Application of expression promoter of cavette protein 1 in preparation of medicine for treating migraine

Abstract

The invention provides an application of an expression promoter of cavette protein 1 in preparation of a medicine for treating migraine. Tests show that overexpression of the caveolar protein 1 can relieve neuroinflammatory response so as to improve pain-related behaviors of migraine mice, and knock-down of CAV1 expression increases the number and activation degree of microglial cells at the trigeminal nerve caudal nucleus part of the migraine mice, which indicates that the caveolar protein 1 gene can be used as a new migraine treatment target and can be used for treating migraine. And a new direction is provided for migraine targeted therapy and drug development. Therefore, the caveolar protein 1 and the caveolar protein 1 expression promoter can be used for preparing the medicine for preventing, relieving and / or treating migraine.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the use of a caveolin-1 expression promoter in the preparation of a medicine for treating migraine. Background Art

[0002] Migraine is a common, recurrent, disabling neurological disease characterized by recurrent unilateral throbbing headaches, often accompanied by symptoms such as nausea, vomiting, photophobia, and phonophobia. According to the 2021 Global Burden of Disease Study (GBD), age-standardized disability-adjusted life years (DALYs) for migraine rank third among neurological diseases. Migraine patients have an increased risk of cardiovascular and cerebrovascular diseases, and have comorbidities such as depression, epilepsy, and circadian rhythm disorders. It has a huge impact on the patient's quality of life and imposes a huge burden on the patient's family and socioeconomics.

[0003] The pathogenesis of migraine is still unclear. Currently, it is mainly believed that the pathogenesis of migraine involves central sensitization and neuroinflammation of the trigeminovascular system. It is characterized by increased excitability and synaptic plasticity of sensory neurons, mainly in the TNC and thalamus. Activation of the trigeminovascular pathway leads to the release of proinflammatory, vasodilatation or pain-producing neuropeptides, such as calcitonin gene-related peptide (CGRP) and pituitary adenylate cyclase-activating polypeptide (PACAP). CGRP is abundant in trigeminal ganglion neurons and is secreted in the trigeminal ganglion. It may promote central sensitization of secondary neurons by interacting with adjacent neurons and satellite glial cells. Some studies have shown that microglia and the ERK / CREB pathway are involved in the central sensitization of migraine. In a nitroglycerin-induced recurrent chronic migraine mouse model, inhibiting the activation of microglia and the ERK / CREB pathway can alleviate central sensitization.

[0004] Therefore, there is an urgent need to develop effective migraine therapeutic targets and drugs for the treatment of migraine. Summary of the invention

[0005] The purpose of the present invention is to provide the use of caveolin-1 as a target in the preparation of a drug for treating migraine. The present invention has found through experiments that overexpression of caveolin-1 can reduce neuroinflammatory response and thus improve pain-related behavior in migraine mice, indicating that caveolin-1 and caveolin-1 expression promoters can be used to prepare drugs for preventing, alleviating and / or treating migraine, and have application potential in clinical treatment.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, there is provided the use of caveolin-1 gene as a target gene in screening drugs for preventing, alleviating and / or treating migraine, wherein the screening method comprises screening substances capable of promoting the expression of caveolin-1 gene.

[0008] In a second aspect of the present invention, there is provided the use of caveolin-1 protein as a target in screening drugs for preventing, alleviating and / or treating migraine, wherein the screening method comprises screening substances that can enhance the activity of caveolin-1 protein.

[0009] In the third aspect of the present invention, there is provided use of caveolin-1 protein in the preparation of a medicament for preventing and / or treating migraine.

[0010] In a fourth aspect of the present invention, provided is the use of a substance that promotes caveolin-1 gene expression in the preparation of a drug for preventing, alleviating and / or treating migraine.

[0011] The substance that promotes caveolin-1 gene expression can also be called a caveolin-1 expression promoter.

[0012] Furthermore, the substance that promotes caveolin-1 gene expression includes a recombinant vector or a recombinant virus that can overexpress the caveolin-1 gene.

[0013] As a specific embodiment, the recombinant vector capable of overexpressing the caveolin-1 gene includes a caveolin-1 overexpressing adenovirus vector.

