Application of Pto-C3H35 gene haplotype in evaluation of lignin content of poplar

Abstract

The invention provides application of a Pto-C3H35 gene haplotype in evaluation of poplar lignin content, and belongs to the technical field of molecular markers. According to the invention, the haplotype of the Pto-C3H35 gene is determined according to the nucleotides of SNP1, InDel1, InDel2, InDel3 and SNP2. The invention provides a primer group and a kit for determining the gene haplotype as well as a method for determining the gene haplotype, the lignin content of the poplar can be accurately judged by determining the genotype combination of the five sites, and superior plants with low lignin content are accurately and efficiently screened in the early growth stage of the poplar; the method is applied to new variety breeding of industrial poplar artificial forests, and effectively shortens the breeding period.

Description

Technical Field

[0001] The invention provides an application of a Pto-C3H35 gene haplotype in evaluating the lignin content of poplars, belonging to the technical field of molecular markers. Background Art

[0002] Populus tomentosa is a native tree species unique to my country, widely distributed in the Yellow River Basin and the North China Plain. Populus tomentosa has the advantages of tall trunks, fast growth, good material, drought resistance, and strong environmental adaptability. It is the main fast-growing timber and greening tree species in northern my country, and is also an excellent afforestation tree species. In addition, the wood of Populus tomentosa is of excellent quality and is an ideal raw material for papermaking in my country. Lignin is the main component of wood, which is tightly cross-linked with cellulose and hemicellulose in the secondary cell wall, preventing the release and utilization of wood fibers. Therefore, reducing the lignin content is an effective strategy to increase the industrial utilization value of wood products.

[0003] Caffeic acid is a key metabolite in the lignin biosynthesis pathway. It is a common precursor for the synthesis of three lignin monomers and an important hub for directing carbon flow from the common phenylpropanoid pathway to the specific lignin synthesis pathway. Therefore, caffeic acid can be used as an important metabolic indicator for evaluating lignin content. In the traditional breeding process of new poplar varieties, the selection of low-lignin poplar varieties can only be carried out through destructive methods such as xylem sampling and phenotypic measurement. However, destructive sampling can cause damage to the xylem of plants, especially in the early stage of poplars, which can cause plant growth retardation or even death. Therefore, in the process of new variety breeding, it is difficult to select the lignin content characteristics of Populus tomentosa by traditional physiological and biochemical methods in the early growth stage of poplars.

[0004] With the continuous advancement of modern molecular breeding technology, by developing key molecular markers related to lignin and identifying the genetic effects of their combination on tree lignin, it is possible to quickly and accurately screen new tree varieties with low lignin content. This technology has important application prospects in evaluating wood quality during the tree seedling stage, but there is currently very little research in this area. Summary of the invention

[0005] The present invention provides an application of a Pto-C3H35 gene haplotype in evaluating the lignin content of poplars, which can quickly screen poplar varieties with target lignin content.

[0006] The present invention provides a primer set for detecting the lignin content of poplars, including a primer set for detecting the haplotype of the Pto-C3H35 gene of poplars;

[0007] The nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID No.1.

[0008] Preferably, the Pto-C3H35 gene haplotype is determined based on the nucleotides of SNP1, InDel1, InDel2, InDel3 and SNP2;

[0009] The SNP1 is that the nucleotide at position 702 of SEQ ID No.1 is T or G;

[0010] The InDel1 is SEQ ID No. 1, wherein the nucleotide at position 705 is CA or lacks CA;

[0011] The InDel2 is SEQ ID No. 1, wherein the nucleotide at position 706 is TTAGAA or TTAGAA is missing;

[0012] The InDel3 is SEQ ID No. 1, wherein the nucleotide at position 716 is A or lacks A;

[0013] The SNP2 is SEQ ID No. 1, and the nucleotide at position 766 is T or C.

