Recombinant DNA (Deoxyribose Nucleic Acid) construct for reducing corn plant height and application

Abstract

The invention discloses a recombinant DNA (deoxyribonucleic acid) construct for reducing corn plant height and application, a recombinant DNA molecule, the construct or a vector inhibits expression of a targeted Br2 gene through non-coding RNA (ribonucleic acid) mediated gene regulation, and a corn transformant with obviously reduced plant height is obtained. The internode length is shortened, and the internode number or the number and size of other organs (including but not limited to leaves, ears and tassels) are not correspondingly reduced, so that the method has important practical application significance in corn dwarfing breeding. Compared with recessive mutation breeding needing homozygous recessive mutation in male and female parents, the heterozygote of the transgenic dwarf plant can effectively reduce the plant height, the character is stable, and great convenience is achieved in breeding.

Description

(I) Technical field

[0001] The invention belongs to the fields of biotechnology and crop genetic breeding, and particularly relates to a recombinant DNA construct for reducing corn plant height and its application. (II) Background technology

[0002] From the 1930s to the recent period, the increase in corn yields has been mainly attributed to the use of fertilizers and pesticides and genetic improvement, but this effect is decreasing year by year, and the increase in planting density has become the most promising means of increasing production, while plant height is a key factor restricting dense-tolerant breeding. Plants that are too tall are prone to lodging and breaking, resulting in reduced yields. In contrast, reducing plant height is more conducive to enhancing the plant's resistance to lodging. Moderately reducing plant height can not only increase planting density and corn harvest index, but also accelerate the mechanization process of my country's corn production system. Therefore, semi-dwarf genetic improvement while maintaining yield is one of the important directions of current corn breeding.

[0003] To date, more than 70 maize dwarf mutants have been reported, most of which are caused by plant hormone-related gene mutations. Most of these reported maize dwarf mutants have not yet been applied to commercial production because their phenotypes are too extreme and have a significant negative impact on maize biomass and grain yield. Therefore, an important but difficult goal in maize breeding is to identify and use dwarfing or semi-dwarfing mutations that confer short stature without seriously affecting other organs, especially reproductive organs (e.g., ears).

[0004] In maize, dwarf mutants show short stature due to the shortened internode length without a corresponding reduction in the number and size of internodes or other organs (including leaves, ears and tassels). In 1935, Emerson discovered the first maize dwarf gene Brachytic2 (Br2), and the discovery of Br2 laid the foundation for the breeding of dwarf and semi-dwarf maize. The Br2 gene encodes an ATP-binding cassette transporter involved in the transport of IAA in the maize stalk. Mutations in this gene lead to abnormal polar transport of auxin in the internode meristem region. Compared with the wild type, the br2 mutant has a 40%-50% reduction in stalk cell length, a significant increase in stalk circumference, and more than 10 layers of thin-walled cells formed under the stalk epidermis, which not only reduces the plant height, but also greatly enhances the strength of the stalk, while other plant organs do not decrease significantly. From an agronomic perspective, the phenotype of br2 has great potential for high yields: it has a sparse plant shape with dense plants at the top and a well-developed root system, and shows strong tolerance to wind lodging and water and fertilizer. The Br2 gene has great application potential and has attracted much attention since its discovery. Most research directions have focused on identifying alleles and moderately reducing plant height. Using limited dwarf germplasm resources to improve plant height through traditional breeding methods will hinder the development of more excellent corn varieties.

[0005] Non-coding RNA (ncRNA) is a type of RNA molecule that does not have protein coding ability but has multiple biological functions. It is widely present in plants, animals, fungi and bacteria. There have been many studies on the regulation of plant gene expression mediated by ncRNA. Several cellular pathways involved in ncRNA-mediated gene repression have been described, each of which differs in characteristic pathways and composition. miRNA is a type of endogenous non-coding single-stranded small RNA molecule that regulates the post-transcriptional expression level of the target gene by base pairing with the target gene and causing the degradation of the target gene or inhibiting its translation under the action of related enzymes. RNAi is a phenomenon of homologous mRNA degradation mediated by double-stranded RNA (dsRNA) that is widely present in eukaryotic organisms and has the characteristics of high specificity and high efficiency. dsRNA needs to rely on vectors and other media to enter cells through transfection / infection, and is processed by a series of enzymes in the cytoplasm to form mature siRNA, which then binds to RISC (RNA-induced silencing complexes) and finally pairs with the target mRNA, resulting in the degradation of the target mRNA. In modern molecular breeding, ncRNA can be used to efficiently regulate important agronomic traits of crops. (III) Summary of the invention

[0006] The purpose of the present invention is to provide a recombinant DNA construct for reducing corn plant height and its application, which inhibits the expression of Br2 gene through miRNA technology and RNAi technology, moderately reduces the plant height of corn plants, which is more conducive to the breeding of lodging-resistant and densely planted corn.

[0007] The technical solution adopted by the present invention is:

[0008] In the first aspect, the present invention provides a recombinant DNA construct for reducing corn plant height, the recombinant DNA construct comprises a transcribable DNA sequence encoding a non-coding RNA molecule, the non-coding RNA molecule comprises at least one targeting sequence; the targeting sequence is a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% complementary to at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of an mRNA molecule encoding a Br2 protein in a corn plant or plant cell. When the non-coding RNA molecule is expressed in a corn plant or plant cell, it downregulates the expression of the mRNA molecule encoding the Br2 protein in the corn plant or plant cell.

[0009] Further, the Br2 protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity with SEQ ID NO:10.

[0010] Further, the mRNA molecule encoding the Br2 protein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identical to SEQ ID NO:1.

[0011] Further, the transcribable DNA sequence is operably linked to a plant expressible promoter to form an inhibitory element targeting the Br2 gene, wherein the plant expressible promoter includes a vascular promoter or a constitutive promoter. The non-coding RNA molecule encoded by the transcribable DNA is a precursor miRNA or siRNA that is processed or cleaved in plant cells to form a mature miRNA or siRNA.

[0012] The plant expressible promoter may preferably drive expression constitutively or in at least a portion of the vascular tissue of the plant. Some tissue-specific and tissue-preferred promoters that drive expression of the Br2 gene suppressor element in plants may not produce a significant dwarf or lodging resistance phenotype due to the spatiotemporal expression pattern of the promoter during plant development, and / or the expression amount or intensity of the promoter being too low or too weak.