[0014] As a specific embodiment, the substance that promotes the expression of the caveolin 1 gene includes a recombinant vector or recombinant virus capable of overexpressing the caveolin 1 gene, including a CAV1 overexpression lentivirus (pLV3-CMV-CAV1). The vector pLV3-CMV-MCS-Puro plasmid (commercially available, such as Shanghai Bolson Biotechnology Co., Ltd., product number BES249273PVE) is double-digested with BamHI and EcoRI and recombined with the caveolin 1 gene CDS fragment (shown in SEQ ID NO.1), and then transferred into Escherichia coli T1 competent cells and cultured, concentrated, screened, and sequenced.

[0015] In a fifth aspect of the present invention, provided is the use of a substance that enhances the activity of caveolin-1 protein in the preparation of a drug for preventing, alleviating and / or treating migraine.

[0016] Furthermore, the drug prevents, alleviates and / or treats migraine by at least one of the following effects: inhibiting cardiac inflammation, reducing myocardial cell apoptosis or improving migraine.

[0017] In a sixth aspect of the present invention, a drug for preventing, alleviating and / or treating migraine is provided, comprising at least one of the following substances:

[0018] (1) Caveolin-1;

[0019] (2) substances that promote caveolin-1 gene expression;

[0020] (3) A substance that enhances the activity of caveolin-1 protein.

[0021] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0022] Furthermore, the auxiliary material is selected from one of a filler, a disintegrant, a binder, a diluent, a lubricant, a sweetener or a colorant.

[0023] Furthermore, the dosage form of the drug includes at least one of granules, tablets, pills, capsules, injections and dispersants.

[0024] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0025] 1. The present invention provides the use of caveolin 1 as a target in the preparation of drugs for the treatment of migraine. The present invention has found through research that upregulating the expression of CAV1 can relieve migraine. Specifically, the present invention has found for the first time that CAV1 interacts with CLR, negatively regulates the downstream ERK / CREB pathway and microglia-mediated neuroinflammatory response, and relieves migraine. Mechanistically, the expression of CAV1 in the migraine mouse model is reduced, the activation of the ERK / CREB pathway and microglia is increased, and the migraine mice show pain sensitization and photophobia behaviors; supplementation of CAV1 inhibits microglial activation through the CAV1 / CLR / ERK / CREB axis, reduces neuroinflammatory response, and thus improves pain-related behaviors in migraine mice. At the same time, knocking down the expression of CAV1 increases the number and activation of microglia in the caudate nucleus of the trigeminal nerve in migraine mice. It shows that CAV1 can be used as a potential target for the preparation of drugs for the prevention and treatment of migraine.

[0026] 2. The present invention can utilize compounds, peptides or viruses to prevent and treat migraine by upregulating CAV1, providing an effective means for the prevention and treatment of migraine. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments.

[0028] Figure 1Figure 2 is the result of evaluating pain-related behaviors of mice in the control group (PBS group) and the migraine group (IS group), where (a) is the periorbital pain threshold, (b) is the number of facial scratching, and (c) is the freezing time.

[0029] Figure 2 To evaluate the photophobia behavior of mice in the control group (PBS group) and the migraine group (IS group), where (a) is the residence time in the bright room, and (b) is the representative movement trajectory and trajectory heat map of mice in the light / dark box.

[0030] Figure 3 The protein expressions of CAV1, CLR, p-ERK1 / 2, ERK1 / 2, TNFα and IL1β in the caudate nucleus of the trigeminal nerve (sp5c) of the control group (PBS group) and the migraine group (IS group) were evaluated by WB method, where (a) is the gel run, (b) is CLR / GAPDH, (c) is CAV1 / GAPDH, (d) is the relative expression levels of p-ERK / ERK and pCREB / CREB, and (e) is TNFα and IL1β.

[0031] Figure 4 Immunofluorescence images (a) and IBA1-positive area (b) were used to evaluate the number and activation degree of microglia in the caudate nucleus of the trigeminal nerve in the control group (PBS group) and the migraine group (IS group), where IBA1 is a marker of microglia.