[0014] Preferably, the primer set for detecting the SNP1, InDel1, InDel2 and InDel3 genotypes of the Pto-C3H35 gene includes Pto-C3H35-702-TF, Pto-C3H35-702-GF and Pto-C3H35-702-R, and the nucleotide sequences are shown in SEQ ID No. 2 to SEQ ID No. 4, respectively;

[0015] The primer set for detecting the SNP2 genotype includes Pto-C3H35-766-TF, Pto-C3H35-766-CF and Pto-C3H35-766-R, and the nucleotide sequences are shown in SEQ ID No. 5 to SEQ ID No. 7, respectively.

[0016] The invention provides a kit for detecting the content of lignin in poplars, comprising the above primer set.

[0017] The present invention provides a method for detecting the lignin content of poplars, comprising using poplar genomic DNA as a template, performing PCR amplification using the above primer set or the primer set in the above kit, and evaluating the lignin content of the poplars according to the genotype of the amplified product.

[0018] Preferably, if Pto-C3H35-702-TF and Pto-C3H35-702-R obtain an amplification product when PCR amplification is performed, Pto-C3H35-702-GF and Pto-C3H35-702-R do not obtain an amplification product when PCR amplification is performed, Pto-C3H35-766-TF and Pto-C3H35-766-R obtain an amplification product when PCR amplification is performed, and Pto-C3H35-766-CF and Pto-C3H35-766-R do not obtain an amplification product when PCR amplification is performed, then the genotype combination of the sample is TT-D1D1-I2I2-I3I3-TT;

[0019] If Pto-C3H35-702-TF and Pto-C3H35-702-R obtain an amplification product when PCR amplification is performed, Pto-C3H35-702-GF and Pto-C3H35-702-R do not obtain an amplification product when PCR amplification is performed, Pto-C3H35-766-TF and Pto-C3H35-766-R do not obtain an amplification product when PCR amplification is performed, and Pto-C3H35-766-CF and Pto-C3H35-766-R obtain an amplification product when PCR amplification is performed, then the genotype combination of the sample is TT-D1D1-I2I2-D3D3-CC;

[0020] If no amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-766-TF and Pto-C3H35-766-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-766-CF and Pto-C3H35-766-R are subjected to PCR amplification, then the genotype combination of the sample is GG-I1I1-D2D2-I3I3-TT;

[0021] If an amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-766-TF and Pto-C3H35-766-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-766-CF and Pto-C3H35-766-R are subjected to PCR amplification, then the genotype combination of the sample is TG-D1I1-D2I2-D3I3-TT.

[0022] Preferably, when the genotype combination is GG-I1I1-D2D2-I3I3-TT, the poplar has a low lignin content.

[0023] Preferably, when the genotype combination is TT-D1D1-I2I2-D3D3-CC, the poplar has a high lignin content.

[0024] Preferably, the PCR amplification procedure includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 45 s, 34 cycles; and complete extension at 72°C for 5 min.

[0025] The present invention also provides application of the primer set, the kit or the method in molecular marker-assisted breeding of poplars.

[0026] Beneficial effect: The present invention provides a method for evaluating the haplotype of a Pto-C3H35 gene, and an application of evaluating poplar wood quality based on the method, wherein the nucleotide sequence of the Pto-C3H35 gene is as shown in SEQ ID No.1; the haplotype of the Pto-C3H35 gene is determined according to the nucleotides of SNP1, InDel1, InDel2, InDel3, and SNP2, wherein SNP1 is the nucleotide at the 702nd position of SEQ ID No.1, and the nucleotide is T or G; the nucleotide after the 705th position of InDel1 is CA (i.e., insertion type Insertion1, I1) or CA is missing (i.e., deletion type Deletion1, D1) of SEQ ID No.1, the nucleotide after the 706th position of InDel2 is TTAGAA (i.e., insertion type Insertion2, I2) or TTAGAA is missing (i.e., deletion type Deletion2, D2) of SEQ ID The nucleotide after the 716th position of No.1 is A (i.e., insertion type Insertion3, I3) or deletion A (i.e., deletion type Deletion3, D3), and the SNP2 is the 766th nucleotide of SEQ ID No.1, and the nucleotide is C or T.

