Recombinant Fuc-alpha1, 2-Gal escherichia coli and application of recombinant Fuc-alpha1, 2-Gal escherichia coli as engineering bacteria

Abstract

The invention belongs to the field of biotechnology and biochemical engineering, and particularly relates to recombinant Fuc-alpha1, 2-Gal escherichia coli and application of the recombinant Fuc-alpha1, 2-Gal escherichia coli as engineering bacteria. The engineering bacterium disclosed by the invention can be used for endogenous expression of alpha (1, 2) fucose transferase genes and / or galactosyl transferase genes, can be used for expressing lipopolysaccharide synthetase gene clusters of Fuc-alpha1, 2-Gal sugar structures, and can be used as a biosafety engineering bacterium to be prepared into a microbial agent to carry out downstream experiments such as intragastric administration so as to research functions of the Fuc-alpha1, 2-Gal sugar structures; wide application prospects are realized.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and biochemical engineering, and specifically relates to a recombinant Fuc-α1,2-Gal Escherichia coli and its application as an engineering bacterium. Background Art

[0002] Fuc-α1,2-Gal is present at the ends of many important polysaccharides, such as blood group H1 and H2 antigens, Lewis B and LewisY antigens, etc. Studies have shown that these sugar antigens are associated with the occurrence of asthma, tumors and inflammation. A deep learning model shows that the Fuc-α1,2-Gal sugar structure is closely related to the pathogenicity of Escherichia coli strains. In pathogenic Escherichia coli strains, most α1,2-linked fucose residues are linked to galactose, forming part of the human blood group H antigen. Fucosylated glycans on the surface of bacteria can mimic Lewis blood group antigens that are also present on the surface of gastric epithelium and are associated with immune escape. Therefore, it is of great significance to conduct in-depth research on the Fuc-α1,2-Gal sugar structure. By searching the CSDB database (Carbohydrate Structure Database), it is known that bacteria with this sugar structure on the surface are pathogenic bacteria. It can be seen that it is particularly important to find a non-pathogenic target strain to conduct more detailed functional studies on the Fuc-α1,2-Gal sugar structure.

[0003] Therefore, by using genome analysis and genetic engineering technology, based on the synthesis pathway of Escherichia coli Fucose, we constructed and screened a biosafe strain that can produce a lipopolysaccharide structure with Fuc-α1,2-Gal at the end. This can further deepen our understanding of the Fuc-α1,2-Gal sugar structure, and then use it to prepare functional probiotics and related vaccines, which has good industrial development and application prospects. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a recombinant Fuc-α1,2-Gal Escherichia coli and its application as an engineered bacterium. The genetically engineered bacterium of the present invention can express the extracellular polysaccharide of Fuc-α1,2-Gal, and can be used as a biosafety strain to study the functional effects of the Fuc-α1,2-Gal sugar structure, and further used to prepare functional probiotics and related vaccines, which has good industrial development and application prospects.

[0005] The first aspect of the present invention provides a genetically engineered bacterium that endogenously expresses an α(1,2) fucosyltransferase gene and / or a galactosyltransferase gene, wherein the α(1,2) fucosyltransferase gene and / or the galactosyltransferase gene has any of the nucleotide sequences (a1) to (a3):

[0006] (a1) the nucleotide sequence shown in SEQ ID NO.1 and / or SEQ ID NO.2;

[0007] (a2) a nucleotide sequence complementary to (a1);

[0008] (a3) A nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule of (a2) and which can encode a protein with the same or similar function.

[0009] The second aspect of the present invention provides a method for constructing the above-mentioned genetically engineered bacteria, comprising transferring the recombinant expression vector into a host bacteria.

[0010] The method for preparing the recombinant expression vector comprises: connecting the α(1,2) fucosyltransferase gene and the galactosyltransferase gene into a plasmid.

[0011] The third aspect of the present invention provides a method for producing extracellular polysaccharides of fucose-α1,2-galactose, comprising the following steps: culturing the above-mentioned genetically engineered bacteria; and isolating the extracellular polysaccharides of fucose-α1,2-galactose from the obtained culture.

[0012] A fourth aspect of the present invention provides the use of the above-mentioned genetically engineered bacteria in the preparation of drugs for preventing or treating immune-related diseases. Furthermore, the drugs include vaccines.

[0013] A fifth aspect of the present invention provides a microbial agent comprising the above-mentioned genetically engineered bacteria and acceptable adjuvants or auxiliary agents.

[0014] Beneficial technical effects of one or more of the above technical solutions:

[0015] The engineered bacteria of the present invention can express the lipopolysaccharide synthase gene cluster of the Fuc-α1,2-Gal sugar structure, and can be used as a biosafety engineered bacteria to be prepared into a microbial agent for gavage and other downstream experiments to study the function of the Fuc-α1,2-Gal sugar structure, and has broad application prospects. The recombinant Escherichia coli disclosed in the present invention is based on the synthesis pathway of E. coli K-12W3110 LPS that depends on Wzy. This heterologous expression method is also suitable for heterologous synthesis of LPS of other pathogens, and has very important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0017] Figure 1 Schematic diagram of the LPS structural modification of the present invention;

[0018] Figure 2 This is the map of the pRSFDuet / rfp+α1,2FucT expression vector of the present invention;

[0019] Figure 3 The silver staining and lectin imprinting experiments of the present invention are used to analyze the lipopolysaccharide of recombinant Escherichia coli;

[0020] Figure 4 This is the monosaccharide composition analysis of the recombinant Escherichia coli LPS of the present invention, wherein (a) is the silver staining result, (b) is the lectin imprinting result, and M is a low molecular weight protein standard;

[0021] Figure 5 The present invention is a chemoenzymatic labeling of the Fuc-α1,2-Gal sugar structure on the surface of recombinant Escherichia coli, wherein (a) is the independently constructed strain E. coli W3110ΔwbbL-rfp-α1,2FucT, and (b) is E. coli W3110ΔwbbL. DETAILED DESCRIPTION

[0022] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0023] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention.