[0032] Figure 5 The results of evaluating the improvement of periorbital mechanical pain threshold and spontaneous pain behavior in migraine mice after CAV1 overexpression, where (a) is the periorbital pain threshold, (b) is the number of facial scratching, and (c) is the freezing time.

[0033] Figure 6 The results of evaluating the improvement of photophobia behavior in migraine mice after CAV1 overexpression are shown in Figure 1, where (a) is the time spent in the bright room, and (b) is the representative movement trajectory and trajectory heat map of mice in the light / dark box.

[0034] Figure 7 The protein expression of CAV1, CLR, p-ERK1 / 2, ERK1 / 2, TNFα and IL1β in the caudate nucleus of the trigeminal nerve (sp5c) of migraine mice after CAV1 overexpression was evaluated by WB method, where (a) is the running gel image and (b) is the relative band intensity result.

[0035] Figure 8 Immunofluorescence images (a) and IBA1-positive area (b) were used to evaluate the number and activation of microglia in the caudate nucleus of the trigeminal nerve (sp5c) of migraine mice after CAV1 overexpression, where IBA1 is a marker for microglia.

[0036] Fig. 9 The results of periorbital mechanical pain threshold and spontaneous pain behavior of mice in the knockout group and the control group are shown in Figure 1, where (a) is the periorbital pain threshold, (b) is the number of facial scratching, and (c) is the freezing time.

[0037] Fig.10 Figure 2 shows the photophobia behavior of mice in the knockout group and the control group, where (a) is the residence time in the bright room, and (b) is the representative movement trajectory and trajectory heat map of mice in the light / dark box.

[0038] Fig.11 The protein expression diagrams of CAV1, CLR, p-ERK1 / 2, ERK1 / 2, TNFα and IL1β in the caudate nucleus of the trigeminal nerve (sp5c) of the knockout group and the control group, where (a) is the gel run and (b) is the relative band intensity result.

[0039] Fig.12 Immunofluorescence images of the number and activation degree of microglia in the caudate nucleus of the trigeminal nerve (sp5c) of mice in the knockout group and the control group (a) and the IBA1-positive area (b). DETAILED DESCRIPTION

[0040] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0041] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0042] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0043] To solve the technical problem of the present invention, the overall idea is as follows:

[0044] The present invention found that in animal models, upregulating caveolin-1 gene expression or interfering with the interaction between caveolin-1 and the CGRP receptor CALCRL subunit can significantly alleviate migraine-like behaviors, including lowering pain threshold, reducing head scratching behavior, reducing freezing time, and improving light hypersensitivity behavior. In addition, it can also reduce the levels of inflammatory factors associated with migraine, such as IL-1β and TNF-α.

[0045] The mouse models include, but are not limited to, the IS migraine model.

[0046] The use method of the present invention is to up-regulate the expression of CAV1 gene by overexpression of shRNA and CAV1 lentivirus and to disrupt the interaction between caveolin 1 and the CALCRL subunit of the CGRP receptor by nasal instillation of methyl β-dextrin.

[0047] In summary, the present invention found that upregulating caveolin-1 gene expression or interfering with the interaction between caveolin-1 and the CGRP receptor CALCRL subunit showed significant therapeutic effects in IS model mice, could alleviate pain behavior and photophobia, and could regulate the expression of proteins related to inflammation.

[0048] Therefore, a substance that promotes caveolin-1 gene expression can be used to prepare a drug for treating migraine.

[0049] The application of caveolin-1 as a target in the preparation of a drug for treating migraine will be described in detail below in combination with examples and experimental data.

