SNP (Single Nucleotide Polymorphism) molecular marker related to wheat grain protein content and application

Abstract

The invention relates to the technical field of genetic engineering, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to the protein content of wheat grains and application. The SNP molecular marker contains a nucleotide sequence of which the polymorphism is T or C at the 167440648 bp position of a wheat 7B chromosome. According to the present invention, the research determines that the site is the SNP site closely related to the protein content, and the specific KASP primer combination designed based on the SNP site can rapidly and accurately identify the wheat protein content. According to the technical scheme provided by the invention, the selection efficiency can be improved, the breeding period can be shortened, and wheat varieties with ideal protein content can be quickly identified and cultivated. The KASP primer combination provided by the invention provides an effective tool for molecular marker-assisted selection of wheat nutritional quality related traits.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a SNP molecular marker related to the protein content of wheat grains and an application thereof. Background Art

[0002] As people's concept of healthy diet improves, breeders' breeding goals have also shifted from increasing yields to improving healthy varieties, among which grain protein content is a key indicator of wheat nutrition. KASP (Kompetitive AlleleSpecific PCR) technology is a molecular marker method based on SNP sites, which is highly favored in genotyping due to its high stability, accuracy and economy. The application of KASP technology not only improves the speed and efficiency of genotyping, but also reduces costs, making it have broad application prospects in agricultural breeding, genetic research, molecular diagnosis and other fields. At present, SNP markers related to wheat protein content need to be further developed. In view of this, the present invention is specially proposed. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a SNP molecular marker related to plant protein content and a KASP primer combination and application thereof.

[0004] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a SNP molecular marker associated with plant protein content, wherein the SNP molecular marker contains a nucleotide sequence of T or C at 167440648 bp of wheat chromosome 7B.

[0005] Preferably, plants with a genotype of TT at the polymorphic site have a higher protein content than plants with a genotype of CC.

[0006] In a second aspect, the present invention provides a KASP primer combination, which is used to amplify the SNP molecular marker, and includes a forward primer 1, a forward primer 2 and a reverse primer; the nucleotide sequence of the forward primer 1 includes the nucleotide fragment shown in SEQ ID NO.01; the nucleotide sequence of the forward primer 2 includes the nucleotide fragment shown in SEQ ID NO.02; the nucleotide sequence of the reverse primer includes the nucleotide fragment shown in SEQ ID NO.03.

[0007] In a third aspect, the present invention provides a detection reagent or a kit for detecting plant protein content, wherein the kit comprises the KASP primer combination.

[0008] In a fourth aspect, the present invention provides a method for identifying high protein content in plants, comprising: using the DNA of the plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the protein content of the plant sample to be tested based on the amplification result.

[0009] Preferably, judging the protein content of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site located at 167440648 bp of wheat chromosome 7B in the amplified product, and the plant with genotype TT has a higher protein content than the plant with genotype CC.

[0010] Preferably, the plant is wheat.

[0011] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water; the primer mixture, based on 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 10-14 μL, and the remainder is water.

[0012] Preferably, the reaction program used for PCR amplification is: 95°C 8-12 min; 95°C 15-25 s, 61°C 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25 s, 55°C 35-45 s, 32-36 cycles; 25°C 10-20 min.

[0013] In a fifth aspect, the present invention provides any of the following applications of the SNP molecular marker, the KASP primer combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat protein content; (2) Used for early prediction of wheat quality traits; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants Beneficial effects: The present invention provides a SNP molecular marker related to plant protein content and its application, wherein the SNP molecular marker contains a nucleotide sequence whose polymorphism is T or C at 167440648 bp of wheat chromosome 7B. The present invention studies and determines that the site is a SNP site closely related to protein content, and the specific KASP primer combination designed based on the SNP site can realize rapid and accurate identification of wheat protein content. The technical solution provided by the present invention can not only improve the selection efficiency, but also shorten the breeding cycle, and help to quickly identify and cultivate wheat varieties with ideal protein content. The KASP primer combination provided by the present invention provides an effective tool for molecular marker-assisted selection of wheat nutritional quality-related traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0015] Figure 1 This is a SNP site map of the exons of the TraesCS7B03G0350300 gene obtained by analyzing the exon capture sequencing technology provided in Example 1 of the present invention.

[0016] Figure 2 This is a statistical graph of protein content of different genotypes at locus 167440648 of chromosome 7B provided in Example 2 of the present invention.