[0027] Based on the strategy of genome-wide association analysis of metabolites, the present invention relies on the germplasm resource population of Populus tomentosa, uses the mixed linear model in TASSEL software, takes population structure and kinship as covariates, and detects SNP sites significantly associated with caffeic acid metabolites in the xylem of Populus tomentosa at the genome-wide level. SNP1 (P=5.51×10 -10 ) and SNP2 (P = 5.00 × 10 -8) were significantly associated with caffeic acid content. Gene annotation showed that SNP1 was located in the promoter region of Pto-C3H35 gene. Using the information of all SNPs and InDels in the promoter and internal regions of Pto-C3H35 gene, candidate gene-based association analysis revealed that, in addition to the above two SNPs significantly associated with caffeic acid content, three InDels located in the promoter region of Pto-C3H35 (InDel1: P=5.05×10 -9 ; InDel2: P = 4.50 × 10 -7 ; InDel3: P = 1.35 × 10 -7 ) was also significantly associated with caffeic acid content. Haplotype analysis of the above-mentioned associated loci using LDBlockShow software revealed that SNP1, InDel1, InDel2, InDel3 and SNP2 showed a high degree of linkage relationship (R 2 >0.8), forming a stable haplotype module and generating four genotype combinations (TT-D1D1-I2I2-I3I3-TT, TT-D1D1-I2I2-D3D3-CC, GG-I1I1-D2D2-I3I3-TT, TG-D1I1-D2I2-D3I3-TT). Among them, SNP1 is located at the 702nd position in the promoter region of the Pto-C3H35 gene, and there are three genotypes of TT, TG and GG in the Populus tomentosa germplasm resource population. InDel1 is located after the 705th base in the promoter region of the Pto-C3H35 gene, and there are three genotypes of D1D1, D1I1 and I1I1 in the Populus tomentosa germplasm resource population. InDel2 is located after the 706th base in the promoter region of the Pto-C3H35 gene, and there are three genotypes of I2I2, D2I2 and D2D2 in the Populus tomentosa germplasm resource population. InDel3 is located at the 716th position in the promoter region of the Pto-C3H35 gene, and there are three genotypes of D3D3, D3I3 and I3I3 in the Populus tomentosa germplasm resource population. SNP2 is located at the 766th position in the promoter region of the Pto-C3H35 gene, and there are two genotypes of TT and CC in the Populus tomentosa germplasm resource population. According to the correlation of phenotypic data of 300 Populus tomentosa plants, the caffeic acid content in the xylem of Populus tomentosa was significantly positively correlated with the lignin content (r = 0.63, P = 6.21 × 10 -27 ); Therefore, the caffeic acid content in the xylem of Populus tomentosa can be used as the best indicator for evaluating the lignin content. By determining the phenotypic contribution of the haplotype combinations of the above five loci to the caffeic acid content, it is possible to accurately determine the effects of different haplotype combinations on the lignin content of poplars, and to accurately and efficiently screen superior plants with low lignin content in the early growth stage of poplars, which can be applied to the breeding of new poplar varieties in industrial timber plantations, effectively shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the LD linkage map of the haplotype module of the Pto-C3H35 gene, including two SNPs and three InDels;

[0029] Figure 2 This is a diagram showing the genotype effect of different genotype combinations in the Pto-C3H35 gene haplotype module on caffeic acid content. DETAILED DESCRIPTION

[0030] The present invention provides a primer set and a kit for determining the haplotype of a Pto-C3H35 gene, and an application of the primer set and a kit for evaluating the content of lignin in a poplar. The nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID No.1; the haplotype of the Pto-C3H35 gene is determined according to the nucleotides of SNP1, InDel1, InDel2, InDel3 and SNP2, wherein SNP1 is the nucleotide at the 702nd position of SEQ ID No.1, and the nucleotide is T or G; the nucleotide after the 705th position of InDel1 is CA (i.e., insertion type Insertion1, I1) or CA is missing (i.e., deletion type Deletion1, D1) of SEQ ID No.1, the nucleotide after the 706th position of InDel2 is TTAGAA (i.e., insertion type Insertion2, I2) or TTAGAA is missing (i.e., deletion type Deletion2, D2) of SEQ ID No.1; the nucleotide after the 706th position of InDel3 is SEQ ID The nucleotide after the 716th position of No.1 is A (i.e., insertion type Insertion3, I3) or deletion A (i.e., deletion type Deletion3, D3), and the SNP2 is the 766th nucleotide of SEQ ID No.1, and the nucleotide is C or T.