[0013] Any vascular promoter known in the art can potentially be used as a tissue-specific or tissue-preferred promoter. Vascular promoters include RTBV promoter (e.g., SEQ ID NO:7), sucrose synthase gene promoters (such as corn sucrose synthase-1 (Sus1 or Sh1) promoter) (e.g., SEQ ID NO: 11), corn Sh1 gene paralog promoters, barley sucrose synthase promoter (Ss1) promoter, rice sucrose synthase-1 (RSs1) promoter (e.g., SEQ ID NO: 12), or rice sucrose synthase-2 (RSs2) promoter (e.g., SEQ ID NO: 13), sucrose transporter gene promoters (such as rice sucrose transporter promoter (SUT1)) (e.g., SEQ ID NO: 14), or rice sucrose synthase-2 (RSs2) promoter (e.g., SEQ ID NO: 15), or rice sucrose transporter promoter (SUT1) promoter (e.g., SEQ ID NO: 16). NO:14), or various known viral promoters, such as Commelina yellow mottle virus (CoYMV) promoter, wheat dwarf type geminivirus (WDV) large intergenic region (LIR) promoter, maize streak geminivirus (MSV) coat protein (CP) promoter, or rice yellow stripe 1 (YS1) or OsYSL2 promoter (SEQ ID NO:15), and any functional sequence portion or truncated form of any of the aforementioned promoters with similar expression patterns, such as truncated RTBV promoter. Any other vascular promoter known in the art can also be used, including promoter sequences of related genes from the same or different plant species or viruses with similar expression patterns (e.g., sucrose synthase, sucrose transporter, and viral gene promoter sequences). Promoter sequences with high homology to any of the aforementioned are also included. For example, a vascular promoter may comprise a DNA sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity to one or more of SEQ ID NO:7, any functional sequence portion or truncated form thereof, and / or any sequence complementary to any of the foregoing sequences; and a constitutive promoter may comprise a DNA sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity to one or more of SEQ ID NO:8, any functional sequence portion or truncated form thereof, and / or any sequence complementary to any of the foregoing sequences. Examples of vascular promoters may also include other known engineered and / or later identified promoter sequences that have been shown to have expression patterns in one or more vessels of a corn plant. In addition, any known or later identified constitutive promoter may also be used to express the repressor element of the Br2 gene.

[0014] Further, the vascular promoter includes one of the following: a sucrose synthase promoter, a sucrose transporter promoter, a Sh1 promoter, a Commelina yellow mottle virus (CoYMV) promoter, a wheat dwarf geminivirus (WDV) large intergenic region (LIR) promoter, a maize streak geminivirus (MSV) coat protein (CP) promoter, a rice yellow stripe 1 (YS1) promoter, or a rice yellow stripe 2 (OsYSL2) promoter.

[0015] Further, preferably, the vascular promoter comprises a DNA sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity to one or more of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15, or a functional part thereof. More preferably, the vascular promoter is the RTBV promoter (DNA sequence as shown in SEQ ID NO:7) or the pBr2 promoter (DNA sequence as shown in SEQ ID NO:9).

[0016] Examples of constitutive promoters that can be used in monocotyledonous plants (such as cereals or corn plants) include various actin gene promoters, such as rice actin 1 promoter (see SEQ ID NO: 18) and rice actin 2 promoter (see U.S. Pat. No. 6,429,357), CaMV 35S promoter (SEQ ID NO: 17), maize ubiquitin promoter ZmUbi (SEQ ID NO: 20), Coix lacryma-jobi polyubiquitin promoter (see SEQ ID NO: 22), rice or maize Gos2 promoter (see Pater et al., The Plant Journal, 2(6): 837-44 1992; for rice Gos2 promoter, see SEQ ID NO: 23), FMV 35S promoter (see U.S. Pat. No. 6,372,211), dual enhanced CMV promoter (see U.S. Pat. No. 5,322,938), MMV promoter (SEQ ID NO: 24). NO:24), PCLSV promoter (SEQ ID NO:8), Emu promoter (see Last et al., Theor. Appl. Genet. 81:581 (1991); and Mcelroy et al., Mol. Gen. Genet. 231:150 (1991)), tubulin promoter from corn, rice or other species, nopaline synthase (nos) promoter, octopine synthase (ocs) promoter, mannopine synthase (mas) promoter, or phytol dehydrogenase (e.g., corn Adh1) promoter, any other promoter known in the art or later identified to provide constitutive expression in cereal or corn plants (including viral promoters), any other constitutive promoter known in the art that can be used in monocots or cereals, and any functional sequence portion or truncated form of any of the foregoing promoters.

[0017] Further, the constitutive promoter comprises one of the following: plant ubiquitin promoter, plant actin promoter, 35S promoter, MMV promoter, FMV promoter, CMP promoter, nopaline synthase promoter, octopine synthase promoter, mannopine synthase promoter, or corn alcohol dehydrogenase, or a functional part thereof. The constitutive promoter is a DNA sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity to one or more of SEQ ID NO: 8, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or a functional part thereof. More preferably, the constitutive promoter is a pClSV promoter, whose DNA sequence is shown in SEQ ID NO: 8.

[0018] Further, the transcribable DNA sequence comprises at least one polynucleotide selected from the following groups: (a) encoding a miRNA precursor processed into a miRNA for inhibiting the expression of a Br2 target gene; (b) encoding an siRNA precursor processed into an siRNA for inhibiting the expression of a Br2 target gene and (c) a ta-siRNA processed into at least one siRNA for inhibiting the expression of a Br2 target gene.

[0019] Further, the targeting sequence of the non-coding RNA molecule comprises a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% complementary to at least 19 consecutive nucleotides of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:16 or SEQ ID NO:4.

[0020] Furthermore, the transcribable DNA sequences for producing the non-coding RNA are shown in SEQ ID NO:6 (corresponding to SEQ ID NO:2), SEQ ID NO:30 (corresponding to SEQ ID NO:3), SEQ ID NO:31 (corresponding to SEQ ID NO:16), and SEQ ID NO:5 (corresponding to SEQ ID NO:4).

[0021] In a second aspect, the present invention provides a DNA molecule comprising the recombinant DNA construct.

[0022] In a third aspect, the present invention provides a transformant comprising the recombinant DNA construct.

[0023] The transformants include transgenic corn plants, plant parts or plant cells.

[0024] In a fourth aspect, the present invention provides a non-viable or non-renewable plant product made from a transgenic corn plant part containing the recombinant DNA construct.

[0025] In a fifth aspect, the present invention provides a method for producing a transgenic corn plant containing a recombinant DNA construct, the method comprising: (a) transforming at least one cell of an explant with the recombinant DNA construct, including transforming a corn plant mediated by Agrobacterium; (b) regenerating or developing a transgenic corn plant from the transformed explant, wherein the transgenic corn plant comprises an insertion sequence of the recombinant DNA construct, and the insertion sequence is stably integrated into the plastid or chromosome of the corn cell.

[0026] The RNA molecule of the recombinant DNA construct of the present invention is also within the scope of protection of the present invention, or the expression cassette, recombinant vector, recombinant bacteria, transgenic cell or plant containing the recombinant DNA construct is also within the scope of protection of the present invention.