[0017] Figure 3 It is the typing result of the wheat genotype at the 167440648 site of chromosome 7B provided in Example 2 of the present invention; wherein CC represents 167440648-C, and TT represents 167440648-T.

[0018] Figure 4 It is the sequencing peak diagram of different genotypes of the 167440648 site of chromosome 7B provided in Example 2 of the present invention. The gene is in the forward direction in the genome, and the sequencing result is forward sequencing. DETAILED DESCRIPTION

[0019] The present invention provides a SNP marker related to plant protein content and its application, wherein the SNP site is located at 167440648 bp of wheat chromosome 7B, the reference genome is IWGSC V2.1, and the polymorphism is C / T. Through haplotype analysis, it is determined that the site is a SNP site closely related to protein content, and a specific KASP primer combination is designed to achieve rapid and accurate identification of wheat protein content. The technology provided by the present invention is of significant significance for improving wheat quality: it can not only improve selection efficiency, but also shorten the breeding cycle, and help to quickly identify and cultivate wheat varieties with ideal protein content. The KASP primer combination provided by the present invention provides an effective tool for molecular marker-assisted selection of wheat nutritional quality-related traits, which can increase the protein content of crops.

[0020] Firstly, the present invention provides a SNP molecular marker associated with plant protein content, wherein the marker contains a nucleotide sequence with a polymorphism of C / T at 167440648 bp of wheat chromosome 7B.

[0021] Furthermore, the plant with the genotype of the polymorphic site contained in the marker being TT has a higher protein content than the plant with the genotype being CC.

[0022] Further, the present invention provides a KASP primer combination for amplifying the marker, comprising forward primer 1 (TGACCTCGTCATCAGCGC) as shown in SEQ ID NO: 1, forward primer 2 (TGACCTCGTCATCAGCGT) as shown in SEQ ID NO: 2, and reverse primer (GCTCAAGAGTGCTGGGATCC) as shown in SEQ ID NO: 3.

[0023] Furthermore, the 5′ ends of the forward primer 1 and the forward primer 2 in the KASP primer combination may also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO: 8) or HEX (GAAGGTCGGAGTCAACGGATT, SEQ ID NO: 9).

[0024] In a specific embodiment of the present invention, the KASP primer combination is as follows: 167440648 F1 (SEQ ID NO:4): 5' GAAGGTGACCAAGTTCATGCTTGACCTCGTCATCAGCGC 3'.

[0025] 167440648 F2 (SEQ ID NO:5): 5' GAAGGTCGGAGTCAACGGATTGACCTCGTCATCAGCGT 3'.

[0026] 167440648 R (SEQ ID NO:3): 5' GCTCAAGAGTGCTGGGATCC 3'.

[0027] The present invention further provides a detection reagent or a kit containing the primer combination.

[0028] The present invention also provides a method for identifying the protein content (high, low, size) of plants, comprising: using the DNA of the plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the protein content of the plant sample to be tested according to the amplification result.

[0029] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water.

[0030] The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

[0031] Preferably, the reaction program used for PCR amplification is: 95°C 8-12 min; 95°C 15-25 s, 61°C 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25 s, 55°C 35-45 s, 32-36 cycles; 25°C 10-20 min.

[0032] Furthermore, the present invention determines the protein content of the plant sample to be tested according to the amplification result, and the judgment criteria include: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with genotype TT has a higher protein content than the plant with genotype CC.

[0033] Furthermore, the plant is wheat.

[0034] The present invention also provides any of the following applications of the marker, the marker combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat protein content; (2) Used for early prediction of wheat protein content traits; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

[0035] The present invention successfully identified a SNP site that is closely related to plant protein content through phenotypic difference analysis and exon capture sequencing technology. The polymorphism detection of this site can accurately and quickly evaluate the protein content characteristics of plants. Using KASP technology, the SNP site and corresponding primer combination provided by the present invention not only improve the efficiency of plant variety selection, but also help shorten the breeding cycle and accelerate the cultivation of high-quality plant varieties. These markers have good genetic stability and high resolution, are suitable for high-throughput detection, and have significant application value in the field of plant breeding.

