue to screen other key pathogenic genes in Botrytis cinerea and design corresponding dsRNA molecules for verification to discover more effective RNAi targets.

[0057] 2. Optimize the dsRNA preparation process: improve the yield and purity of dsRNA and reduce production costs to meet the needs of practical applications.

[0058] 3. Study the mechanism of action of dsRNA: In-depth study of the regulatory mechanism of dsRNA on the gene expression of Botrytis cinerea to provide a theoretical basis for further optimization of RNAi technology.

[0059] 4. Field trial verification: The screened effective dsRNA molecules will be verified in field trials to evaluate their disease control effects and application potential in natural environments.

[0060] This experiment provides a new and environmentally friendly RNAi biopesticide strategy for the prevention and control of gray mold diseases, which has broad application prospects and far-reaching significance.

[0061] Example 2: Inhibitory effect of BcTRE1-dsRNA on hyphae growth of Botrytis cinerea

[0062] Use a pipette to take 10 μL of the above spore solution and inoculate it onto PDA solid culture medium and culture it at 25°C for four days. Take a 5 mm bacterial cake from the edge of the colony. The experiment was divided into 3 groups, each with 3 replicates. The blank control group was a PDA solid culture medium with the extract added, experimental group 1 was a PDA solid culture medium with a working concentration of 150 ng / μL bcDCL1 / 2-dsRNA solution added, and experimental group 2 was a PDA solid culture medium with a working concentration of 150 ng / μL bcTRE1-dsRNA solution added. Take the above bacterial cake with a diameter of 5 mm and inoculate it onto different groups of PDA solid culture media and culture it at 25°C for 4 days. The results are as follows Figure 4-6 As shown in the figure, the colony diameter of Botrytis cinerea treated with BcTRE1-dsRNA solution is significantly smaller than the colony diameter of Botrytis cinerea treated with BcDCL1 / 2-dsRNA solution and the colony diameter of Botrytis cinerea in the blank control group. The colony diameter of Botrytis cinerea was measured using a ruler. To make the experimental results more intuitive, we used a ruler to measure the colony diameter of Botrytis cinerea. The results are shown in the figure. Figure 7 As shown, the average diameter of the gray mold colony in the blank control group was 82.5 mm, the average diameter of the gray mold colony after the BcDCL1 / 2-dsRNA solution treatment was 45.7 mm, and the average diameter of the gray mold colony after the BcTRE1-dsRNA solution treatment was 22.5 mm. The experimental group 2 had a very significant difference compared with the blank control group, and the plaque diameter treated with BcTRE1-dsRNA was about half of the colony diameter after BcDCL1 / 2-dsRNA treatment. According to the above structure, compared with the comparative example, the growth inhibition efficiency of gray mold hyphae using the TRE1-dsRNA of the embodiment of the present invention is much higher than that of DCL1 / 2-dsRNA.

[0063] Detailed analysis and extended research of gray mold growth inhibition experiment:

[0064] Botrytis cinerea, as a widely distributed plant pathogenic fungus, poses a serious threat to global agricultural production. The long-term use of traditional chemical pesticides not only leads to the enhancement of pathogen resistance, but also may cause potential harm to the environment and human health. Therefore, it is particularly important to develop new, efficient and environmentally friendly disease prevention and control strategies. This experiment aims to explore the effect of specific double-stranded RNA (dsRNA) molecules on the mycelial growth of Botrytis cinerea, to evaluate its potential as a biopesticide, and to compare the inhibitory effects of dsRNA molecules with different target genes.

[0065] Experimental results and analysis: The experimental results showed that the colony diameter of Botrytis cinerea treated with BcTRE1-dsRNA solution was significantly smaller than the colony diameter of Botrytis cinerea treated with BcDCL1 / 2-dsRNA solution and the colony diameter of Botrytis cinerea in the blank control group. To make the experimental results more intuitive, the colony diameter of Botrytis cinerea was measured with a ruler.

[0066] Experimental significance and extension: This experiment not only verified the effectiveness of dsRNA technology in the prevention and control of gray mold diseases, but also compared the inhibitory effects of dsRNA molecules of different target genes. BcTRE1-dsRNA showed a higher inhibition efficiency, providing a new and more efficient target gene for the use of RNAi technology to prevent and control gray mold diseases.

[0067] Technicians can also expand the experiment by:

[0068] 1. Optimize the dsRNA preparation process: improve the yield and purity of dsRNA and reduce production costs to meet the needs of practical applications.

[0069] 2. In-depth study of the mechanism of action: Further explore the regulatory mechanism of dsRNA on the gene expression of Botrytis cinerea, and provide a theoretical basis for the further optimization of RNAi technology.

[0070] 3. Field trial verification: The screened high-efficiency dsRNA molecules will be verified in field trials to evaluate their disease control effects and application potential in natural environments.

[0071] 4. Develop compound formulations: Combine BcTRE1-dsRNA with other biological pesticides or chemical pesticides to develop compound formulations to improve disease control effects and reduce pesticide usage.

