Use of the small molecule compound nx-1607 in the manufacture of a product for the treatment of liver fibrosis

Abstract

The present application relates to the technical field of biological medicine, in particular to application of small molecule compound NX-1607 in preparation of products for treating liver fibrosis. The present application finds that NX-1607 has high-efficiency anti-liver fibrosis effect, and shows significant anti-fibrosis effect in multiple mouse models of liver fibrosis, and has wide adaptability. The present application also finds that NX-1607 can up-regulate expression of a key inhibitory factor SMAD7 of a TGF-beta signal pathway, reduce activation of hepatic stellate cells, thereby effectively relieving liver fibrosis, and this mechanism is different from existing anti-liver fibrosis drugs, thereby providing new technical support for liver fibrosis treatment. And NX-1607 does not find obvious toxic side effects in an effective dose range (3-8 mg / kg / d), and has good safety. It can be seen that NX-1607 is a safe and effective anti-liver fibrosis drug, and can improve the problems of limited current curative effect and large side effects.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the application of small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. BACKGROUND

[0002] At present, liver fibrosis is a widespread pathological process caused by chronic liver injury, which may eventually develop into cirrhosis and even liver cancer. Although studies have shown that the TGF-β signaling pathway promotes the occurrence and development of liver fibrosis, there is still a lack of effective anti-fibrosis drugs targeting the TGF-β signaling pathway in clinical practice.

[0003] The existing anti-liver fibrosis treatment methods mainly include: (1) Anti-inflammatory therapy: such as glucocorticoids, but long-term use may cause side effects, such as immunosuppression, etc. (2) Anti-oxidative stress: such as S-adenosyl methionine, but the efficacy is limited. (3) Anti-fibrosis drugs: including some experimental TGF-β pathway inhibitors, but most of them have not entered clinical application, and some drugs have problems such as poor pharmacokinetic properties, large side effects, etc.

[0004] Therefore, there is an urgent need for a safe and effective anti-liver fibrosis drug to improve the shortcomings of current treatment methods. SUMMARY

[0005] In order to solve the above problems, the present application provides the application of small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. The present application finds that NX-1607 can up-regulate the expression of the key inhibitor SMAD7 of the TGF-β signaling pathway, reduce the activation of hepatic stellate cells (HSC), and thus effectively alleviate liver fibrosis. It is a safe and effective anti-liver fibrosis drug that can improve the problems of limited efficacy and large side effects in current treatment.

[0006] In order to achieve the above purpose, the present application provides the following technical scheme:

[0007] The present application provides the application of small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis.

[0008] Preferably, the product comprises a drug.

[0009] The present application provides a drug for treating liver fibrosis, and the effective ingredient comprises small molecule compound NX-1607; the unit dose of the drug is 3-8 mg / kg of body weight of mice.

[0010] Preferably, the unit dose of the drug is 5 mg / kg of body weight of mice.

[0011] Preferably, the medicine further comprises an excipient; the excipient comprises 5g / L of sodium carboxymethyl cellulose solution.

[0012] Advantages:

[0013] The application provides application of a small molecule compound NX-1607 in preparation of a product for treating liver fibrosis. The application finds that NX-1607 has a high-efficiency anti-liver fibrosis effect, and shows a significant anti-fibrosis effect in multiple mouse models of liver fibrosis (MCD diet model and CCL4 induction model), has a wide adaptability, and is expected to become a new type of candidate drug for anti-liver fibrosis. The application further finds that NX-1607 can up-regulate expression of a key inhibitor SMAD7 of a TGF-β signal pathway, reduce activation of hepatic stellate cells (HSC), and thus effectively relieve liver fibrosis, which is different from a mechanism of an existing anti-liver fibrosis drug, and provides new technical support for treatment of liver fibrosis. Moreover, NX-1607 is a drug in a clinical stage on the market, and no obvious toxic side effects are found in an effective dose range (3-8 mg / kg / d), and NX-1607 has good safety. In conclusion, the application finds that NX-1607 is a safe and effective anti-liver fibrosis drug, and can improve the problems of limited curative effect and large side effects. BRIEF DESCRIPTION OF DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments.