[0027] The inhibitory element of the present invention may comprise a transcribable DNA sequence of at least 19 nucleotides in length, such as a length of 19 nucleotides to a length of 27 nucleotides, or a length of 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides, wherein the transcribable DNA sequence corresponds to at least a portion of the target gene to be inhibited, and / or a DNA sequence complementary thereto. The length of the inhibitory element may be at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides or more (e.g., a length of at least 25, at least 30, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1000, at least 1500, at least 2000, or at least 3000 nucleotides). According to the length and sequence of the inhibitory element, one or more sequence mismatches or non-complementary bases can be tolerated, such as 1, 2, 3, 4, 5, 6, 7, 8 or more mismatches, and the inhibition is not lost, that is, the non-coding RNA molecule encoded by the inhibitory element is still able to fully hybridize and bind to the target mRNA molecule of the Br2 gene. In fact, even shorter RNAi inhibitory elements with a length in the range of 19 nucleotides to 27 nucleotides can have one or more mismatches or non-complementary bases, and still effectively inhibit the target gene Br2. Therefore, there is a sense or antisense inhibitory element sequence that can target at least one segment or part of the Br2 gene or its complementary sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity.

[0028] The present invention "non-coding RNA molecule" is an RNA molecule that does not encode protein. Non-limiting examples of non-coding RNA molecules include microRNA (miRNA), miRNA precursor, small interfering RNA (siRNA), siRNA precursor, small RNA (18-26 nt in length) and its precursor, heterochromatin siRNA (hc-siRNA), Piwi interacting RNA (piRNA), hairpin double-stranded RNA (hairpin dsRNA), trans-acting siRNA (ta-siRNA), naturally occurring antisense siRNA (nat-siRNA), CRISPR RNA (crRNA), tracer RNA (tracrRNA), guide RNA (gRNA) and single guide RNA (sgRNA).

[0029] Elements or transcribable DNA sequences for targeted inhibition of the Br2 gene may include one or more of the following: (a) a DNA sequence including at least one antisense DNA sequence, which is antisense to or complementary to at least one segment or part of the targeted Br2 gene; (b) a DNA sequence including at least one sense DNA sequence, which contains at least one segment or part of the targeted Br2 gene; (c) a DNA sequence including a miRNA precursor, which encodes an artificial miRNA complementary to at least one segment or part of the targeted Br2 gene; (d) a nucleotide DNA sequence including siRNA; (e) a DNA sequence including an inverted repeat sequence targeting the Br2 gene and / or transcribed into an RNA for inhibiting the targeted Br2 gene by forming a double-stranded RNA, wherein the transcribed RNA includes a DNA sequence that is antisense to or complementary to at least one segment or part of the targeted Br2 gene.

[0030] For antisense inhibition, transcribable DNA sequence or inhibitory element comprises antisense to or is complementary to the sequence of at least one part or segment of targeting Br2 gene.In order to suppress Br2 gene using inverted repeat sequence or transcribed dsRNA, transcribable DNA sequence or inhibitory element may comprise the sense sequence of segment or part comprising targeting Br2 gene and the antisense sequence of segment or part complementary to targeting Br2 gene, wherein sense and antisense DNA sequence are arranged in series.Sense and / or antisense sequence can each have less than 100% identity or complementarity with segment or part of targeting Br2 as described above respectively.Sense sequence and antisense sequence can be separated by spacer sequence so that the RNA molecule transcribed by inhibitory element forms stem, loop or stem-loop structure between sense sequence and antisense sequence.

[0031] In order to use miRNA to inhibit Br2 gene, the transcribable DNA sequence or inhibitory element may include a DNA sequence derived from a natural miRNA sequence or a natural miRNA sequence modified or derived from a virus or eukaryotic organism (such as an animal or plant). Such natural or natural-derived miRNA sequences can form a folded structure and be used as a scaffold for a precursor miRNA (pre-miRNA), and can correspond to the stem region of a natural miRNA precursor sequence, such as a natural (or natural-derived) primary miRNA (pri-miRNA) or pre-miRNA sequence. MiRNA is a non-protein coding RNA. When the miRNA precursor molecule is cut, a mature miRNA is formed, which is generally about 19 to about 25 nucleotides in length (often about 20 to about 24 nucleotides in length in plants), and has a sequence corresponding to a gene and / or its complementary sequence targeted for inhibition. Mature miRNA hybridizes with a target mRNA transcript and guides a protein complex to bind to the target transcript, which can be used to inhibit translation and / or cause degradation of the transcript, thereby negatively regulating or inhibiting the expression of the targeted gene.

[0032] Transgenic expression of miRNA can be used to regulate the expression of one or more target genes of miRNA. The recognition site of miRNA has been verified in all regions of mRNA. MiRNA is an important regulatory element in eukaryotes, and utilizing miRNA to achieve transgenic inhibition is a useful tool for manipulating biological pathways and responses. Designing artificial miRNA sequences can be achieved by replacing the nucleic acid in the stem region of the miRNA precursor with a sequence complementary to the expected target. A non-limiting example of a general method for determining nucleotide changes in a natural miRNA sequence to generate an engineered miRNA precursor for a target of interest includes the following steps: (a) selecting a unique target sequence of at least 18 nucleotides that is specific for a target gene, for example, by using a sequence alignment tool such as BLAST; cDNA and / or genomic DNA sequences can be used to identify target transcripts pointing to homologs and any potential matches to unrelated genes, thereby avoiding unintentional silencing or suppression of non-target sequences; (b) preferably having the following properties: (1) a GC content between about 40% and about 60%, (2) lacking consecutive stretches of 4 or more identical nucleotides, and (3) minimal differences from the miRNA precursor transcript; (c) determining the reverse complement sequence of the selected target sequence for use in preparing a modified mature miRNA, with the base mismatch type modified to obtain a secondary structure similar to that of the natural miRNA based on the mismatch site of the referenced natural miRNA; and (d) transforming the artificial miRNA into a plant.

[0033] Trans-acting small interfering RNA (ta-siRNA) is a special type of siRNA, with a common length of 21 nt. It is derived from the RNA fragment produced by miRNA cleaving the target gene. Its mechanism of action is similar to that of miRNA, that is, it trans-cleaves the target gene transcript to interfere with gene expression or trigger the next round of ta-siRNA production. Artificial ta-siRNA technology-mediated plant gene silencing is feasible and effective and has been applied in many plants, such as tobacco (Wu Bin et al., 2018 Shandong Agricultural Science 50(12):86-90).