[0036] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0038] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "specific implementations", or "some specific implementations" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0039] In the examples provided in this specification, if no specific techniques or conditions are specified, the techniques or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0040] The wheat varieties (lines) involved in the following examples were all provided by Zhang Xueyong, a researcher at the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The wheat was sown in Xinxiang, Henan Province, harvested after physiological maturity, dried naturally and used for subsequent analysis. It should be noted that as a professional agricultural research institution, the applicant has long-term preservation of relevant germplasm materials, and the relevant wheat varieties are publicly available in the market or existing germplasm banks.

[0041] Example 1 This example illustrates the process of obtaining SNP markers related to plant protein content and the design of KASP primers.

[0042] 1. 182 exon capture sequencing.

[0043] The whole exome sequencing workflow includes the following steps: 1) Sample testing: Before DNA sequencing, the quality and quantity of sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration must be no less than 20 ng / ul and the total amount must be no less than 800 ng to ensure the accuracy and repeatability of sequencing.

[0044] 2) Library construction: Use Covaris fragmentor to randomly break genomic DNA into 180-280 bp fragments. Then, use Agilent Sure Select kit to complete DNA end repair, phosphorylation, and poly A tailing. Liquid phase hybridization is used to enrich the exon region, and biotin-labeled probes are used for specific hybridization with libraries with specific indexes, followed by PCR amplification. Finally, the amplified library is quality tested to ensure that the quality of the library meets the standards before sequencing.

[0045] 3) Library inspection: After the library is constructed, Qubit 2.0 is used for preliminary quantification. Then, the Agilent 2100 bioanalyzer detects the inserted fragments to ensure that the size is appropriate. After passing the test, the effective concentration of the library is accurately quantified to 3nmol / L by Q-PCR to ensure the quality and accuracy of the sequencing library.

[0046] 4) Sequencing: After the library is qualified, PE150 sequencing is performed using the Illumina HiSeq platform according to the effective concentration of the library and data requirements. PE150 is double-end sequencing, with 150 bp reads at each end. High-throughput sequencing is performed using the insert fragments of the small fragment library to facilitate subsequent sequence comparison and analysis, and improve the accuracy and reliability of the data.

[0047] 2. Obtaining protein content of different wheat varieties and developing SNP molecular markers In order to screen for key genes affecting wheat protein content, protein content was measured in 182 wheat varieties in 2022 and 2023 to assess their phenotypic variation. This basic data collection work is the first step to understand the genetic background of protein content. The results are shown in Table 1, laying the foundation for further genetic analysis and breeding research.

[0048] Based on the protein content phenotypic data of 182 samples obtained in two years in step 2, combined with the results of exon capture sequencing analysis, the contribution of SNP sites of important genes to protein content was explored. A SNP site was found in the exon of the TraesCS7B03G0350300 gene on chromosome 7B of the wheat genome. The protein content of the SNP variant at this site increased significantly, and a significant site affecting wheat protein content was identified (7B: 167440648 bp) (part of the results are shown in Figure 1 ), and the site was named: 167440648. It should be noted that the gene is in the forward direction in the genome, and the designed sequencing and KASP primers are all forward sequences.

[0049] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed. The specific design is as follows: 167440648-F1 (SEQ ID NO:4): 5'-GAAGGTGACCAAGTTCATGCTTGACCTCGTCATCAGCGC-3'.

[0050] 167440648-F2 (SEQ ID NO:5): 5'-GAAGGTCGGAGTCAACGGATTGACCTCGTCATCAGCGT -3'.

[0051] 167440648-R (SEQ ID NO:3): 5'-GCTCAAGAGTGCTGGGATCC-3'.

[0052] When 167440648-F1 and 167440648-R are used as a primer pair combination, they are used to amplify the sequence with base C at position 167440648 of chromosome 7B in the wheat molecular marker.

[0053] When 167440648-F2 and 167440648-R are used as a primer pair combination, they are used to amplify the sequence with base T at position 167440648 of chromosome 7B in the wheat molecular marker.

[0054] Example 2 This example provides the application of the above SNP markers in identifying the protein content of wheat.

[0055] 1. Based on the primer pair design of Example 1, the present invention detected the genotypes of 182 wheat materials (29 CC / 29 TT) and identified the correlation between genotype and protein content phenotype. The specific process is as follows.

[0056] First, genomic DNA of each wheat variety was extracted.

[0057] Then, according to the primers designed in Example 1, the above extracted DNA was used as a template to perform PCR (using Quant Studio 1 fluorescent quantitative PCR instrument) detection and analysis on different wheat samples.