[0015] Figure 1 Masson staining result of the MCD model after NX-1607 treatment;

[0016] Figure 2 Sirius red staining result of the MCD model after NX-1607 treatment;

[0017] Figure 3 Detection result of serum liver damage markers ALT and AST of the MCD model after NX-1607 treatment;

[0018] Figure 4 Detection result of RT-qPCR of the MCD model after NX-1607 treatment;

[0019] Figure 5 Masson staining result of the CCL4 model after NX-1607 treatment;

[0020] Figure 6 Sirius red staining result of the CCL4 model after NX-1607 treatment;

[0021] Figure 7The detection results of serum liver damage markers ALT and AST after NX-1607 treatment in the CCL4 model;

[0022] Figure 8 The detection results of RT-qPCR after NX-1607 treatment in the CCL4 model;

[0023] Figure 9 The Western Blot detection results after NX-1607 stimulation of the human hepatic stellate cell line LX2;

[0024] Among them, Figure 3 、 Figure 4 、 Figure 7 and Figure 8 NX1607 in NX-1607 treatment group. DETAILED DESCRIPTION

[0025] The present application provides the use of a small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. The small molecule compound NX-1607 described in the present application is a small molecule compound in the clinical stage that is commercially available, and no obvious toxic side effects are found within the effective dose range (3-8 mg / kg / d), and it has good safety. As an embodiment, the small molecule compound NX-1607 described in the present application is purchased from sellck company, and the item number is E1957.

[0026] As an embodiment, the product can be a drug.

[0027] The present application finds that NX-1607 has a high-efficiency anti-liver fibrosis effect, and it shows a significant anti-fibrosis effect in multiple liver fibrosis mouse models (MCD diet model and CCL4 induction model), can inhibit the expression of αSMA gene and inhibit the expression of Col1a1 gene, and reduce the content of glutamic-pyruvic transaminase and glutamic-oxaloacetic transaminase in serum. MCD diet is a non-alcoholic fatty liver disease related liver fibrosis model; CCL4 (carbon tetrachloride) is a classic chemical liver damage inducer, which can simulate liver fibrosis caused by drug damage, alcohol and viral liver damage. It can be seen that NX-1607 has wide adaptability and is expected to become a new type of anti-liver fibrosis candidate drug.

[0028] The present application also finds that NX-1607 can up-regulate the expression of the key inhibitor SMAD7 of the TGF-β signaling pathway, reduce the activation of hepatic stellate cells (HSC), and thus effectively alleviate liver fibrosis, which is different from the existing anti-liver fibrosis drugs, and provides new technical support for the treatment of liver fibrosis.

[0029] Based on the above advantages, the present application provides a medicine for treating liver fibrosis, and the effective component includes a small molecule compound NX-1607; the unit dose of the medicine is 3-8 mg / kg of body weight of mice. The unit dose of the present application refers to the effective unit dose of the medicine for playing an anti-liver fibrosis role, and the equivalent conversion can be made according to the common knowledge in the art if the medicine is used for human body.

[0030] As an implementation mode, the unit dose of the medicine is 5 mg / kg of body weight of mice.

[0031] As an implementation mode, the medicine further includes an excipient; the excipient includes a 5 g / L sodium carboxymethyl cellulose solution.

[0032] In order to further illustrate the present application, the application of the small molecule compound NX-1607 provided by the present application in the preparation of a product for treating liver fibrosis is described in detail below in combination with the drawings and examples, but they cannot be understood as limiting the protection scope of the present application.

[0033] Example 1

[0034] The C57BL / 6J mice were modeled for liver fibrosis by using the method described in the literature

Rao J, Wang H, Ni M, Wang Z, Wang Z, Wei S, Liu M, Wang P, Qiu J, Zhang L, Wu C, Shen H, Wang X, Cheng F, Lu L. FSTL1 promotes liver fibrosis by reprogramming macrophage function through modulating the intracellular function of PKM2. Gut. 2022 Dec;71(12):2539-2550. doi: 10.1136 / gutjnl-2021-325150. Epub 2022 Feb 9. PMID: 35140065; PMCID: PMC9664121.

[0035] Example 2

[0036] NX-1607 (or denoted as NX1607, purchased from sellck company) was dissolved in a 5 g / L sodium carboxymethyl cellulose solution to obtain an NX-1607 solution.

[0037] The MCD diet model mice constructed in Example 1 were divided into two groups, a control group (denoted as Vehicle) and an NX-1607 treatment group, each group of 6. The two groups of mice were treated as follows:

[0038] The NX-1607 treatment group of mice were given NX-1607 solution by gavage, with the amount of NX-1607 solution by gavage being 5 mg / kg of body weight per day in terms of the mass of NX-1607; the control group was given the same volume of solvent (i.e. 5 g / L sodium carboxymethyl cellulose solution).

[0039] After 6 weeks of treatment, the two groups of mice were subjected to liver paraffin section Masson staining and Sirius red staining, and the results are shown in Figure 1 and Figure 2 The results show that the degree of liver fibrosis in the MCD diet model mice after NX-1607 treatment is reduced.

[0040] After 6 weeks of treatment, the levels of liver damage markers alanine transaminase (ALT) and aspartate transaminase (AST) in the serum of the two groups of mice were detected, and the results are shown in Figure 3 wherein ** indicates P<0.01 and *** indicates P<0.001. The results show that NX-1607 treatment can reduce the content of liver damage markers (ALT and AST) in the serum of MCD diet model mice.