[0031] The nucleotide sequence shown in SEQ ID No. 1 of the present invention is as follows, wherein the first underlined uppercase base T is the site before SNP1 mutation, the underlined uppercase base CA is the insertion sequence of InDel1, the underlined lowercase base ttagaa is the deletion sequence of InDel2, the underlined lowercase base a is the deletion base of InDel3, and the second underlined uppercase base T is the site before SNP2 mutation:

[0032] aacgtggagatgcgggggatcgaaccccgtgcctctcgcatgcaaagcgagcgctctaccatttgagctacatccccgtaggcaaatggtttccttaacataattaaaaacaataattaaattgccttttgttcttttaaattcaacttagcacaggcgatcaattctagagttcatgctctgtcatccatggctgcaaatataattcaagtcaatgtatggtcatggaaccacaatcttgcctctagctgtataataacatgttcgagttcatgttattcacacgtagtttattcttattattgtcttaattaaagtgagttaagactgataactggacatgtttctca tttaacaattccaaattcaataataaagagatcaaacaaaataatttcctattttcaaaataattttgttttatttttttctttccttcaaactaattttattgatattttaagattattttgatatatcaatatcaaaaataatttttgtaaaaaaatcttatttcaaaacattttataacaaaaaatatattaaaaaaatagttattataacaataccaaataatttattaacttcatcataaaggataggttttttttaaaaaaaataataattaattgtctcctaataaggtggagtcattgaagataaagcaagtgattactcttacaaaaagaccatggttt T ttt CA t ttagaa aaataatttttcaaactttcttgtatttgtttgtcattagaaaagttggttaa T

[0033] The present invention provides a primer set for detecting the content of lignin in poplar, including a primer set for simultaneously detecting SNP1 and InDel (InDel1, InDel2 and InDel3): Pto-C3H35-702-TF, the nucleotide sequence of which is shown in SEQ ID No.2; Pto-C3H35-702-GF, the nucleotide sequence of which is shown in SEQ ID No.3; Pto-C3H35-702-R, the nucleotide sequence of which is shown in SEQ ID No.4;

[0034] The primer set for detecting SNP2: Pto-C3H35-766-TF, the nucleotide sequence is shown in SEQ ID No.5; Pto-C3H35-766-CF, the nucleotide sequence is shown in SEQ ID No.6; Pto-C3H35-766-R, the nucleotide sequence is shown in SEQ ID No.7.

[0035] The genotype of the site to be tested can be accurately determined by four PCRs using the primer set of the present invention, which greatly improves the detection efficiency compared with conventional PCR (site-by-site detection).

[0036] The present invention also provides a kit for detecting the lignin content of poplars, comprising the above primer set. The kit provided by the present invention can accurately and quickly determine the lignin content of poplars.

[0037] The present invention also provides a method for rapidly detecting the lignin content of poplars, by designing primers for the nucleotide sequence of the haplotype module for PCR amplification, and detecting whether the amplified product exists, and the size of the amplified fragment to judge the genotype of the site to be tested, and then judge the lignin content of the poplar. The primer design requirement is that the last base at the 3' end of the forward primer is a functional site corresponding to the SNP, and at the same time, in order to ensure the specificity of the amplified product, the last base at the 3' end of the forward primer is modified with a locked nucleic acid (LNA). The above-mentioned primer set can accurately and quickly determine the genotype of the haplotype related to the lignin content of the poplar, and then judge the lignin content of the poplar by the determined genotype combination, so as to accurately and efficiently screen the superior white poplar plants with low lignin content in the early growth stage of the poplar, and effectively shorten the breeding cycle.