[0050] Example 1: Reduced protein expression level of CAV1 in the trigeminal nucleus caudate of migraine mice (IS group)

[0051] 1. Experimental Methods

[0052] 1.1 Establishment of migraine mouse model: The migraine mouse model was established by epidural inflammatory soup stimulation. Specifically, 6-8 week old female C57BL / 6J mice were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd. All animal experiments were performed in a clean animal laboratory of Renmin Hospital of Wuhan University. During the experiment, mice were free to eat and drink, and the light-controlled laboratory alternated day and night, with a room temperature of 181□26℃ and a humidity of (55±2)%. Under SPF conditions, 8 mice were randomly divided into each group and freely carried out a 12-hour light and dark cycle. Mice were anesthetized with 3% isoflurane and maintained anesthesia with 1.5% isoflurane. The mice were placed on a stereotaxic instrument and the body temperature was maintained with a heating pad. A small hole (1 mm in diameter, 1 mm posterior, 1 mm lateral to Bregma) was drilled in the mouse skull using a cranial drill, penetrating the skull but keeping the dura intact, implanting the guide cannula into the small hole and fixing it with dental cement for inflammatory soup (IS) delivery, and suturing the wound after surgery. 20 microliters of IS (2mM prostaglandin E2, 2mM serotonin, 2mM histamine and 2mM bradykinin) or saline was delivered into the cannula every day for 7 consecutive days. The control group was given an equal amount of phosphate buffered saline (PBS). After the model was established, the migraine model was successfully established by behavioral testing.

[0053] 1.2 Behavioral test: Immediately after model establishment, behavioral tests were performed on mice by personnel who were unaware of the experimental groups.

[0054] 1.2.1 Mechanical pain threshold: Gently press the Von Frey filament against the periorbital area of ​​the mouse, apply enough force to bend the filament, and keep it in contact for 1-2 seconds. A positive reaction is defined as a sudden head retraction, head scratching, and head shaking of the mouse. When a positive reaction occurs, a smaller fiber is used; otherwise, a larger fiber is used. The minimum weight of the fiber that causes a positive reaction is recorded as the mechanical pain threshold of the mouse. Each mouse is tested at least three times, and the average threshold is measured.

[0055] 1.2.2 Spontaneous pain-related behaviors: including the number of head scratching and freezing behavior. The number of head scratching was recorded as the mouse scratching the scalp and orbital skin area with its forepaws, which is generally considered to be a manifestation of aversive behavior caused by craniofacial pain. Freezing refers to the state in which the mouse stops moving and remains motionless. The freezing time of the mouse within 5 minutes after the last administration was counted.

[0056] 1.2.3. Photophobia: Photophobia was assessed using the light / dark box test. The light / dark box consisted of a bright and a dark compartment with a passage between the two compartments (each compartment measured 30 × 30 × 20 cm). The box was placed in a dedicated room so that mice could adapt to the environment before testing. At the beginning of the experiment, mice were placed in the center of the box and allowed to explore freely for a total of 5 minutes. The movement trajectory of the mice was detected. The time the mice spent in the bright compartment was recorded to assess photophobia.

[0057] 1.3 Western Blot detection: After the behavioral test, the mouse trigeminal nucleus tissue was taken, and the tissue was lysed with lysis buffer to extract protein. After protein quantification, the protein sample was mixed with protein loading buffer and heated for denaturation. Electrophoresis was performed using 10% separation gel and 4% concentration gel. After electrophoresis, the membrane was transferred to PVDF membrane. After the transfer, it was blocked with rapid blocking solution for 15 minutes and incubated with primary antibody. The dilution ratio of the antibodies is as follows: CAV1 (1:1000, purchased from Wuhan Sanying Biotechnology Co., Ltd.), CLR (1:500, purchased from Abotek Biotechnology Co., Ltd.), ERK1 / 2 (1:1000, purchased from Jiangsu Qinke Biological Research Center Co., Ltd.), p-ERK1 / 2 (1:1000, purchased from Jiangsu Qinke Biological Research Center Co., Ltd.), p-CREB (1:1000, purchased from Wuhan Yucheng Biotechnology Co., Ltd.), CREB (1:1000, purchased from Wuhan Yucheng Biotechnology Co., Ltd.), TNF-alpha (1:500, purchased from Wuhan Saiweier Biotechnology Co., Ltd.), IL-1β (1:500, purchased from Wuhan Saiweier Biotechnology Co., Ltd.), GAPDH (1:1000, purchased from Wuhan Sanying Biotechnology Co., Ltd.). Incubate overnight at 4°C. After removal, wash the PVDF membrane with TBST buffer solution and incubate the corresponding secondary antibody at room temperature for 1 hour. After washing 3 times with TBST solution, the protein bands were visualized using chemiluminescence software.