[0034] Adequate expression of a transcribable DNA sequence encoding a non-coding RNA molecule targeting the Br2 gene for inhibition may be necessary to produce a semi-dwarf phenotype of a dwarf plant type that is resistant to lodging, as lower expression levels may not be sufficient to cause a noticeable phenotype. Therefore, tissue-specific and tissue-preferred promoters that drive moderate or strong levels of expression of their associated transcribable DNA sequences in plant tissues may be preferred. In addition, such tissue-specific and tissue-preferred promoters should drive expression of their associated transcribable DNA sequences during one or more vegetative stages of plant development when the plant is growing and / or elongating, including one or more of the following vegetative stages: VE, V1, V2, V3, V4, V5, V6, V7, V8, V9, V10, V11, V12, V13, V14, Vn, VT, such as at least V3-V12, V4-V12, V5-V12, V6-V12, V7-V12, V8-V12, V3-V14, V5-V14, V6-V14, V7-V14, V8-V14, V9-V14, V10-V14, etc., or any other range of vegetative stages when plant growth and / or elongation is occurring.

[0035] The recombinant DNA molecule, construct or vector transcribable DNA sequence of the present invention may be operably linked to one or more additional regulatory elements, such as one or more enhancers, leader sequences, transcription start sites (TSS), linkers, one or more 5' and 3' untranslated regions (UTRs), one or more introns, polyadenylation signals, termination regions or sequences, etc., in addition to its associated promoter, which are suitable, necessary or preferred for enhancing, regulating or allowing the expression of the transcribable DNA sequence in plant cells. Such one or more additional regulatory elements may be optional and / or used to enhance or optimize the expression of the transgenic or transcribable DNA sequence. As provided herein, the difference between an "enhancer" and a "promoter" may be that an enhancer generally lacks a transcription start site, a TATA box or an equivalent sequence, and is therefore insufficient to drive transcription alone. As used herein, a "leader sequence" may generally be defined as a DNA sequence of the 5'-UTR of the gene (or transgenic) between the transcription start site (TSS) and the 5' end of the protein coding sequence of the transcribable DNA sequence or transgenic.

[0036] The present invention provides methods for transforming plant cells, tissues or explants with recombinant DNA molecules or constructs to produce transgenic plants. Many methods for transforming chromosomes or plasmids in plant cells with recombinant DNA molecules or constructs are known in the art, which can be used to produce transgenic plant cells and plants according to the method embodiments of the present invention. Any suitable method or technique known in the art for transforming plant cells can be used according to the methods of the present invention. Effective methods for transforming plants include bacterial-mediated transformation, such as Agrobacterium-mediated or Rhizobium-mediated transformation, and microparticle or particle bombardment-mediated transformation. It is known in the art to transform explants with transformation vectors and then subsequently culture these explants, etc., to regenerate or develop transgenic plants. Other methods for plant transformation, such as microinjection, electroporation, vacuum infiltration, pressure, ultrasonic treatment, silicon carbide fiber stirring, PEG-mediated transformation, etc., are also known in the art.

[0037] Methods for transforming plant cells and explants are well known to those of ordinary skill in the art. Methods for transforming plant cells with particles coated with recombinant DNA by microprojectile bombardment are provided in, for example, U.S. Pat. Nos. 5,550,318; 5,538,880; 6,160,208; 6,399,861; and 6,153,812, and Agrobacterium-mediated transformation is described in, for example, U.S. Pat. Nos. 5,159,135; 5,824,877; 5,591,616; 6,384,301; 5,750,871; 5,463,174; and 5,188,958; all of which are incorporated herein by reference. Additional methods for transforming plants can be found in, for example, Compendium of Transgenic Crop Plants (2009) Blackwell Publishing. Any suitable plant transformation method known in the art or later developed can be used to transform plant cells or explants using any of the nucleic acid molecules, constructs or vectors provided herein.

[0038] The one or more recipient cells or explants or cell targets for transformation include, but are not limited to, seed cells, fruit cells, leaf cells, cotyledon cells, hypocotyl cells, meristem cells, embryo cells, endosperm cells, root cells, shoot cells, stem cells, pod cells, flower cells, inflorescence cells, stalk cells, pedicel cells, style cells, stigma cells, receptacle cells, petal cells, calyx cells, pollen cells, anther cells, filament cells, ovary cells, ovule cells, pericarp cells, phloem cells, bract cells, callus cells, chloroplasts, stomatal cells, trichome cells, root hair cells, storage root cells, or vascular tissue cells, seeds, embryos, meristems, cotyledons, hypocotyls, endosperm, roots, shoots, stems, nodes, callus, cell suspensions, protoplasts, flowers, leaves, pollen, anthers, ovaries, ovules, pericarp, bracts, and / or vascular tissues, or any transformable portion of any of the foregoing. For plant transformation, any one or more target cells, tissues, explants, etc. that can be used to accept the recombinant DNA transformation vector or molecule of the present disclosure can be collectively referred to as "explants" for transformation. Preferably, the explant cells or tissues that can be transformed or transformed can further develop or regenerate into plants. Any cell or explant that can grow or regenerate into a fertile plant is considered to be a useful receptor cell or explant (i.e., as a target explant for transformation) for practicing the present disclosure. Callus can be initiated or produced by various tissue sources, including but not limited to embryo or embryo part, non-embryo seed tissue, seedling apical meristem, microspores, etc. Any cell that can be used as callus proliferation can be used as a receptor cell for transformation. Transformation methods and materials (e.g., various culture media and receptor target cells or explants and methods for transforming and subsequently regenerating into transgenic plants) for preparing transgenic plants are known in the art.

[0039] The transformation of target plant material or explant can be put into practice in tissue culture on nutrient medium, and described medium for example allows the mixture of the nutrients of cell in vitro growth or cell culture.As known in the art, transformed explant, cell or tissue can carry out other culture steps, such as callus induction, selection, regeneration etc.It is also possible to transform when not producing or not using callus.Can make the transformed cell, tissue or explant containing recombinant DNA sequence insertion or event grow, develop or regenerate into transgenic plant in culture medium, plug (plug) or soil according to methods known in the art.Transgenic plant can be further hybridized with self or other plants to produce transgenic seed and progeny.It is also possible to prepare transgenic plant by hybridizing the first plant comprising recombinant DNA sequence or transformation event with the second plant lacking insertion.For example, recombinant DNA construct or sequence can be introduced into the first plant system that is easy to transform, then it can be hybridized with the second plant system to gradually infiltrate the recombinant DNA construct or sequence into the second plant system. The progeny of these crosses can be further backcrossed into more desirable lines multiple times, such as through 6 to 8 generations or backcrosses, to produce progeny plants having essentially the same genotype as the original parental line but with the introduction of the recombinant DNA construct or sequence.

[0040] Transgenic or edited plants, plant parts, cells, or explants provided by the present invention may belong to superior varieties or superior strains. Superior varieties or superior strains refer to varieties obtained by breeding and selecting for excellent agronomic performance. Transgenic or edited plants, cells, or explants provided herein may be hybrid plants, cells, or explants. As used herein, "hybrids" are produced by hybridizing two plants from different varieties, strains, inbred lines, or species so that progeny include genetic material from each parent. Technicians will recognize that higher-level hybrids may also be generated. For example, a first hybrid may be prepared by hybridizing variety A with variety B to produce an A x B hybrid, and a second hybrid may be prepared by hybridizing variety C with variety D to produce a C x D hybrid. The first hybrid and the second hybrid may be further hybridized to produce a higher-level hybrid (A × B) × (C × D) comprising genetic information from all four parental varieties.