[0041] After 6 weeks of treatment, the relative expression amounts of liver fibrosis molecular markers αSMA gene and Col1a1 gene were detected by RT-qPCR, with actin as the internal reference gene, and the primer sequences used are shown in Table 1. The results are shown in Figure 4 wherein ** indicates P<0.01.

[0042] Table 1 RT-qPCR primers

[0043] Primer name Primer sequence (5’-3’) mus-actin-F GGCTGTATTCCCCTCCATCG (SEQ ID NO. 1) mus-actin-R CCAGTTGGTAACAATGCCATGT (SEQ ID NO. 2) mus-aSMA-F CCCAGACATCAGGGGAGTAATGGG (SEQ ID NO. 3) mus-aSMA-R TCTATCGGATACTTCAGCGTCA (SEQ ID NO. 4) mus-Col1a1-F TGCTAACGTGGTTCGTGACCGT (SEQ ID NO. 5) mus-Col1a1-R ACATCTTGAGGTCGCGGCATGT (SEQ ID NO. 6)

[0044] The results show that the relative expression amounts of liver fibrosis molecular markers αSMA gene and Col1a1 gene in the MCD diet model mice after NX-1607 treatment are reduced.

[0045] Example 3

[0046] A similar method to Example 2 was used, except that the MCD diet model mice constructed in Example 1 were replaced by CCL4-induced model mice constructed in Example 1, and the results are shown in Figures 5-8 wherein ** indicates P<0.01 and *** indicates P<0.001.

[0047] The results show that the degree of liver fibrosis in CCL4-induced model mice is reduced after NX-1607 treatment, the contents of liver damage markers (ALT and AST) in serum are reduced, and the relative expression amounts of liver fibrosis molecular markers aSMA gene and Col1a1 gene are reduced.

[0048] Example 4

[0049] After stimulating human hepatic stellate cell line LX224h with transforming growth factor-β (TGF-β, stimulating concentration of 10 ng / ml) and NX-1607 (stimulating concentration of 100 nM, solvent is 5 g / L sodium carboxymethyl cellulose solution) respectively, total protein of the cells was collected for Western Blot detection. The specific detection method of Western Blot is as follows:

[0050] 1. Cell lysis and protein extraction

[0051] The cells were washed with pre-cooled PBS (phosphate buffer) twice to remove the residual medium. An appropriate amount of RIPA lysis buffer (containing protease inhibitor and phosphatase inhibitor) was added, and the cells were lysed on ice for 30 min, and mixed evenly every 10 min. 12,000 x g, 4°C centrifugation for 15 min, and the supernatant was collected as total protein. The protein concentration was determined by BCA protein quantification kit. 15 μg of protein sample was taken, 5x protein loading buffer (SDS-PAGE Loading Buffer) was added, and denaturation was performed at 100°C for 5 min.

[0052] 2. SDS-PAGE electrophoresis

[0053] Prepare 10% SDS-PAGE gel and gel polymerization. Load the sample into the gel well, add protein molecular weight marker, and electrophorese (80V for 30 min, 120V for 60 min) until the protein separates to the appropriate position.

[0054] 3. Protein transfer

[0055] Transfer the gel protein to PVDF membrane (0.22 μm) by wet transfer (400 mA, 60 min).

[0056] 4. Blocking and antibody incubation

[0057] Block the membrane with 5% skim milk powder (room temperature, 2 h). Add SMAD7 and GAPDH primary antibodies (antibody dilution ratio 1:1000), and incubate at 4°C overnight. Wash with TBST for 3 times, 10 min each time. Add HRP-labeled secondary antibody (1:5000), and incubate at room temperature for 1 h. Wash the membrane with TBST for 3 times, 10 min each time.

[0058] 5. ECL color development and signal detection

[0059] The ECL luminescent substrate was added dropwise on the membrane, and incubated for 1 min in the dark. The protein bands were detected by chemiluminescence imaging system or X-ray film exposure. The target protein was normalized according to the band intensity of GAPDH.

[0060] The results are shown in Figure 9 The results showed that NX-1607 promoted the expression of SMAD7 in hepatic stellate cells (0.91) relative to TGF-β stimulation (0.47).

[0061] In summary, the present application provides a safe and effective anti-hepatic fibrosis small molecule drug NX-1607. NX-1607 can reduce the activation of hepatic stellate cells (HSC) by promoting the expression of SMAD7, a key inhibitor of the TGF-β signaling pathway, thereby effectively alleviating hepatic fibrosis and improving the shortcomings of current treatment methods.

[0062] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which belong to the protection scope of the present application.

Claims

1. Use of the small molecule compound NX-1607 for the manufacture of a medicament for the treatment of liver fibrosis.

Images