[0038] The present invention has no special requirements for the extraction method of the genomic DNA of the test sample, and the conventional plant genome extraction method in the art can be used. The present invention has no special restrictions on the determination method of the SNP (SNP1) at the 702nd position of the Pto-C3H35 gene promoter, the InDel (InDel1) after the 705th base, the InDel (InDel2) after the 706th base, the InDel (InDel3) after the 716th base, and the 766th SNP (SNP2), and the SNP and InDel genotype detection method well known to those skilled in the art can be used. As an implementable method, the present invention is implemented by a PCR amplification method.

[0039] The genotype of the plant is identified by PCR amplification, and the method for detecting the amplified product is agarose gel electrophoresis or sequencing, preferably agarose gel electrophoresis. In the present invention, the size of the amplified product of Pto-C3H35-702-TF and Pto-C3H35-702-R is between 75bp-84bp (affected by the genotypes of InDel1, InDel2, and InDel3), the size of the amplified product of Pto-C3H35-702-GF and Pto-C3H35-702-R is between 75bp-84bp (affected by the genotypes of InDel1, InDel2, and InDel3), the size of the amplified product of Pto-C3H35-766-TF and Pto-C3H35-766-R is 65bp, and the size of the amplified product of Pto-C3H35-766-CF and Pto-C3H35-766-R is 65bp. If the target band does not exist in the agarose gel electrophoresis results, it means that the corresponding amplification product is not obtained.

[0040] According to the amplification results, the genotype combination of the test sample can be directly determined. Among them, if Pto-C3H35-702-TF and Pto-C3H35-702-R obtain amplification products when PCR amplification is performed, Pto-C3H35-702-GF and Pto-C3H35-702-R do not obtain amplification products when PCR amplification is performed, Pto-C3H35-766-TF and Pto-C3H35-766-R obtain amplification products when PCR amplification is performed, and Pto-C3H35-766-CF and Pto-C3H35-766-R do not obtain amplification products when PCR amplification is performed, then the genotype combination of the sample is TT-D1D1-I2I2-I3I3-TT;

[0041] If Pto-C3H35-702-TF and Pto-C3H35-702-R obtain an amplification product when PCR amplification is performed, Pto-C3H35-702-GF and Pto-C3H35-702-R do not obtain an amplification product when PCR amplification is performed, Pto-C3H35-766-TF and Pto-C3H35-766-R do not obtain an amplification product when PCR amplification is performed, and Pto-C3H35-766-CF and Pto-C3H35-766-R obtain an amplification product when PCR amplification is performed, then the genotype combination of the sample is TT-D1D1-I2I2-D3D3-CC;

[0042] If no amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-766-TF and Pto-C3H35-766-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-766-CF and Pto-C3H35-766-R are subjected to PCR amplification, then the genotype combination of the sample is GG-I1I1-D2D2-I3I3-TT;

[0043] If an amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-766-TF and Pto-C3H35-766-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-766-CF and Pto-C3H35-766-R are subjected to PCR amplification, then the genotype combination of the sample is TG-D1I1-D2I2-D3I3-TT.

[0044] Among the four haplotype combinations provided by the present invention, the poplar wood xylem associated with GG-I1I1-D2D2-I3I3-TT has the lowest caffeic acid content, indicating that the poplar wood xylem has the lowest lignin content; the poplar wood xylem associated with TT-D1D1-I2I2-D3D3-CC has the highest caffeic acid content, indicating that the poplar wood xylem has the highest lignin content. The poplar described in the present invention is preferably Populus tomentosa, and there is no special limitation on the sampling tissue of genomic DNA, but the xylem is preferred.

[0045] The 702nd base (SNP1) and the 766th base (SNP2) of the Pto-C3H35 gene described in the present invention are based on the strategy of whole genome association analysis, relying on the Populus tomentosa germplasm resource population, and using the compressed mixed linear model in the TASSEL software to detect SNP sites significantly associated with the caffeic acid content of Populus tomentosa at the whole genome level. The InDel1, InDel2, and InDel3 are based on all SNP and InDel variations (including the upstream 2kb promoter region) of the Pto-C3H35 gene, and the strategy of candidate gene association analysis is used to detect InDels significantly associated with caffeic acid content. The SNP and InDel sites show a high degree of linkage relationship (R 2 >0.8), forming a stable haplotype module and generating four genotype combinations (TT-D1D1-I2I2-I3I3-TT, TT-D1D1-I2I2-D3D3-CC, GG-I1I1-D2D2-I3I3-TT, TG-D1I1-D2I2-D3I3-TT). The significance threshold of the SNP and InDel associated with caffeic acid content in the present invention is P < 1 × 10 -6 .