[0041] Recombinant DNA molecules of the present invention or constructs can be used for transforming the DNA transformation vector of corn plant cells, tissues or explants or are contained in the DNA transformation vector.Except at least one transgenic, expression cassette and / or targeting Br2 gene to suppress the transcribable DNA sequence of the non-coding RNA molecule, this transformation vector can usually include necessary or useful sequences or elements for effective transformation.For Agrobacterium-mediated, rhizobium-mediated or other bacteria-mediated transformation, the transformation vector can include engineered transfer DNA (or T-DNA) section or region, which has two border sequences at least transcribable DNA sequence or transgenic flank, i.e. left border (LB) and right border (RB), so that T-DNA inserts the transformation event that will produce transcribable DNA sequence, transgenic or expression cassette in the plant genome.Therefore, the transcribable DNA sequence, transgenic or expression cassette of the non-coding RNA molecule of coding targeting Br2 gene to suppress can be located between the left and right borders of T-DNA, possibly together with one or more other transgenic or expression cassettes, such as plant selective marker transgenic and / or can give the plant agronomy interested in proterties or phenotype agronomy one or more other genes. According to alternative embodiments, coding targeting endogenous Br2 gene can be present in the T-DNA segment separated on identical or different one or more recombinant DNA molecules with the transcribable DNA sequence, transgenic or expression cassette and plant selective marker transgenic (or other genes of interest in agronomy) of the non-coding RNA molecule that suppresses, such as for co-conversion.Conversion vector or construct can also comprise prokaryotic maintenance element, and it can be positioned at one or more T-DNA regions outside in the vector.

[0042] Due to the presence of selection agents such as antibiotics or herbicides, the plant selective marker transgene in the transformation vector of the present invention or the construct can be used to help the selection of transformed cells or tissues, wherein the plant selective marker transgene provides tolerance or resistance to the selection agent. Therefore, the selection agent can be biased towards or conducive to the survival, development, growth, proliferation, etc. of the transformed cells expressing the plant selective marker gene, such as to increase the ratio of transformed cells or tissues in the TO plant. Commonly used plant selective marker genes include, for example, those that impart tolerance or resistance to antibiotics such as kanamycin and paromomycin (nptII), hygromycin B (aph IV), streptomycin or spectinomycin (aadA) and gentamicin (aac3 and aacC4), or those that impart tolerance or resistance to herbicides such as glufosinate (bar or pat), quizalofop-ethyl (aad-1), flazasulfuron (CdP450), dicamba (DMO) and glyphosate (aroA or cp4epsps or g10evo-epsps). Plant screenable marker genes can also be used, which provide the ability of transformants through visual screening, such as luciferase or green fluorescent protein (GFP), or the gene of expression beta glucuronidase or uidA gene (GUS) (its various chromogenic substrates are known). In some embodiments, carrier provided by the invention or polynucleotides comprise at least one selective marker gene selected from the group consisting of the following: nptII, aph IV, aadA, aac3, aacC4, bar, pat, CdP450, DMO, EPSPS, aad-1, aroA, GFP and GUS. Plant transformation also can be carried out in the absence of selection in one or more steps or stages of explants, tissues, plants and / or plant parts of cultivation, growth or regeneration transformation.

[0043] As used herein, singular terms and the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant", "the plant", or "a plant" also includes a plurality of plants; further, depending on the context, use of the term "plant" may also include genetically similar or identical progeny of the plant.

[0044] The term "about" of the present invention is intended to limit the numerical value modified by it, indicating that the value is variable within the error range. When no specific error range, such as the standard deviation of the mean value, is listed, the term "about" should be understood to mean a range that includes the value and a range that is included by rounding up or down to the number taking into account the significant figures.

[0045] The present invention "plant" refers to a complete plant, any part of a plant or a cell or tissue culture derived from a plant, comprising any of the following: a complete plant, a plant part or organ (e.g., leaf, stem, root, etc.), a plant tissue, a seed, a plant cell and / or its progeny. A plant cell is a biological cell taken from a plant or a plant derived from a cell of a plant by culturing." plant part" may refer to any organ or complete tissue of a plant, such as meristem, branch organ / structure (e.g., leaf, stem or node), root, flower or flower organ / structure (e.g., bract, sepal, petal, stamen, carpel, anther and ovule), seed (e.g., embryo, endosperm and seed coat), fruit (e.g., mature ovary), propagule, or other plant tissues (e.g., vascular tissue, epidermal tissue, etc.), or any part thereof. The present invention's plant part may be vigorous, inviable, reproducible and / or non-reproducible.

[0046] "Propaganda" can include any plant part capable of growing into a whole plant.

[0047] "Corn plant" or "maize plant" herein refers to a plant of the species Zea mays L., and includes all plant varieties that can be crossed with maize, including wild maize species.

[0048] The term "dwarf" plant of the present invention refers to an atypical small plant. Typically, the stature or height of the "dwarf plant" is reduced by about 30%, 35%, 40%, 45%, 50%, 55%, 60% or more relative to the stature or height of a control wild-type plant (e.g., a plant of the same genus that includes all other traits except the dwarfing trait).

[0049] "Semi-dwarf plants" of the present invention refer to plants whose stature or height is reduced by about 5%, 10%, 15%, 20%, 25%, 30% or less relative to the stature or height of control wild-type plants. Typically, but not exclusively, the dwarf plants are characterized by a shortened stem, stalk or trunk length when compared to the stem, stalk or trunk length of control wild-type plants under comparable growth conditions.

[0050] The term "dwarf plant" of the present invention refers to a plant that exhibits a short stature due to a shortened internode length without a corresponding reduction in the number and size of the internodes or other organs (including but not limited to leaves, ears and tassels). "Dwarfing" refers to a plant abnormal variation characterized by a shortened internode without a corresponding reduction in other plant parts.

[0051] The present invention "germplasm" refers to the living source of genetic material. Germplasm can be a part of an organism or cell, or can be separated from an organism or cell. Usually, germplasm provides a specific molecular composition for genetic material, and this specific molecular composition provides a physical basis for some or all of the genetic properties of an organism or cell culture. Germplasm includes cells, seeds or tissues that can grow into new plants, or plant parts that can be cultivated into whole plants, such as leaves, stems, pollen or cells.

[0052] The present invention "transgenic plant" refers to such a plant, the genome of which has been altered by integration or insertion of a recombinant DNA molecule, construct or sequence. Transgenic plants include plants developed or regenerated from the initially transformed plant cells, as well as progeny transgenic plants in later generations or hybrid plants from transgenic plants.