[0058] 1.4 Immunofluorescence detection: After perfusing the mice with tissue fixative, the mouse brain was dissected and isolated. After dehydration, it was embedded in OCT embedding medium and sliced ​​with a freezing microtome. After the tissue sections were fixed with paraformaldehyde for 15 minutes, 0.3% Triton X-100 was added to permeabilize the tissue. Then it was blocked with 5% bovine serum albumin (BSA) at room temperature for half an hour, and incubated with IBA1 primary antibody (purchased from Wuhan Saiweier Biotechnology Co., Ltd.), the primary antibody dilution ratio was 1:1000, and 4°C overnight. After washing three times with PBS, it was incubated with FITC-conjugated secondary antibody at room temperature for 1 hour. The nucleus was counterstained with DAPI, the slides were sealed, and images were collected using a fluorescence microscope (Olympus BX51; Olympus, Tokyo, Japan).

[0059] 2. Experimental results

[0060] like Figure 1-2 As shown, compared with the control group (PBS group), the migraine mice (IS group) had increased periorbital mechanical pain threshold, increased head scratching times and increased freezing time.

[0061] like Figure 3As shown, compared with the control group (PBS group), the protein expression level of CAV1 in the caudate nucleus of the trigeminal nerve of migraine mice (IS group) was reduced, the activation degree of the ERK / CREB pathway was increased, and the expression levels of neuroinflammatory factors TNFα and IL1β were increased.

[0062] like Figure 4 As shown, compared with the control group (PBS group), the number and activation degree (cell bodies became larger and branches became shorter) of microglia in the caudate nucleus of the trigeminal nerve of migraine mice (IS group) increased.

[0063] Example 2: Pain-related behaviors of IS model mice were significantly improved after CAV1 overexpression

[0064] 1. Experimental Methods

[0065] 1.1 In vivo transfection of CAV1 overexpressing lentivirus in mice: CAV1 overexpressing lentivirus (pLV3-CMV-CAV1) and control lentivirus vectors were synthesized by Miaoling Biotechnology (Wuhan) Co., Ltd. The construction method of CAV1 overexpressing lentivirus (pLV3-CMV-CAV1) is as follows:

[0066] Obtain the mouse caveolin-1 gene CDS fragment (sequence:

[0067] atggcagac gaggtgactg agaagcaagt gtatgacgcg cacaccaagg agattgacctggtcaaccgc gaccccaagcatctcaacga cgacgtggtc aagatgact ttgaagatgt gattgcagaaccagaaggga cacacagttt cgacggcatctggaaggcca gcttcaccac cttcactgtg acaaaatattggttttaccg cttgttgtct acgatcttcg gcatcccaat ggcactcatctggggcattt actttgccattctctccttc ctgcacatct gggcggttgt accgtgcatc aagagcttcc tgattgagattcagtgcatcagccgcgtct actccatcta cgtccatacc ttctgcgatc cactctttga agctattggcaagatattca gcaacatccg catcagcacgcagaaagaga tatga) (SEQ ID NO. 1);

[0068] The vector pLV3-CMV-MCS-Puro plasmid (commercially available, such as Shanghai Boersen Biotechnology Co., Ltd., catalog number BES249273PVE) was double-digested with BamHI and EcoRI and recombined with the caveolin-1 gene CDS fragment, and then transferred into Escherichia coli T1 competent cells for culture, concentration, screening, and sequencing;

[0069] To investigate the therapeutic effect of CAV1 overexpression on migraine mice, 5 μl of control lentivirus or CAV1 overexpression lentivirus (10 9 TU / ml) were microinjected into the caudal nucleus of the trigeminal nerve. Models were established one week after transfection.

[0070] 1.2 Establishment of migraine mouse model: Same as Example 1.

[0071] 1.3 Behavioral test: Same as Example 1.

[0072] 1.4 Western Blot detection: Same as Example 1.

[0073] 1.5 Immunofluorescence detection: Same as Example 1.

[0074] 2. Experimental results

[0075] like Figure 5-6 As shown, CAV1 overexpression alleviated pain and photophobia in migraine mice.