[0046] Among them, SNP1 is located at the 702nd position in the promoter region of the Pto-C3H35 gene, and there are three genotypes of TT, TG and GG in the Populus tomentosa germplasm resource population. InDel1 is located after the 705th base in the promoter region of the Pto-C3H35 gene, and there are three genotypes of D1D1, D1I1 and I1I1 in the Populus tomentosa germplasm resource population. InDel2 is located after the 706th base in the promoter region of the Pto-C3H35 gene, and there are three genotypes of I2I2, D2I2 and D2D2 in the Populus tomentosa germplasm resource population. InDel3 is located at the 716th position in the promoter region of the Pto-C3H35 gene, and there are three genotypes of D3D3, D3I3 and I3I3 in the Populus tomentosa germplasm resource population. SNP2 is located at the 766th position in the promoter region of the Pto-C3H35 gene, and there are two genotypes of TT and CC in the Populus tomentosa germplasm resource population. By measuring the genotype combination of the above five loci, the lignin content of poplars can be accurately determined, and superior plants with low lignin content can be accurately and efficiently screened in the early growth stage of poplars. This can be applied to the breeding of new varieties of poplars for industrial use, effectively shortening the breeding cycle.

[0047] After determining the genotype combination of the SNP and InDel sites, the present invention judges the lignin content of the poplar according to the genotype combination of the sites: when the genotype of SNP1 is GG, the genotype of InDel1 is I1I1, the genotype of InDel2 is D2D2, the genotype of InDel3 is I3I3, and the genotype of SNP2 is TT, that is, when the genotype combination of the haplotype is GG-I1I1-D2D2-I3I3-TT, the lignin content of the xylem of the poplar sample is the lowest; when the genotype of SNP1 is TT, the genotype of InDel1 is D1D1, the genotype of InDel2 is I2I2, the genotype of InDel3 is D3D3, and the genotype of SNP2 is CC, that is, when the genotype combination of the haplotype is TT-D1D1-I2I2-D3D3-CC, the lignin content of the xylem of the poplar sample is the highest.

[0048] The present invention also provides an application of the application or the primer set or the kit in poplar breeding. The present invention can quickly and accurately determine the genotype of the SNP and InDel of the poplar sample to be tested, and then judge the lignin content of the poplar by the determined genotype combination, so as to accurately and efficiently screen the superior white poplar plants with low lignin content in the early growth stage of the poplar, and effectively shorten the breeding cycle. By detecting the genotype of the SNP and InDel sites, the present invention can screen the poplar samples with the genotype combination of GG-I1I1-D2D2-I3I3-TT for subsequent breeding operations in order to obtain poplar varieties with low lignin content.

[0049] All primers of the present invention are synthesized by relevant biological companies, and unless otherwise specified, the chemical reagents used are conventional commercial reagents, and the technical means used are conventional technical means well known to those skilled in the art.

[0050] In order to further illustrate the present invention, the application of a Pto-C3H35 gene haplotype provided by the present invention in evaluating the lignin content of poplar is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1

[0052] 1. Primer set for detecting haplotype of Pto-C3H35 gene

[0053] The primer set includes: a primer set for identifying the genotype of the 172nd base (SNP1) of the nucleotide sequence shown in SEQ ID No. 1, an InDel sequence after the 705th base (InDel1), an InDel sequence after the 706th base (InDel2), and an InDel sequence after the 716th base (InDel3): Pto-C3H35-702-TF and Pto-C3H35-702-R, the amplification product is between 75bp-84bp, Pto-C3H35-702-GF and Pto-C3H35-702-R, the amplification product is between 75bp-84bp; a primer set for identifying SEQ ID No. The primer set for the genotype of the 766th base (SNP2) of the nucleotide sequence shown in No.1 is: Pto-C3H35-766-TF and Pto-C3H35-766-R, the amplification product is 65bp, Pto-C3H35-766-CF and Pto-C3H35-766-R, the amplification product is 65bp; the specific nucleotide sequences of the primer set are shown in SEQ ID No.2 to SEQ ID No.7.