[0072] 5. Drug resistance monitoring: Establish an effective drug resistance monitoring mechanism, regularly evaluate the sensitivity of Botrytis cinerea to dsRNA, and provide a scientific basis for the long-term application of RNAi technology.

[0073] In summary, this experiment provides a new, efficient and environmentally friendly RNAi biopesticide strategy for the prevention and control of gray mold disease, which has broad application prospects and far-reaching significance. In the future, it is necessary to continue to study and improve related technologies to promote their widespread application in agricultural production.

[0074] Example 3: Effect of BcTRE1-dsRNA on infection of tobacco leaves by Botrytis cinerea spores

[0075] Select tobacco leaves with a growth cycle of 4 weeks and consistent growth for the experiment of infecting gray mold spores and spraying dsRNA solution. In order to facilitate subsequent photography, detached tobacco leaves were used. For the moisturizing of detached tobacco leaves, the roots of the tobacco leaves were wrapped with moist cotton. During the culture, the detached tobacco leaves were moisturized with sterile water. Then, the spore suspension with a concentration of 5×106 / mL was added dropwise to the detached tobacco leaves, cultured in a 24°C light incubator for three days, and then sprayed with a working concentration of 200ng / μL dsRNA solution. After 1 day, take a photo to record the size of the gray mold spots on the tobacco leaves.

[0076] The experiment was divided into 3 groups, each with 3 replicates. The blank control group was sprayed with 100uL of extract, the experimental group 1 was sprayed with an equal amount of 200ng / μL BcDCL1 / 2-dsRNA solution, and the experimental group 2 was sprayed with an equal amount of 200ng / μL BcTRE1-dsRNA solution. Figure 8 The lesion size on tobacco leaves in the blank control group was significantly larger than that in the experimental group sprayed with dsRNA solution, and the lesion size on tobacco leaves sprayed with BcDCL1 / 2-dsRNA solution was also significantly larger than that sprayed with BcTRE1-dsRNA solution. The diameter of the lesions was measured, and the results were as follows: Fig. 9 As shown, the average diameter of the lesions in the blank control 1 was 32.06 mm, the average diameter of the lesions sprayed with the BcDCL1 / 2-dsRNA solution was 7.78 mm, the average diameter of the lesions sprayed with the BcTRE1-dsRNA solution was 2.78 mm, and the diameter of the lesions in the experimental group 2 was about 0.36 of the diameter of the lesions in the experimental group 1. The above results show that compared with DCL1 / 2-dsRNA, the use of the TRE1-dsRNA molecules of the embodiments of the present invention has a stronger control effect on gray mold fungi on living leaves.

[0077] In-depth analysis and extended research on the effect of BcTRE1-dsRNA on the infection of tobacco leaves by Botrytis cinerea spores:

[0078] Background and purpose: Botrytis cinerea, as an important plant pathogen, has caused serious damage to global agricultural production. The long-term use of traditional chemical pesticides has not only led to the enhancement of pathogen resistance, but also may cause potential harm to the environment and human health. Therefore, it is particularly important to develop new, efficient and environmentally friendly disease control strategies. This study aims to explore the effect of a specific double-stranded RNA (dsRNA) molecule BcTRE1-dsRNA on the infection of tobacco leaves by Botrytis cinerea spores, and compare its control effect with that of another target gene dsRNA molecule BcDCL1 / 2-dsRNA, in order to provide new strategies for the biological control of Botrytis cinerea diseases.

[0079] Experimental results and analysis: The experimental results show that the size of the lesions on tobacco leaves in the blank control group is significantly larger than that in the experimental group sprayed with dsRNA solution. This indicates that the dsRNA solution has a certain inhibitory effect on the growth of gray mold. Further comparison found that the size of the lesions sprayed with BcDCL1 / 2-dsRNA solution was also significantly larger than the lesions sprayed with BcTRE1-dsRNA solution. After measuring the diameter of the lesions, the average diameter of the lesions in the blank control group was 32.06 mm, the average diameter of the lesions sprayed with BcDCL1 / 2-dsRNA solution was 7.78 mm, and the average diameter of the lesions sprayed with BcTRE1-dsRNA solution was 2.78 mm. The diameter of the lesions in experimental group 2 (sprayed with BcTRE1-dsRNA solution) was approximately 0.36 times the diameter of the lesions in experimental group 1 (sprayed with BcDCL1 / 2-dsRNA solution). This result indicates that BcTRE1-dsRNA has a stronger control effect on Botrytis cinerea on living leaves than BcDCL1 / 2-dsRNA.

[0080] Experimental significance and extension: This study not only verified the effectiveness of dsRNA technology in the prevention and control of gray mold diseases, but also compared the control effects of dsRNA molecules with different target genes. BcTRE1-dsRNA showed higher control efficiency, providing a new and more efficient target gene for the use of RNAi technology to control gray mold diseases.

