Application of tomato lncRNA-PEL8 in increasing 2-phenethyl alcohol content of fruits

Abstract

The invention relates to the field of medicinal chemistry, and in particular relates to a 4-(1-(azacyl-3-butyl)-1H-imidazole-2-yl) aniline PKM2 agonist. Compared with an original drug, the novel PKM2 agonist for treating aortic dissection provided by the invention has the advantages that the agonistic activity of each concentration of the compound is obviously superior to that of the original drug, and AC50 is equivalent to that of a positive drug, so that the novel PKM2 agonist has a wide application prospect.

Description

Technical Field

[0001] The present application relates to the fields of genetic engineering, molecular biology and physiology, and more specifically, to the application of lncRNA-PEL8 in increasing the 2-phenylethanol content in tomato fruits. Background Art

[0002] 2-Phenylethanol is an important volatile flavor compound that gives tomatoes their unique sweet aroma. Its content decreases significantly during the domestication process, making it an important factor affecting the flavor of modern tomatoes.

[0003] Tomato is the most valuable vegetable / fruit in the world. It is the main model system for studying fleshy fruit ripening and fruit flavor, involving many metabolic processes. In addition, with the deepening of research on tomato flavor quality, it was found that the domestication process significantly affected the flavor characteristics of tomatoes. In the process of domesticating tomatoes from wild species to modern cultivated varieties, although the yield and fruit size were increased, the diversity and concentration of flavor substances decreased significantly. With the completion of tomato genome sequencing and fine assembly, the study of important traits such as tomato yield and quality through biotechnology and genetic engineering is of great significance to the study of fruit traits.

[0004] Long non-coding RNA (lncRNA) is a non-coding RNA with a length greater than 200 nucleotides. lncRNAs are considered to be important regulators of protein-coding gene expression, translation, and function. These genes are involved in regulating biological processes such as signal transduction, organ / tissue differentiation and development, and responses to biotic and abiotic stresses. Studies have shown that lncRNAs can participate in the regulation of plant secondary metabolites by interacting with transcription factors, target genes, or small RNA molecules. However, the specific mechanism of action of lncRNA in regulating the 2-phenylethanol metabolic pathway has not yet been clarified. It is of great significance to study the potential role of lncRNA in the regulation of 2-phenylethanol metabolism and the molecular mechanism of changes in 2-phenylethanol content during domestication, which provides a new research direction for improving tomato flavor. The lncRNA MdLNC610 in apple promotes the release of ethylene and the accumulation of anthocyanins in apple by regulating the ethylene biosynthesis gene MdACO1, enhancing the promoter activity of MdACO1 and increasing its expression level. In addition, the whole genome lncRNA identification of melon found that lncRNAs (LNC_000987, LNC_000693, LNC_001323, LNC_003610 and LNC_003380) may play an important role in regulating respiratory changes and fruit ripening. However, the specific mechanism of lncRNA in regulating the 2-phenylethanol metabolic pathway has not yet been clarified. It is of great significance to study the potential role of lncRNA in the regulation of 2-phenylethanol metabolism and the molecular mechanism of changes in 2-phenylethanol content during domestication, which provides a new research direction for improving tomato flavor. Summary of the invention

[0005] In view of the shortcomings of the existing problems, the purpose of the present invention is to provide the application of tomato lncRNA-PEL8 in increasing the content of 2-phenylethanol in fruits. The present invention identifies 450 lncRNAs related to the content of metabolites in tomato fruits through genome-wide association analysis (GWAS). Based on the co-localization method commonly used in population genetics theory, the present invention can more effectively identify genetic regulatory sites related to fruit flavor by combining mGWAs with lncRNA-eQTL, thereby identifying the main regulatory element lncRNA-PEL8 of 2-phenylethanol. The study of the domestication history of long non-coding RNA lncRNA-PEL8 not only helps to study more efficient genetic regulation of 2-phenylethanol accumulation, but also can further understand the evolutionary laws and regulatory mechanisms of plant aromatic anabolism. Overexpression of lncRNA-PEL8 to obtain tomato fruits with high 2-phenylethanol provides a theoretical basis for the synthesis of tomato 2-phenylethanol and molecular-assisted breeding, which is of great significance for the study of high-quality tomato breeding and the improvement of tomato cultivation environment.

[0006] The technical solution adopted by the present invention to solve the technical problem is:

[0007] In a first aspect, the present invention protects the use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in increasing the 2-phenylethanol content of tomato fruit.

[0008] The coding sequence of lncRNA-PEL8 is shown in SEQ ID NO: 1.

[0009] In a second aspect, the present invention protects the use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in the preparation of a product that increases the 2-phenylethanol content in tomato fruit.