[0053] The term "transgenic plant cell" of the present invention simply refers to any plant cell transformed with a stably integrated recombinant DNA molecule, construct or sequence. The transgenic plant cell may include a transgenic plant cell of an initially transformed plant cell, a transgenic plant cell of a regenerated or developing TO plant, a transgenic plant cell cultured from another transgenic plant cell, or a transgenic plant cell of any progeny plant or descendant of a transformed TO plant, including one or more cells of a plant seed or embryo, or a cultured plant cell, callus cell, etc.

[0054] The term "recombinant" with respect to polynucleotide (DNA or RNA) molecules, proteins, constructs, vectors, and the like, refers to polynucleotide or protein molecules or sequences that are artificially produced and not normally found in nature.

[0055] The term "phenotype" or "phenotypic trait" or "trait" refers to one or more traits of an organism. The phenotype can be observed by the naked eye or by any other evaluation method known in the art (e.g., microscopy, biochemical analysis, genomic analysis, determination of specific disease resistance, etc.). In some cases, the phenotype is directly controlled by a single gene or genetic locus, i.e., a "monogenic trait". In other cases, the phenotype is the result of several genes.

[0056] The term "operably linked" refers to a functional connection between a promoter or other regulatory element and an associated transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc. operates or functions to initiate, assist, influence, cause and / or promote transcription and expression of the associated transcribable DNA sequence or coding sequence in at least certain one or more cells, tissues, developmental stages and / or conditions.

[0057] The term "plant expressible promoter" refers to a promoter that can initiate, assist, influence, cause and / or promote the transcription and expression of its associated transcribable DNA sequence, coding sequence or gene in plant cells or tissues.

[0058] The present invention "vascular promoter" refers to a plant expressible promoter that drives, causes or triggers the expression of a transcribable DNA sequence or transgene operably linked to such a promoter in one or more vascular tissues of a plant, even if the promoter is also expressed in one or more other non-vascular plant cells or tissues. Such one or more vascular tissues may include one or more of the phloem, vascular parenchyma, and / or one or more bundle sheath cells or tissues of a plant. The difference between a "vascular promoter" and a constitutive promoter is that it has a regulated and relatively more limited expression pattern, including one or more vascular tissues of a plant. Vascular promoters include vascular-specific promoters and vascular-preferred promoters.

[0059] The "coding region" of the present invention refers to a portion of a polynucleotide encoding a functional unit or molecule (for example, but not limited to, mRNA, protein, or non-coding RNA sequence or molecule).

[0060] The term "inhibit" refers to reducing, decreasing or eliminating the expression level of mRNA and / or protein encoded by a target gene in a plant, plant cell or plant tissue at one or more plant developmental stages, compared to the expression level of such target mRNA and / or protein in a wild-type or control plant, cell or tissue at the same plant developmental stage.

[0061] As understood in the art, the term "promoter" generally refers to a DNA sequence that contains an RNA polymerase binding site, a transcription start site and / or a TATA box and helps or promotes the transcription and expression of an associated transcribable polynucleotide sequence and / or a gene (or transgenic). A promoter can be synthetic or artificial and / or engineered, varied or derived from a known or naturally occurring promoter sequence. A promoter can be a chimeric promoter comprising a combination of two or more heterologous sequences. Therefore, the promoter of the present invention may include a variant of a promoter sequence that is similar in composition to but not identical to one or more other promoter sequences known or provided herein. Promoters can be classified according to a variety of standards associated with the expression pattern of the relevant coding or transcribable sequence or gene (including transgenic) that is operably connected to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. A promoter that drives expression in all or nearly all tissues of a plant is referred to as a "constitutive" promoter. However, the expression level achieved using a "constitutive promoter" is not necessarily consistent in different tissue types and cells. A promoter that drives expression in certain developmental periods or stages is referred to as a "developmental" promoter. Promoters that drive enhanced expression in certain tissues of a plant relative to other plant tissues are referred to as "tissue-enhanced" or "tissue-preferred" promoters. Thus, a "tissue-preferred" promoter results in relatively high or preferential or predominant expression in one or more specific tissues of a plant, but has lower expression levels in one or more other tissues of the plant. Promoters that are expressed in one or more specific tissues of a plant and have little or no expression in other plant tissues are referred to as "tissue-specific" promoters. Tissue-specific or tissue-preferred promoters can also be defined based on the specific or preferred tissue or tissues in which it drives expression of its associated transcribable DNA sequence or inhibitory element. For example, a promoter that results in specific expression in vascular tissue can be referred to as a "vascular-specific promoter," while a promoter that results in preferential or predominant expression in vascular tissue can be referred to as a "vascular-preferred promoter."

[0062] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0063] The recombinant DNA molecule, construct or vector of the present invention inhibits the expression of the targeted Br2 gene through gene regulation mediated by non-coding RNA, and obtains a corn transformant with significantly reduced plant height, shortened internode length, and no corresponding reduction in the number of internodes or the number and size of other organs (including but not limited to leaves, ears and tassels). Specifically, the transcribable DNA sequence encoding the non-coding RNA molecule (such as miRNA and siRNA) targeting the Br2 gene is fused with other regulatory elements, such as vascular promoter (RTBV) or constitutive promoter (ClSV) to construct a gene inhibition expression vector, and a corn transformant with significantly reduced plant height is obtained through transgenic technology, which has important practical application significance for corn dwarf breeding.

[0064] Compared with recessive mutation breeding which requires both parents to contain homozygous recessive mutations, the heterozygous transgenic dwarf plants of the present invention can effectively reduce plant height and have stable traits, which is extremely convenient in breeding. (IV) Description of the drawings

[0065] Figure 1 , schematic diagram of the structure of Br2 gene.

[0066] Figure 2 Example 2: The plant height reduction ratio of the transformant expressing the targeted Br2 gene suppression element relative to the wild-type corn.

[0067] Figure 3 Example 3: The ratio of reduced plant height of hybrid corn expressing the targeted Br2 gene suppression element relative to wild-type corn. (V) Specific implementation methods

[0068] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0069] Example 1. Vector construction and acquisition

[0070] The maize Br2 gene contains 5 exons and 4 introns (e.g. Figure 1), whose sequence is shown in SEQ ID NO:28. According to the sequence SEQ ID NO:28, an interference sequence for inhibiting the expression of the Br2 gene was designed, and the nucleotide fragment from the 930th to the 1384th position at the 5' end of the sequence was selected as the forward arm of the interference structure, which is a part of the second exon, a total of 455bp, and its reverse complementary sequence was used as the reverse arm of the interference structure; the second intron and a part of the third exon were selected as the circular sequence, which was composed of the nucleotide fragment from the 1385th to the 1486th position at the 5' end of the SEQ ID NO:28 sequence, a total of 102bp. The three were spliced ​​to form a stem-loop structure that inhibits the expression of the Br2 gene, and its sequence is shown in SEQ ID NO:5 (1-455bp is the forward arm sequence, 456-557bp is the loop structure, and 558-1012bp is the reverse complementary sequence of the forward arm).

