Specific molecular marker for identifying Saet CMS cytoplasmic sterile line of eggplant and application of specific molecular marker

Abstract

The invention discloses a specific molecular marker for identifying an eggplant Saet CMS cytoplasmic sterile line and application of the specific molecular marker. The molecular marker Saet218b is selected from eggplant Saet CMS cytoplasmic male sterile line and maintainer line mitochondrial genomes to be compared, a Saet CMS sterile candidate specific gene orf218b is obtained through bioinformatics analysis and screening, the nucleotide sequence of the Saet CMS sterile candidate specific gene orf218b is shown as SEQ ID NO: 1, and the molecular marker Saet218b for identifying the eggplant Saet CMS cytoplasmic male sterile line is successfully designed according to the sequence information. The molecular marker provided by the invention can be used for identifying the eggplant Saet CMS cytoplasmic male sterility line, the efficiency is high, the procedure is simple and convenient, the result can be used for molecular marker-assisted breeding of the eggplant Saet source cytoplasmic male sterility line, the breeding efficiency is improved, and meanwhile, a technical support and a theoretical basis are provided for identification of eggplant specific cytoplasmic germplasm.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to a specific molecular marker for identifying eggplant Saet CMS cytoplasmic sterile line and an application thereof. Background Art

[0002] Eggplant is an important vegetable crop that is currently widely planted around the world. It is a cross-pollinating plant with obvious hybrid vigor. Cytoplasmic male sterility, as one of the main ways to utilize hybrid vigor, has been widely used in the production of Solanaceae vegetables. In the eggplant breeding process, the use of cytoplasmic male sterility for seed production can not only reduce breeding costs and improve breeding efficiency, but also effectively ensure seed purity, so it is highly valued by breeders. Most of the reported eggplant cytoplasmic male sterile materials are obtained through interspecific hybridization or somatic hybridization, mainly including anther non-dehiscent types and pollen-free types.

[0003] The identification of CMS from different cytoplasm sources of eggplant is mainly based on morphological or cytological characteristics, but there are problems such as failure to identify early and inaccurate characterization. The use of specific molecular markers to identify cytoplasmic male sterile lines can effectively overcome the above problems. It has the advantages of accuracy, rapidity, and stability and can be widely used in the identification of sterile types. At present, with the development of mitochondrial sequencing technology, mitochondrial genome sequence information is used to screen cytoplasmic male sterile candidate genes and develop related markers, which can not only be used to distinguish eggplant sterile cytoplasm type analysis and guide the breeding of cytoplasmic male sterile lines and maintenance lines, but also provide the possibility of using molecular marker-assisted technology to efficiently and stably identify Saet CMS sterile lines. Summary of the invention

[0004] The present invention provides a molecular marker for eggplant Saet CMS cytoplasmic male sterile line and its application. By comparing the mitochondrial genome sequence information of eggplant Saet-source cytoplasmic male sterile line and maintainer line, Saet-source CMS candidate genes are screened, markers are designed according to the sequence characteristics of the candidate genes, and eggplant cytoplasmic male sterile lines of different genetic backgrounds and types are tested to verify the validity of the marker. Through the development of the cytoplasmic male sterile marker, eggplant Saet CMS can be quickly identified, the identification workload is greatly reduced, and the work efficiency is improved.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] According to the mitochondrial genome information of the Saet CMS cytoplasmic sterile line and maintainer line and sterile source that have been sequenced, ORF-Finder, BLASTN, BLASTX and other software were used to screen the unique ORFs with amino acid numbers greater than 100 in the mitochondrial genome of the Saet CMS sterile line, and the transmembrane domain, co-transcription and mosaicism, position structure and other analyses of these specific ORFs were carried out according to the relevant characteristics of the known cytoplasmic male sterile genes of other crops. Finally, one ORF was screened as a candidate gene of SaetCMS, named orf218b, and its nucleotide sequence is shown in SEQ ID NO.1. Based on the orf218b sequence information, specific primers were designed using Primer Premier 5.0 software, and amplification was performed in sterile lines and maintainers of different cytoplasmic types and different sources. It was found that only a 553bp band was specifically amplified in the Saet CMS sterile line, while no band was amplified in the corresponding maintainer line and other types of sterile lines. The marker was named Saet218b

[0007] The molecular marker Saet218b primers are characterized in that the upstream primer 1 is shown in SEQ ID NO: 2, and the downstream primer 2 is shown in SEQ ID NO: 3.

[0008] The molecular markers and specific primers for identifying the eggplant Saet CMS cytoplasmic male sterile line are used in identifying the eggplant cytoplasmic male sterile line.

[0009] In specific application, the identification method includes the following steps:

[0010] 1. Extract genomic DNA from the eggplant sample to be tested;

[0011] 2. Perform PCR amplification on the extracted DNA using the Saet218b molecular marker to obtain an amplified product.

[0012] 3. The amplified product was detected by agarose gel electrophoresis. When a specific band of 900 bp was amplified using the Saet218b marker, the sample to be tested was the eggplant Saet CMS cytoplasmic male sterile line.

[0013] The present invention has the following beneficial effects:

[0014] 1. The eggplant Saet CMS cytoplasmic sterility specific molecular marker developed by the present invention is a new marker developed based on the comparison of the sequenced eggplant mitochondrial genome and the mitochondrial genome of the Saet-derived sterile line. The results show that the marker has the advantages of high efficiency and stability.