[0010] Thirdly, the application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in cultivating tomato fruits with high 2-phenylethanol content.

[0011] In a fourth aspect, the present invention protects the use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in tomato breeding for increasing the 2-phenylethanol content of the fruit.

[0012] In a fifth aspect, the present invention protects the use of recombinant bacteria containing lncRNA-PEL8 in increasing the 2-phenylethanol content in tomato fruit.

[0013] In a sixth aspect, the present invention protects the use of a recombinant bacterium containing lncRNA-PEL8 in the preparation of a product for increasing the 2-phenylethanol content in tomato fruit.

[0014] In a seventh aspect, the present invention protects the use of recombinant bacteria containing lncRNA-PEL8 in cultivating tomato fruits with high 2-phenylethanol content.

[0015] In an eighth aspect, the present invention also protects the use of recombinant bacteria containing lncRNA-PEL8 in tomato breeding for increasing the 2-phenylethanol content in fruits.

[0016] In a ninth aspect, the present invention provides a method for increasing the 2-phenylethanol content in tomato fruit, wherein the method is achieved by increasing the expression level of lncRNA-PEL8 in the target plant.

[0017] In a specific embodiment, the method is achieved by introducing a recombinant vector containing lncRNA-PEL8 into the target plant.

[0018] Beneficial Effects

[0019] The application of tomato lncRNA-PEL8 provided by the present invention in increasing the 2-phenylethanol content of fruit has the following beneficial effects compared with the prior art:

[0020] (1) The present invention reveals that the content of flavor metabolites in natural tomato populations is rich in variation, providing a material basis for tomato flavor quality breeding.

[0021] (2) The present invention uses GWAS association analysis and lncRNA differential expression analysis to quickly and effectively identify lncRNAs related to tomato fruit metabolites, including lncRNA-PEL8 related to 2-phenylethanol content.

[0022] (3) Based on the analysis of lncRNA-PEL8 expression in natural populations, combined with molecular biology techniques, new pathways related to the regulation of 2-phenylethanol content can be effectively identified. Based on the expression of lncRNA-PEL8 in natural populations, germplasm resources with different 2-phenylethanol content can be efficiently screened to assist in tomato quality breeding.

[0023] (4) The identification of lncRNA-PEL8 enriched and improved the existing 2-phenylethanol synthesis and regulatory network, revealing the molecular mechanism of changes in 2-phenylethanol content in tomatoes during evolution. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Identification of different types of lncRNAs in 404 tomato fruit epidermis.

[0025] Figure 2 Figure 1 shows the domestication analysis of lncRNAs. (a) PCA principal component analysis; (b) expression analysis of differentially expressed lncRNAs during the domestication and improvement process; (c) the number of potential lncRNAs selected during the domestication and improvement process.

[0026] Figure 3 are the eQTLs associated with lncRNAs. (a) The genomic distribution of lncRNA eQTLs in the genome; (b) The number of lncRNA eQTLs for each lncRNA.

[0027] Figure 4 The invention relates to lncRNAs associated with metabolites. Among them, (a) identification method of lncRNAs associated with metabolites; (b) ratio of lncRNAs co-localized with metabolites; (c) screening of lncRNAs associated with differential expression co-localized with metabolites.

[0028] Figure 5The lncRNA population expression diagram shows that (a) LncRNA-PEL8 and 2-phenylethanol are co-localized at chr08:60Mb; (b) LncRNA-PEL8 is differentially expressed during breeding; (c) lncRNA-PEL8 expression during tomato fruit ripening.

[0029] Figure 6 Overexpression of LncRNA-PEL8 increases the content of 2-phenylethanol. (a) Relative expression level of LncRNA-PEL8 in wild-type and overexpressed plants; (b) Content of 2-phenylethanol in wild-type and overexpressed plants. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below with reference to the examples. The reagents or instruments used without indicating the manufacturer are regarded as conventional products that can be purchased on the market.

[0031] Example 1: Discovery of the association between tomato lncRNA-PEL8 and 2-phenylethanol content

[0032] 1. lncRNA identification Classification Analysis of differential expression:

[0033] The RNA sequencing data of 404 tomato fruit epidermis samples with the number PRJNA396272 were downloaded from the NCBI database. The RNA-seq data was generated by 150-bp double-end sequencing on the Illumina platform. The downloaded data was quality controlled and trimmed by the FASTX toolkit, and then the RNA-seq data was aligned to the tomato Heinz1706 v3.0 reference genome using the hisat2 alignment software and the unique aligned reads were identified. The SAM files generated by the alignment were sorted and converted into BAM files using the Samtools software. Then, the stringtie software was used to assemble transcripts based on the bam files generated in the previous step. After assembling the transcripts of the 404 germplasms, the final transcript database was obtained through the merging function of stringtie, and then the expression levels of all transcripts were quantified. After identifying the whole genome transcripts of the 404 tomato germplasms, the transcripts with coding possibilities and shorter lengths were filtered based on the general process of lncRNA. The filtering criteria are as follows:

[0034] (1) Transcripts with a length of less than 200 bp were filtered out.