[0054] 2. Using the above primer set, identify the genotypes of the SNPs and InDels of 30 individuals in the hybrid population of Populus tomentosa, and then determine the lignin content of the samples, the steps are as follows:

[0055] 1) 30 individuals were randomly selected from the hybrid population of Populus tomentosa planted in Guanxian County, Shandong Province. After removing the bark, two xylem samples of about 300 mg were scraped with a file and immediately frozen in liquid nitrogen. One sample was sent to a biological company for targeted metabolomics analysis to detect the content of caffeic acid metabolites. At the same time, the other sample was used to determine the lignin content using the Klason method. The test results are shown in Table 1;

[0056] 2) Collect the corresponding poplar leaves and immediately freeze them in liquid nitrogen (-196°C);

[0057] 3) The genomic DNA of leaf samples was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme China, Nanjing, China);

[0058] 4) Using the locked nucleic acid modification method, the 702nd base, the InDel after the 705th base, the InDel after the 706th base, the InDel after the 716th base, and the 766th base in the promoter region of the Pto-C3H35 gene in the genomic DNA of the Populus tomentosa leaf sample are determined. PCR amplification is performed using the primer set described in Example 1 and the genomic DNA obtained in step 3) as a template;

[0059] PCR amplification was performed using 2× PhantaMax MasterMix (Dye Plus) (Vazyme China, Nanjing, China), and the reaction system and procedure were set according to the instructions. The reaction system was as follows: 2× Phanta Max Master Mix (Dye Plus) 25 μL, ddH O 19 μL, genomic DNA template 2 μL, and 2 μL each of upstream and downstream primers;

[0060] The amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 45 s, 34 cycles; and complete extension at 72°C for 5 min.

[0061] After PCR amplification, agarose gel electrophoresis was used to detect the amplified product and the result was judged.

[0062] The genotypes of the SNPs and InDels of the candidate samples and the corresponding caffeic acid and lignin contents are shown in Table 1.

[0063] Table 1 Genotypes and caffeic acid content of five predetermined loci of Populus tomentosa individuals to be tested

[0064]

[0065] According to the results in Table 1, the relative content of caffeic acid in the 30 strains was 2021014.7175±747927.9977, the content of lignin was 0.2340±0.05516%, and the phenotypic correlation coefficient was r=0.97 (P=2.7×10 -19). When the genotype combination of base 702, InDel after base 705, InDel after base 706, InDel after base 716, and base 766 in the promoter region of Pto-C3H35 was GG-I1I1-D2D2-I3I3-TT, the caffeic acid and lignin contents of the candidate poplar individuals were the lowest, as reflected in that the caffeic acid content of the candidate individuals (783292.7220±103465.7606) was 61.24% lower than the overall caffeic acid content (2021014.7175±747927.9977), and the lignin content (0.1390±0.006919%) was 40.58% lower than the overall lignin content (0.2340±0.05516%). When the genotype combination of base 702, InDel after base 705, InDel after base 706, InDel after base 716 and base 766 in the Pto-C3H35 promoter region is TT-D1D1-I2I2-D3D3-CC, the caffeic acid and lignin contents of the candidate poplar individuals are the highest, as reflected in the fact that the caffeic acid content of the candidate individuals (2912154.0624±179786.0762) is 44.09% higher than the overall caffeic acid content (2021014.7175±747927.9977), and the lignin content (0.2979±0.009008%) is 27.30% higher than the overall lignin content (0.2340±0.05516%).

[0066] It can be seen that the present invention can accurately and quickly determine the haplotype that is significantly correlated with the lignin content of poplars, and then judge the lignin content of poplars through the determined genotype combination, so as to accurately and efficiently screen superior plants with low lignin content in the early growth stage of poplars, and effectively shorten the breeding cycle of poplar varieties with excellent wood quality.