[0058] During specific PCR amplification, the 10 μL amplification system was designed as follows: KASP Mix (2×), 5 μL; HiGeno 2x Probe Mix (provided at 2x concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2 and reference dye ROX; Primer Mix, 0.14 μL; DNA, 30 ng; ddH2O, supplemented to 10 μL. Among them, the Primer Mix, in each 100 μL: 167440648-F1, 100 μM, 12 μL; 167440648-F2, 100 μM, 12 μL; 167440648-R, 100 μM, 30 μL; ddH2O, 46 μL.

[0059] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, decreasing by 0.6℃ each cycle); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0060] 2. Use the genomic DNA of each wheat variety extracted in step 1 to perform conventional PCR and sequencing to verify the accuracy of KASP genotyping.

[0061] First, specific primers were designed for amplification at 167440648 bp of wheat chromosome 7B (the reference sequence was Chinese spring wheat). The primer sequences were: F (SEQ ID NO:6): 5'GCATTGGCATGAAGGTGTCGTG 3'.

[0062] R (SEQ ID NO:7): 5'CTTCCCATCACTAAGTAGGCTATTG 3'.

[0063] Six CC / TT genotype wheat varieties with KASP genotyping results were randomly selected, amplified using a common PCR instrument, and sequenced after electrophoresis detection to verify the reliability of the genotyping results.

[0064] During specific PCR amplification, the 25 μL amplification system was designed as follows: Full-format JinBio 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; primers WAF / WAR, 1 μL each; primer concentration is 10 μM; DNA, 60 ng; ddH2O, supplemented to 25 μL.

[0065] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 94℃ for 5 min; 94℃ for 30 s, 90℃ for 30 s, 72℃ for 40 s (35 cycles); 72℃ for 10 min; end at 16℃.

[0066] The statistical results of specific genotypes and wheat protein content are shown in Tables 1 and Figure 1-4 shown.

[0067] Table 1 Corresponding results of different wheat genotypes and their protein content .

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP molecular marker associated with plant protein content, characterized in that: The SNP molecular marker contains a nucleotide sequence of T or C at the 167440648 bp position of wheat chromosome 7B.

2. The SNP molecular marker according to claim 1, characterized in that: Plants with genotype TT at the polymorphic site had higher protein content than those with genotype CC.

3. KASP primer combination, characterized in that, The KASP primer combination is used to amplify the SNP molecular marker according to claim 1, and comprises forward primer 1, forward primer 2 and reverse primer; The nucleotide sequence of forward primer 1 includes the nucleotide fragment shown in SEQ ID NO.01; The nucleotide sequence of forward primer 2 includes the nucleotide fragment shown in SEQ ID NO.02; The nucleotide sequence of the reverse primer includes the nucleotide fragment shown in SEQ ID NO.

03.

4. A detection reagent or kit for detecting plant protein content, the kit comprising the KASP primer combination according to claim 3.

5. A method for identifying a plant with high protein content, characterized in that: include: Using the DNA of the plant sample to be tested as a template, PCR amplification is performed using the KASP primer combination described in claim 3 or the detection reagent or kit described in claim 4, and the protein content of the plant sample to be tested is determined based on the amplification result.

6. The method for identifying high protein content in plants according to claim 5, characterized in that: Determining the protein content of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site located at 167440648 bp of wheat chromosome 7B in the amplified product, and the plant with genotype TT has a higher protein content than the plant with genotype CC.

7. The method for identifying high protein content in plants according to claim 5 or 6, characterized in that: The plant is wheat.

8. The method for identifying high protein content in plants according to any one of claims 5 to 7, characterized in that: Based on a total system of 10 μL, the system used for PCR amplification includes: 2×KASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the remainder is water; the primer mixture, based on 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 10-14 μL, and the remainder is water.

9. The method for identifying high protein content in plants according to claim 8, characterized in that: The reaction program used for PCR amplification was as follows: 95°C for 8-12 min; 95°C for 15-25 s, 61°C for 60 s, for 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C for 15-25 s, 55°C for 35-45 s, for 32-36 cycles; 25°C for 10-20 min.

10. Any of the following uses of the SNP molecular marker according to claim 1 or 2, the KASP primer combination according to claim 3, or the detection reagent or kit according to claim 4: (1) Used for identification, breeding and improvement of wheat protein content; (2) Used for early prediction of wheat quality traits; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

Images