[0081] Technical personnel can also expand from the following aspects:

[0082] 1. Optimize the dsRNA preparation process: improve the yield and purity of dsRNA and reduce production costs to meet the needs of practical applications.

[0083] 2. In-depth study of the mechanism of action: Further explore the regulatory mechanism of dsRNA on the gene expression of Botrytis cinerea to provide a theoretical basis for the further optimization of RNAi technology. At the same time, study the transport and stability of dsRNA in plants, as well as its interaction with the plant immune system.

[0084] 3. Field test verification: The screened high-efficiency dsRNA molecules will be verified in field tests to evaluate their disease control effects and application potential in natural environments. At the same time, the duration and stability of dsRNA in the field, as well as its impact on crop growth and yield, will be studied.

[0085] 4. Develop compound formulations: Combine BcTRE1-dsRNA with other biological pesticides or chemical pesticides to develop compound formulations to improve disease control and reduce pesticide usage. At the same time, study the formulation and preparation process of the compound formulation, as well as its safety to the environment and human body.

[0086] 5. Resistance monitoring: Establish an effective resistance monitoring mechanism, regularly evaluate the sensitivity of Botrytis cinerea to dsRNA, and provide a scientific basis for the long-term application of RNAi technology. At the same time, study the mechanism and cause of Botrytis cinerea resistance to dsRNA to provide guidance for the development of new dsRNA targets and prevention and control strategies.

[0087] In summary, this study provides a new, efficient and environmentally friendly RNAi biopesticide strategy for the prevention and control of gray mold diseases, which has broad application prospects and far-reaching significance. In the future, it is necessary to continue to study and improve related technologies to promote their widespread application in agricultural production.

[0088] Finally, it should be noted that the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A method for preparing a novel target molecule TRE1-dsRNA that can control plant gray mold fungus through RNAi, characterized in that The method comprises the following steps: Step 1) Synthesis of DNA template encoding antibacterial RNA molecule: introducing an XbaI restriction site upstream of the DNA sequence encoding TRE1-dsRNA, and introducing a reverse complementary sequence of the T7 promoter and a HindIII restriction site 5'-CCTATAGTGAGTCGTATTAGAAGCTT-3' downstream, and chemically synthesizing this template DNA sequence encoding the antibacterial RNA molecule; Step 2) constructing a prokaryotic expression vector for expressing RNA molecules: inserting the chemically synthesized template DNA molecule between the Xba I and Hind III restriction sites of the plasmid vector pET28a(+) to obtain a recombinant plasmid that can be induced to express in Escherichia coli to obtain TRE1-dsRNA molecules; Step 3) Induced expression and separation and purification of TRE1-dsRNA molecules: The above-mentioned recombinant plasmid was transformed into Escherichia coli HT115, and the positive recombinant clone was picked and expanded at 37°C using LB liquid medium until the OD value reached 0.4, IPTG was added for induction for 4 hours, and the bacteria were collected by centrifugation, 1 / 10 volume of RNA extraction solution was added, and an equal volume of water-saturated phenol was added to lyse the bacteria and denature proteins. After centrifugation for 10 minutes, the supernatant was taken to a new tube, an equal volume of chloroform was added to mix, and then centrifuged for 10 minutes, and the supernatant was taken to obtain the TRE1-dsRNA molecule.

2. The method for preparing a novel target molecule TRE1-dsRNA for controlling plant gray mold via RNAi according to claim 1, characterized in that: The coding DNA sequence of the TRE1-dsRNA is as follows: TCCTCTCGGAACCGCTACCTCGAACGGATTTAGAAGATACGACATTCGCGGGACTTATATGCTATCAAATCTTTTACAGGAGTTGACTTTAGCAAAGGAAAATGGCAGAGAACAAATTATCTTGGACGAATCTCGCCTCAACGAGAATCCTGTCAATCGCCTCTC AAGATTGATTCAGGGCTCATTCTGGGATGGCCTGACTCGTAGAATCGATGGCTCGGTGATTGAAATTGCTGGGCGTGATCCTAAGGATTGGACCGACGATCCCCGTCCACGTATCTACATACCACGGGGTGCACCTGAACAGCATGCATACTATACCAAAGTGGC.

3. The method for preparing a novel target molecule TRE1-dsRNA for controlling plant gray mold via RNAi according to claim 1 or 2, characterized in that: The Hind III restriction site is 5'-CCTATAGTGAGTCGTATTAGAAGCTT-3'.

4. The method for preparing a novel target molecule TRE1-dsRNA for controlling plant gray mold via RNAi according to claim 1, characterized in that: The invention comprises arbitrarily achieving the control of gray mold by silencing the expression of TRE1 through RNAi.

5. The method for preparing a novel target molecule TRE1-dsRNA for controlling plant gray mold via RNAi according to claim 1, characterized in that: A new target gene for controlling gray mold, the trehalase TRE1 gene, was used to control gray mold by RNAi, so as to achieve control of gray mold by silencing the expression of TRE1.

Images