[0076] like Figure 7 As shown, CAV1 overexpression reduced the activation of the ERK / CREB pathway in the caudate nucleus of the trigeminal nerve in migraine mice and reduced the expression levels of neuroinflammatory factors TNF-α and IL-1β.

[0077] like Figure 8 As shown, CAV1 overexpression reduced the number of microglia in the caudate nucleus of the trigeminal nerve in migraine mice and reduced the degree of microglial activation.

[0078] Example 3: CAV1 knockdown induces pain and photophobia in mice

[0079] 1. Experimental Methods

[0080] 1.1 In vivo transfection of CAV1 knockdown siRNA mice:

[0081] Methoxy- and cholesterol-modified siRNA targeting CAV1 knockdown

[0082] forward, 5′-CGACGUGGUCAAGAUUGACUUdTdT-3′ (SEQ ID NO. 2);

[0083] Reverse, 5′-AAGUCAAUCUUGACCACGUCGdTdT-3 (SEQ ID NO. 3);

[0084] and control siRNA (siRNA-NC) were synthesized by Jinkairui Biological Company.

[0085] Using ExFect transfection reagent from Nanjing Novizan Biotechnology Co., Ltd., siRNA was transfected into the caudal nucleus of the trigeminal nerve of mice by stereotaxic injection according to the instructions. Subsequent experiments were performed 36-48 hours after transfection.

[0086] 1.2 Establishment of migraine mouse model: Same as Example 1.

[0087] 1.3 Behavioral test: Same as Example 1.

[0088] 1.4 Western Blot detection: Same as Example 1.

[0089] 1.5 Immunofluorescence detection: Same as Example 1.

[0090] 2. Experimental results

[0091] like Figure 9-10 As shown, CAV1 knockdown induced pain and photophobia behaviors in mice.

[0092] like Fig.11 As shown, CAV1 knockdown increased the activation of the ERK / CREB pathway in the caudate nucleus of the trigeminal nerve in mice and upregulated the expression levels of neuroinflammatory factors TNF-α and IL-1β.

[0093] like Fig.12 As shown, CAV1 knockdown increased the number and activation of microglia in the caudate nucleus of the trigeminal nerve in mice with migraine.

[0094] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0095] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0096] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of caveolin-1 gene as a target gene in screening drugs for preventing, alleviating and / or treating migraine, characterized in that: The screening method includes screening substances that can promote the expression of caveolin-1 gene.

2. Use of caveolin-1 as a target in screening drugs for preventing, alleviating and / or treating migraine, characterized in that: The screening method includes screening substances that can enhance caveolin-1 activity.

3. Use of caveolin-1 in the preparation of a medicament for preventing and / or treating migraine.

4. Use of a substance that promotes caveolin-1 gene expression in the preparation of a drug for preventing, alleviating and / or treating migraine.

5. The use according to claim 4, characterized in that: The substance that promotes caveolin-1 gene expression includes a recombinant vector or a recombinant virus that can overexpress the caveolin-1 gene.

6. The use according to claim 4, characterized in that: The substance that promotes caveolin-1 gene expression includes CAV1 overexpression lentivirus.

7. Use of a substance that enhances caveolin-1 activity in the preparation of a drug for preventing, alleviating and / or treating migraine.

8. The use according to any one of claims 1 to 7, characterized in that: The drug prevents, alleviates and / or treats migraine by at least one of the following actions: inhibiting inflammation of the trigeminovascular system, reducing apoptosis of trigeminovascular system cells, or improving migraine.

9. A drug for preventing, alleviating and / or treating migraine, characterized in that: The drug contains at least one of the following substances: (1) Caveolin-1; (2) substances that promote caveolin-1 gene expression; (3) Substances that enhance caveolin-1 activity.

10. The drug according to claim 9, characterized in that The method of preventing, alleviating and / or treating migraine by the drug includes: under the stimulation of inflammatory soup or nitroglycerin, overexpression of caveolin-1 in the drug can significantly reduce the damage caused by inflammatory soup or nitroglycerin to microglial cells of the trigeminovascular system.

Images