[0071] It is well known in the art that designing artificial miRNA sequences can be achieved by replacing the nucleic acid in the stem region of the miRNA precursor with a sequence complementary to the expected target. In this example, the rice Osa-MIR1425 precursor sequence (SEQ ID NO: 6) was used to design an amiRNA precursor targeting the Br2 mRNA sequence. According to the characteristics of miRNA and miRNA* pairing when the rice Osa-MIR1425 precursor sequence forms a secondary structure, targets that meet these conditions were found in the Br2 gene encoding mRNA sequence (SEQ ID NO: 1). The psRNATarget software (https: / / www.zhaolab.org / psRNATarget / ) was used to analyze the off-target efficiency of the artificially designed targets online, and then the RNA fold software (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi) was used to analyze and predict its secondary structure online. Three preferred amiRNAs (artificial microRNAs) were obtained: (1) SEQ ID NO.2:UAUCUGCGCGAGCGCCUGCUC, (2) SEQ ID NO.3:UAGGCGAAGAUGGCGCUGAAG, (3) SEQ ID NO.16:UUCUGGACGAUGACGGAGAUG. The transcribable DNA sequences used to transcribe the above amiRNAs are shown in SEQ ID NO.6, SEQ ID NO.30 and SEQ ID NO.31, respectively. The preferred sequence SEQ ID NO.6 was used for the next experiment.

[0072] SEQ ID NO: 6#Os-amiRNA1425 precursor sequence 408bp The single underline is the target sequence, and the double underline is the sequence that is reverse complementary to the target and has 3 base mismatches

[0073]

[0074] SEQ ID NO: 30#SZ1 The single underline is the target sequence, and the double underline is the sequence that is reverse complementary to the target and has 3 base mismatches, 408 bp

[0075]

[0076]

[0077] SEQ ID NO: 31#SZ2 408bp The single underline is the target sequence, and the double underline is the sequence that is reverse complementary to the target and has 3 base mismatches

[0078]

[0079] RNAi expression frame: The promoter (pRTBV (SEQ ID NO.7), pBr2 promoter (SEQ ID NO.9), constitutive promoter pClSV (SEQ ID NO.8) and root-specific expression promoter pRcc3 (SEQ ID NO.27)), stem-loop sequence siRNA (SEQ ID NO:5) that inhibits Br2 gene expression and NOS terminator (SEQ ID NO:26) are operably linked to artificially synthesize pRTBV-siRNA-tNOS, pBr2-siRNA-tNOS, pClSV-siRNA-tNOS and pRcc3-siRNA-tNOS fragments.

[0080] miRNA expression frame: The promoter (pRTBV (SEQ ID NO.7), pBr2 promoter (SEQ ID NO.9), constitutive promoter pClSV (SEQ ID NO.8) and root-specific expression promoter pRcc3 (SEQ ID NO.27)), the amiRNA sequence that inhibits the expression of the Br2 gene (SEQ ID NO:6) and the NOS terminator (SEQ ID NO:26) are operably linked to artificially synthesize pRTBV-amiRNA-tNOS, pBr2-amiRNA-tNOS, pClSV-amiRNA-tNOS, and pRcc3-amiRNA-tNOS fragments.

[0081] Screening gene expression cassette: The pZmUbi-aad-1-TCaMV35S fragment was artificially synthesized by operably connecting the maize ZmUbi promoter (SEQ ID NO: 20), the aad-1 gene and its signal peptide coding sequence (SEQ ID NO: 25), and the cauliflower mosaic virus 35s terminator TCaMV35S (SEQ ID NO: 29).

[0082] Transformation vector: The vector pCambia1300 (NCBI sequence number AF234296) was double-digested with HindⅢ / XhoⅠ, and a fragment of 6783 bp was recovered. The above three miRNA and RNAi gene expression frames were recombined by seamless cloning, and then transformed into Escherichia coli TG1 strain. After sequencing confirmation, the transformation vectors p1300-pRTBV::amiRNA-Pubi::aad-1 and p1300-pBr2::amiRNA-Pubi::aad-1 were obtained. , p1300-pClSV::amiRNA-Pubi::aad-1, p1300-pRTBV::siRNA-Pubi::aad-1, p1300-pBr2::siRNA-Pubi::aad-1, p1300-pClSV::siRNA-Pubi::aad-1, p1300-pRcc3::amiRNA-Pubi::aad-1, and p1300-pRcc3::siRNA-Pubi::aad-1.

[0083] These plasmids were transformed into Agrobacterium LBA4404 competent cells by electroporation, and after enzyme digestion and identification, they were preserved in glycerol bacteria to obtain recombinant Agrobacterium, which was used for genetic transformation of corn inbred line PH6WC.

[0084] Example 2: Genetic transformation of corn plants

[0085] Maize genetic transformation was carried out by Agrobacterium-mediated transformation, specifically according to the method and culture medium formula reported by Frame et al. (Plant Physiol, 2002, 129: 13-22), using highly effective haloxyfop-p-ethyl as a screening agent, and the steps were as follows:

[0086] (1) The recombinant Agrobacterium containing the transformation vector obtained in Example 1 was mixed evenly in the infection medium, and the bacterial solution concentration OD660 was adjusted to 0.5-0.6, which is the infection solution containing Agrobacterium.

[0087] (2) Take corn ears 8-10 days after pollination and collect immature embryos with a size of 1.0-1.5 mm. Immerse the collected immature embryos in the infection solution of step (1), let stand at room temperature for 5 minutes, take out the embryos, absorb the liquid, place the embryos flat side down on the co-culture medium, and culture at 22°C for 3-5 days.

[0088] (3) The immature embryos cultured in step (2) were transferred to a callus induction medium containing a final concentration of 200 mg / L of Timentin antibiotic (GlaxoSmithKline, USA), and cultured in the dark at 28° C. for 10-14 days to kill Agrobacterium.

[0089] (4) All callus tissues after induction culture in step (3) were transferred to a screening medium containing a final concentration of 100 nM halpyr-methyl and cultured in the dark at 28° C. for 2-3 weeks. After induction culture, all callus tissues were transferred to a fresh screening medium containing 500 nM halpyr-methyl and cultured in the dark at 28° C. for 2-3 weeks.

[0090] (5) The embryonic tissue that survived in step (4) was transferred to a regeneration medium, cultured in the dark at 28° C. for 10-14 days, then transferred to a fresh regeneration medium, and cultured in the light at 26° C. for 10-14 days.