[0035] (2) ORF-finder predicted open reading frames with lengths greater than 100 amino acids were filtered out.

[0036] (3) Transcripts with a transcript alignment P-value < 0.01 were filtered out by comparing with the Pfam and Swiss-Prot databases.

[0037] (4) CPC calculated the coding probability of the transcripts, and transcripts with probability greater than 0.5 were filtered out.

[0038] (5) Based on the splicing site and splicing alignment of the genome, reads with strand information are encoded as XS tags, and then the strand information of lncRNA is predicted by stringtie software. For single exon transcripts lacking strand information, transcripts on both strands are considered to have no protein coding potential.

[0039] Among all lncRNAs, 10,089 lncRNAs were mainly located in intergenic regions and identified as lincRNAs, 1,372 lncRNAs overlapped with protein-coding transcripts on the same strand, 3,283 antisense lncRNAs overlapped with protein transcripts on the antisense strand, and 125 were located in the intronic regions of protein-coding genes ( Figure 1 ).

[0040] To identify how the expression trend of lncRNA changes during tomato breeding, we analyzed the expression variation and nucleotide polymorphism in the gooseberry, cherry and large-fruit tomato subpopulations. First, the overall expression difference between subpopulations was evaluated by PCA analysis. Gooseberry, cherry and large-fruit tomato could be clearly divided into three groups based on the expression level of lncRNA, indicating that lncRNA had significant expression differences between subpopulations and the expression level changed significantly during tomato breeding ( Figure 2 a).

[0041] In order to further identify the differences in lncRNA expression during domestication and improvement, ballgown software was used to detect differentially expressed lncRNAs between gooseberry, cherry and large-fruited tomato. lncRNAs with p values ​​less than 0.01 and differential folds greater than or equal to 1.5 between the two groups were identified as differentially expressed lncRNAs. A total of 265, 77 and 384 lncRNAs were differentially expressed during domestication, improvement and selection, respectively ( Figure 2 b,c).

[0042] 2.GWAS analysis:

[0043] A genome-wide association analysis was performed using fruit metabolism data from 404 tomato core germplasm resources combined with lncRNA expression profiles. FaST-mixed linear model software was used to perform genome-wide association analysis of expressed lncRNAs and metabolites and a Bonferroni-corrected (p-value < 4.15e-08) threshold was used to screen eQTLs. Based on the mixed linear model, GWAs were performed on 2,115 high-confidence lncRNAs, of which 695 lncRNAs identified 1,383 loci, with an average of 1.99 eQTLs per lncRNA, of which 387 lncRNAs (55.60%) had only one eQTL ( Figure 3 ).

[0044] Colocalization is a commonly used method in population genetics theory. This study used colocalization to identify important candidate genes related to metabolites and lncRNA expression. Through colocalization analysis, 638 eQTLs of 450 lncRNAs were identified to have a common linkage disequilibrium block with 578 mQTLs of metabolites. The linkage disequilibrium between eQTL and mQTL was 2 >=0.28 and the physical distance is less than 1Mb. Among them, 145 lncRNAs related to metabolites were differentially expressed in breeding ( Figure 4 ), including the important flavor-related metabolite benzene glycol lncRNA-PEL8, which is also located in the linkage block where eQTL and mQTL are co-localized ( Figure 5 a).

[0045] Example 2: Application of tomato lncRNA-PEL8 in increasing the content of 2-phenylethanol in fruits

[0046] (1) LncRNA-PEL8 expression analysis

[0047] First, by analyzing RNA-seq data, we found that the expression level of lncRNA-PEL8 was significantly different in three subgroups: currant, cherry and large-fruited tomato ( Figure 5 b). Furthermore, total RNA was extracted from the fruit of the modern tomato variety 'MoneyMaker' (MM) at the ripening stage, and after reverse transcription into cDNA, the relative expression level of LncRNA-PEL8 at each stage was determined using the CAC gene as an internal reference. It was found that the expression level of lncRNA-PEL8 increased rapidly after the fruit broke color ( Figure 5 c). The qPCR reaction system is as follows:

[0048]

[0049]

[0050] (2) Overexpression vector construction

[0051] Using cDNA as a template and specific primers F1 and R1 as primers, lncRNA-PEL8 was amplified, and the amplified fragment was connected to the overexpression vector pCM2300; the nucleotide sequences of the primers F1 and R1 are shown in SEQ ID NOs: 2 and 3;

[0052] The overexpression vector was introduced into AGL1 Agrobacterium competent cells, PP (S. pimpinellifolium) was used as the receptor material for genetic transformation, 35S::lncRNA-PEL8 was transformed into tomato by Agrobacterium tumefaciens-mediated transformation, and positive transgenic plants were identified by qPCR screening ( Figure 6 a);

[0053] SEQ ID NO2: aagctccaatgttgtactgca;

[0054] SEQ ID NO3: tactctattcattatgactgtgt.