[0015] 2. The specific molecular marker provided by the present invention can be effectively used for eggplant cytoplasm type identification, eggplant cytoplasm male sterile line and maintainer line breeding, sterile line screening, thereby improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 PCR amplification with Saet CMS specific primers

[0017] Figure 2 PCR Amplification of Different Cytoplasmic Male Sterility Lines Using Saet CMS Specific Primers DETAILED DESCRIPTION

[0018] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments. The methods used in the following embodiments are conventional methods unless otherwise specified. The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings.

[0019] Example 1 Development and verification of specific molecular markers for eggplant Saet CMS cytoplasmic sterility:

[0020] 1.1 First, the sequenced Saet CMS cytoplasmic sterile line EP28A mitochondrial genome sequence (GenBank: OR187866), the maintainer line EP28 mitochondrial genome sequence (GenBank: OR187865), and the sterile source mitochondrial genome sequence (GenBank: OR187867) were extracted from the NCBI database, and these mitochondrial genome sequences were compared and analyzed using ORFFinder and BLAST software to obtain the ORFs specific to the Saet source cytoplasmic sterile line. According to the sequence characteristics of known sterility-related genes in other crops, the obtained specific ORFs were analyzed for transmembrane domains, co-transcription, chimeric genes, and repeated sequences, and orf218b was finally determined as a candidate gene for Saet CMS. This orf is only unique to the sterile line EP28A, but missing in the maintainer line, and has two transmembrane domains and is located 243bp upstream of the known gene atp1. According to the sequence information of orf218b, a pair of specific primers Saet218b-F / R were designed using Primer Premier 5.0. The nucleotide sequence of the primers is 5′→3′, the sequence of Saet218b-F is TTTTGTTTGTCTGGGACTCG (as shown in SEQ ID No.2), and the sequence of Saet218b-R is CCGTAAGGACTTTCTCAATG (as shown in SEQ ID No.3)

[0021] 1.2 The total DNA of the selected materials was extracted using the CTAB method. Then, the designed primers were used to perform PCR amplification verification on the known cytoplasmic sterile lines and maintenance line materials. PCR amplification procedure: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30S, 58℃ annealing for 30S, 72℃ extension for 30s, 35cycles; 72℃ extension for 7min. After the amplification was completed, the amplified product was detected by 1.2% agarose gel electrophoresis. The results are as follows: Figure 1 The PCR amplification results showed that when the Saet sterile line, maintainer line and inbred line DNA were amplified using the primers of molecular marker Saet218b (Saet218b-L and Saet218b-R), only the eggplant sterile line containing Saet CMS specific cytoplasm could amplify the target band, while the other materials did not amplify the target band.

[0022] Example 2 Application of Saet218b molecular marker in identifying eggplant cytoplasmic male sterility types.

[0023] 1. Using the three known eggplant cytoplasmic male sterile types EP28A (Saet CMS), EP50A (Sang CMS), EP52A (Skur CMS) sterile lines and corresponding maintainer lines as materials, the CTAB method was used to extract leaf genomic DNA of all materials.

[0024] 2. Using the extracted leaf genomic DNA as a template, PCR amplification was performed using the molecular marker Saet218b. The PCR reaction system (20uL) was as follows: 2μL template DNA (50ng / μL), 0.5μL each of forward and reverse primers (10ng / μL), 10μL Taq Plus MasterMix II, and 7μL sterile water. The PCR amplification program was: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30S, 58℃ annealing for 30S, 72℃ extension for 30s, 35cycles; 72℃ extension for 7min. 1.2% agarose gel electrophoresis was used for detection. The test results are shown in Figure 2 (From left to right in the figure: M: DNA marker (DL2000); EP28A (Saet CMS); EP50A (Sang CMS); EP52A (Skur CMS); EP28; EP50; EP52. Figure 2 It can be seen that only the Saet CMS sterile line EP28A can amplify the corresponding band, and the size is consistent with the target band, while the band is not amplified in the other two cytoplasmic male sterile lines, further verifying that the Saet218b molecular marker is specific in identifying eggplant Saet cytoplasmic sterility.

[0025] The above description is only a specific implementation example of the patent of the present invention, but any changes or modifications made with reference to the patent application of the present invention are included in the patent scope of the present invention.

Claims

1. A specific molecular marker for identifying eggplant Saet CMS cytoplasmic sterile line and its application, characterized in that: The molecular marker is selected from the eggplant mitochondrial gene orf218b, and its nucleotide sequence is shown in SEQ NO: 1 in the sequence table.

2. The molecular marker for identifying eggplant Seat CMS cytoplasmic male sterile line according to claim 1, characterized in that: The specific primers of the molecular marker Seat218b are Seat218b-F / R, and the nucleotide sequences thereof are as follows: the upstream primer Seat218b-F is shown in SEQ NO:2, and the downstream primer Seat218b-R is shown in SEQ NO:

3.

3. The molecular marker for identifying eggplant Seat CMS cytoplasmic male sterile line according to claim 1 or 2 is used to identify eggplant Seat Application of CMS cytoplasmic male sterile line.

4. The application according to claim 3, characterized in that: When applied specifically, the following steps are included: (1) extracting genomic DNA from leaves of the eggplant to be tested; (2) Using leaf genomic DNA as a template, amplification was performed using the specific primers Seat218b-F / R described in claim 2, and the amplified product was detected by 1.2% agarose gel electrophoresis. If a specific band of 553 bp was amplified, the eggplant tested was Seat CMS cytoplasmic male sterile line.

Images