[0091] (6) The fully developed plants from step (5) were selected and placed on a rooting medium and cultured under light at 26° C. until the roots were fully developed. The rooted regenerated seedlings were transplanted to a greenhouse for growth and cultivation.

[0092] Example 3: Plant height reduction of transformants containing Br2 suppression element

[0093] Several transformants in Example 2 were analyzed by probe method (Taqman) at a later stage to analyze the copy number of the transformant, retain the transformant of a single copy, and bag self-pollination seed (T1 generation). The T1 generation seeds of each transformant were planted in the field according to 3 seeds per hole, and when they grew to the 3-leaf stage, each transformant was sprayed with a 2-fold medium dose (45mL / mu) of quizalofop-ethyl aqueous solution. After 2 weeks, the corn plants that continued to grow were retained according to the pattern of one hole and one corn plant, and the plant height of the transformant was counted during the R5 growth period, and 8 transformation events of each vector were measured, and 10 plants were measured for each transformation event, and compared with the average plant height of the control plant (PH6WC), and the results are shown in Figure 2 Furthermore, there was no abnormality in ear development in these transformants, with shortened internode length without a corresponding reduction in the number of internodes or the number and size of other organs (including but not limited to leaves, ears and tassels).

[0094] from Figure 2The results of the experiment show that, compared with the control plants, constructs using vascular promoters and constitutive promoters to express miRNA or siRNA targeting the Br2 gene repression element are effective in causing these plant height phenotypes, with the average plant height of the transformants reduced by 30.20%-50.52%, while the plant height of the transformants containing the rice root promoter pRcc3 expressing the Br2 gene repression element was reduced very little (3.63%-4.50%).

[0095] Conclusion: The effects observed with this suppression construct were not caused by the insertion of the construct at any one locus within the plant genome. Therefore, targeting the expression of the Br2 gene suppression construct was effective in reducing plant height, given that different expression patterns, including vascular and constitutive expression, provided similar plant height phenotypes and no obvious heteromorphism in the panicle.

[0096] Example 4: Hybrid corn containing an expression-targeted Br2 gene suppression element has reduced plant height

[0097] The transformants carrying the targeted Br2 gene inhibition element described in Example 3 are the mother plants, and such mother plants are determined to be homozygous by the probe method (Taqman). The preferred mother plants are pClSV-miR-24-5, pBr2-miR-15-9, pClSV-miR-24-1, pRTBV-siR-4-7, pBr2-siR-1-1 and pClSV-siR-14-4. The plant heights of these transformants were reduced by 48.61%, 48.78%, 47.91%, 46.48%, 48.9% and 49.13%, respectively.

[0098] They were artificially assisted pollinated with wild-type parent PH4CV to obtain hybrid corn. After obtaining transgenic and control hybrids, they were planted in the field in plots (20 square meters plot, density 4500 plants / mu), and 10 plants were randomly selected from each plot during the R5 growth period to measure plant height and conduct statistical analysis. Compared with the non-transgenic control hybrid corn (Xianyu 335), a significant decrease in average plant height was observed in the transgenic hybrid plants expressing the repressor element (such as Figure 3 ), a reduction in internode length without a corresponding reduction in the number of internodes or the number and size of other organs (including but not limited to leaves, ears and tassels).

[0099] In this experiment, the average plant height of field-grown hybrid maize plants expressing miRNA targeting Br2 was reduced by 26.66%-32.71% relative to wild-type hybrid control plants ( Figure 3 ), while the average plant height of field-grown hybrid maize plants expressing siRNA targeting Br2 was also reduced by 27.60%-34.05% (e.g. Figure 3). In other words, the corn plants after hybridization still retain the dwarf trait.

Claims

1. A recombinant DNA construct for reducing corn plant height, characterized in that: The recombinant DNA construct comprises a transcribable DNA sequence encoding a non-coding RNA molecule, wherein the non-coding RNA molecule comprises at least one targeting sequence; the targeting sequence is a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% complementary to at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of an mRNA molecule encoding a Br2 protein in a corn plant or plant cell.

2. The recombinant DNA construct according to claim 1, characterized in that The Br2 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identical to SEQ ID NO:

10.

3. The recombinant DNA construct according to claim 1, characterized in that The transcribable DNA sequence is operably linked to a plant expressible promoter to form a repressor element targeting the Br2 gene, wherein the plant expressible promoter includes a vascular promoter or a constitutive promoter.

4. The recombinant DNA construct according to claim 1, wherein The mRNA molecule of the Br2 protein consists of a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identical to SEQ ID NO:

1.

5. The recombinant DNA construct according to claim 3, characterized in that The vascular promoter includes one of the following: sucrose synthase promoter, sucrose transporter promoter, Sh1 promoter, Commelina yellow mottle virus promoter, wheat dwarf geminivirus large intergenic region promoter, corn streak geminivirus coat protein promoter, rice yellow stripe 1 promoter, or rice yellow stripe 2 promoter; the constitutive promoter includes one of the following: plant ubiquitin promoter, plant actin promoter, 35S promoter, MMV promoter, FMV promoter, CMP promoter, nopaline synthase promoter, octopine synthase promoter, mannopine synthase promoter, or corn alcohol dehydrogenase, or a functional part thereof.

6. The recombinant DNA construct according to claim 5, characterized in that The constitutive promoter is a DNA sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identity to one or more of SEQ ID NO:8, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22, or a functional portion thereof; The vascular promoter comprises a DNA sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% identical to one or more of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15, or a functional part thereof.

7. The recombinant DNA construct according to claim 6, characterized in that The vascular promoter DNA sequence is shown in SEQ ID NO:7 and SEQ ID NO:9; the constitutive promoter is shown in SEQ ID NO:

8.

8. The recombinant DNA construct according to claim 1, wherein The transcribable DNA sequence comprises at least one polynucleotide selected from the following groups: (a) encoding a miRNA precursor processed into a miRNA for inhibiting the expression of a Br2 target gene; (b) encoding an siRNA precursor processed into an siRNA for inhibiting the expression of a Br2 target gene and (c) a ta-siRNA processed into at least one siRNA for inhibiting the expression of a Br2 target gene.

9. The recombinant DNA construct according to claim 1, wherein The targeting sequence of the non-coding RNA molecule comprises a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% complementary to at least 19 consecutive nucleotides of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:

16.

10. A DNA molecule comprising the recombinant DNA construct of claim 1.

11. A transformation vector comprising the recombinant DNA construct of claim 1.

12. A non-viable or non-renewable plant product made from a transgenic corn plant part containing the recombinant DNA construct of claim 1.

13. A method for producing a transgenic corn plant containing the recombinant DNA construct of claim 1, characterized in that: The method comprises: (a) transforming at least one cell of an explant with the recombinant DNA construct, and (b) regenerating or developing the transgenic corn plant from the transformed explant.

Images