[0055] (3) Determination of 2-phenylethanol content in tomato fruit

[0056] Wild-type and lncRNA-PEL8 overexpressing tomato fruits (500 mg) were collected and transferred to TFE-silica gel septum bottles (Thermo Fisher Scientific, Waltham, MA, USA) containing 1 mL of stop buffer (containing 4.6 M CaCl2 and 100 mM EDTA) and 20 ng of internal standards 2-heptanone and heptane (Merck, Darmstadt, Germany). Each sample bottle was incubated at 80°C for 10 min and absorbed at 80°C for 10 min. Compounds were identified and quantified using a Thermo Exactive GC Orbitrap mass spectrometer coupled to a Tace1310 GC (Thermo Fisher Scientific) equipped with a 30 m × 0.25 mm × 1.0 μm DB-5 capillary column. The gas chromatography program was as follows: the temperature was initially set to 40°C and held for 5 min, then increased to 300°C at a rate of 5°C / min and finally held for 5 min. Metabolites were identified using our in-house database and the NIST 2020 mass spectrometry database and quantified using internal standards. The content of phenyl 2-ethanol was then calculated based on a calibration curve prepared using standard compounds. The results showed that the content of 2-phenylethanol in lncRNA-PEL8 overexpressing plants was significantly higher than that in wild-type plants ( Figure 6 b).

[0057] SEQ ID NO: 1

[0058] GGTGAACTCTTGCTCTAAATTTAAGAATAGACGCAAACAAAATTATTAAAGACATAACGA

[0059] ATAAATATATATTTACCATGTTAATGAGGGGGAAAATGATCAATAAATTGATTTTACATAAA

[0060] TTTATAGGAATTATAAGATGATGAAATACAAAGGTGAAGTGAACTTATATTTTTTGTTCAC

[0061] TTATACAAGAGATCATCACCAAAAAATCTATTAAAAGACAAAAATAATTATAACCCAAAA

[0062] AAATTATAAATAAAATATAATCAGTAAATAAGGTGCAAATATATGCACACACAAAAGAA

[0063] GGATCATTTGAGCAAGATAACTAACAAATATTAGTAAAAAAAATACACAAATAATGATAT

[0064] CACCGACTTTGAAAGAAGTTTCATTATATAAATTGAAAAACTATTAAAAATATTTATACAT

[0065] AAATATTGTTTTCGGCTATTCTTTATACTAAAATAAAGACATTATCGAAATTGAAAGAAGG

[0066] GTCTTTATATGTTTTGTCTCCAACATTTCCACGATGAATCAATATAACTCTTAAAATCAAA

[0067] ACTCAATAATAGATTATTTGACTATGTGATTGAATAATATGAATTTTTTTTCAAATTTATAG

[0068] AATCCTTTAAAGAATATGAAAAGGTCATGATTTCATGGAAGATGAATGGAATTAAACATT

[0069] TTAATTAAAAG

[0070] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. Application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in increasing the 2-phenylethanol content in tomato fruit.

2. Application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in the preparation of products for increasing the 2-phenylethanol content in tomato fruits.

3. Application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in cultivating tomato fruits with high 2-phenylethanol content.

4. Application of tomato lncRNA-PEL8 or recombinant vector containing lncRNA-PEL8 in tomato breeding to increase the 2-phenylethanol content of the fruit.

5. Application of recombinant bacteria containing lncRNA-PEL8 in increasing the 2-phenylethanol content in tomato fruits.

6. Application of recombinant bacteria containing lncRNA-PEL8 in the preparation of products for increasing the 2-phenylethanol content in tomato fruits.

7. Application of recombinant bacteria containing lncRNA-PEL8 in cultivating tomato fruits with high 2-phenylethanol content.

8. Application of recombinant bacteria containing lncRNA-PEL8 in tomato breeding to increase the 2-phenylethanol content in the fruit.

9. A method for increasing the 2-phenylethanol content in tomato fruit, the method being achieved by increasing the expression level of lncRNA-PEL8 in the target plant.

10. The method according to claim 9, characterized in that The method is achieved by introducing a recombinant vector containing lncRNA-PEL8 into a target plant.

Images