[0067] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer set for detecting the content of lignin in poplar, characterized in that: Includes a primer set for detecting the haplotype of the Pto-C3H35 gene in poplar; The nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID No.

1.

2. The primer set according to claim 1, characterized in that: The Pto-C3H35 gene haplotype is determined based on the nucleotides of SNP1, InDel1, InDel2, InDel3 and SNP2; The SNP1 is that the nucleotide at position 702 of SEQ ID No.1 is T or G; The InDel1 is SEQ ID No. 1, wherein the nucleotide at position 705 is CA or lacks CA; The InDel2 is SEQ ID No. 1, wherein the nucleotide at position 706 is TTAGAA or TTAGAA is missing; The InDel3 is SEQ ID No. 1, wherein the nucleotide at position 716 is A or lacks A; The SNP2 is SEQ ID No. 1, and the nucleotide at position 766 is T or C.

3. The primer set according to claim 2, characterized in that: The primer sets for detecting the SNP1, InDel1, InDel2 and InDel3 genotypes of the Pto-C3H35 gene include Pto-C3H35-702-TF, Pto-C3H35-702-GF and Pto-C3H35-702-R, and the nucleotide sequences are shown in SEQ ID No. 2 to SEQ ID No. 4, respectively; The primer set for detecting the SNP2 genotype includes Pto-C3H35-766-TF, Pto-C3H35-766-CF and Pto-C3H35-766-R, and the nucleotide sequences are shown in SEQ ID No. 5 to SEQ ID No. 7, respectively.

4. A kit for detecting the content of lignin in poplar, characterized in that: The invention comprises the primer set according to any one of claims 1 to 3.

5. A method for detecting the content of lignin in poplar, characterized in that: The method comprises using poplar genomic DNA as a template, performing PCR amplification using the primer set described in any one of claims 1 to 3 or the primer set in the kit described in claim 4, and evaluating the lignin content of the poplar according to the genotype of the amplified product.

6. The method according to claim 5, characterized in that: If Pto-C3H35-702-TF and Pto-C3H35-702-R obtain an amplification product when PCR amplification is performed, Pto-C3H35-702-GF and Pto-C3H35-702-R do not obtain an amplification product when PCR amplification is performed, Pto-C3H35-766-TF and Pto-C3H35-766-R obtain an amplification product when PCR amplification is performed, and Pto-C3H35-766-CF and Pto-C3H35-766-R do not obtain an amplification product when PCR amplification is performed, then the genotype combination of the sample is TT-D1D1-I2I2-I3I3-TT; If Pto-C3H35-702-TF and Pto-C3H35-702-R obtain an amplification product when PCR amplification is performed, Pto-C3H35-702-GF and Pto-C3H35-702-R do not obtain an amplification product when PCR amplification is performed, Pto-C3H35-766-TF and Pto-C3H35-766-R do not obtain an amplification product when PCR amplification is performed, and Pto-C3H35-766-CF and Pto-C3H35-766-R obtain an amplification product when PCR amplification is performed, then the genotype combination of the sample is TT-D1D1-I2I2-D3D3-CC; If no amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-766-TF and Pto-C3H35-766-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-766-CF and Pto-C3H35-766-R are subjected to PCR amplification, then the genotype combination of the sample is GG-I1I1-D2D2-I3I3-TT; If an amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-766-TF and Pto-C3H35-766-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-766-CF and Pto-C3H35-766-R are subjected to PCR amplification, then the genotype combination of the sample is TG-D1I1-D2I2-D3I3-TT.

7. The method according to claim 6, characterized in that: When the genotype combination was GG-I1I1-D2D2-I3I3-TT, the lignin content of poplar was low.

8. The method according to claim 6, characterized in that: When the genotype combination was TT-D1D1-I2I2-D3D3-CC, the lignin content of poplar was high.

9. The method according to claim 5, characterized in that: The PCR amplification procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 45 seconds, 34 cycles; and complete extension at 72°C for 5 minutes.

10. Use of the primer set according to any one of claims 1 to 3, the kit according to claim 4, or the method according to any one of claims 5 to 9 in molecular marker-assisted breeding of poplar.

Images