[0024] In view of this, in a specific embodiment of the present invention, a genetically engineered bacterium is provided, which endogenously expresses an α(1,2) fucosyltransferase gene and / or a galactosyltransferase gene, wherein the α(1,2) fucosyltransferase gene and / or the galactosyltransferase gene has any of the nucleotide sequences (a1) to (a3):

[0025] (a1) the nucleotide sequence shown in SEQ ID NO.1 and / or SEQ ID NO.2;

[0026] (a2) a nucleotide sequence complementary to (a1);

[0027] (a3) A nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule of (a2) and which can encode a protein with the same or similar function.

[0028] In another specific embodiment of the present invention, the engineered bacteria is Escherichia coli, preferably Escherichia coli K-12W3110.

[0029] In another specific embodiment of the present invention, the genetically engineered bacteria is Escherichia coli, which expresses the α(1,2) fucosyltransferase gene and the galactosyltransferase gene by fusion.

[0030] In another specific embodiment of the present invention, a method for constructing a genetically engineered bacterium is provided, comprising the following steps:

[0031] 1. Construction of pRSFDuet-rfp+α1,2FucT gene expression vector

[0032] The sequences of the galactosyltransferase (rfp) gene sequence from Shigella dysenteriae type 1 pathogen (S.dysenteriae 1) and the α1,2 fucosyltransferase gene (α1,2FucT) from Helicobacter pylori were synthesized respectively. The nucleotide sequence of the α1,2 fucosyltransferase gene (α1,2FucT) is shown in SEQ ID NO.1, and the nucleotide sequence of the galactosyltransferase gene is shown in SEQ ID NO.2.

[0033] The nucleotide sequence of the α(1,2) fucosyltransferase gene fragment is as follows:

[0034] GATTTTAAAATCGTGCAGGTTCATGGCGGTCTGGGCAACCAGATGTTTCAGTATGCGTTCGCCAAAAGCCTGCAGACCCACCTGAACATTCCGGTGCTGCTGGATACCACGTGGTTTGATTACGGCAATCGTGAACTGGGTCTGCATCTGTTCCCGATCGATCTGCAGTGCGCATCTGCGCAGCAGATTGCGGCCGCACACATGCAGAATCTGCCGCGTCTGGTTCGTGGTGCACTGCGTCGCATGGGCCTGGGTCGCGTGAGCAAAGAAATCGTTTTTGAATATATGCCGGAACTGTTCGAACCGTCTCGTATTGCCTATTTTCATGGTTACTTCCAGGACCCGCGCTACTTTGAAGATATCAGCCCGCTGATTAAACAGACCTTCACGCTGCCGCATCCGACGGAACACGCAGAACAGTATAGTCGTAAACTGAGCCAGATCCTGGCGGCCAAAAACAGTGTGTTTGTTGCAATTCGTCGCGGCGATTACATGCGCCTGGGTTGGCAGCTGGATATCAGCTATCAGCTGCGTGCCATTGCATACATGGCGAAACGCGTGCAGAACCTGGAACTGTTTCTGTTCTGCGAAGATCTGGAATTTGTGCAGAATCTGGATCTGGGCTATCCGTTCGTTGATATGACCACGCGTGATGGTGCAGCGCATTGGGATATGATGCTGATGCAGTCTTGTAAACACGGTATTATCACCAACAGCACGTATTCTTGGTGGGCCGCATACCTGATCAAAAACCCGGAAAAAATCATCATCGGCCCGAGTCATTGGATCTACGGTAACGAAAACATCCTGTGTAAAGATTGGGTTAAAATCGAATCTCAGTTCGAAACCAAAAGT(SEQ ID NO.1).

[0035] The nucleotide sequence of the galactosyltransferase gene is shown below:

[0036]

[0037] The α1,2 fucosyltransferase gene (α1,2FucT) nucleotide sequence was inserted between the NdeI and BamHI sites of the pET15b vector to synthesize the plasmid pET15b-α1,2FucT (the above was synthesized and verified by Qingke Biotechnology Co., Ltd.); the galactosyltransferase (rfp) gene sequence was inserted between the NdeⅠ and XhoⅠ sites of the pRSFDuet-1 vector to synthesize the recombinant expression vector pRSFDuet-rfp (the above was synthesized and verified by Qingke Biotechnology Co., Ltd.).

[0038] Using pET15b-α1,2FucT as a template, primers (F-5'-CTTTAATAAGGAGATATACCATGGGCAGCAGCCATCATC-3' (SEQ ID NO.3), R-5'-TGGTGATGGCTGCTGCCCATTTAACTTTTGGTTTCGAACTGAGATT-3' (SEQ ID NO.4)) were designed for PCR amplification to obtain the α1,2FucT target gene fragment; using pRSFDuet-rfp as a template, primers (F-5'-ATGGGCAGCAGCCATCACC-3' (SEQ ID NO.5); R-5'-GGTATATCTCCTTATTAAAGTTAAACAAAATTA-3' (SEQ ID NO.6)) were designed for PCR amplification to obtain the linearized pRSFDuet-rfp.

[0039] The cloned α1,2FucT fragment was inserted into the recombinant expression vector pRSFDuet-rfp by homologous recombination to obtain a new expression vector pRSFDuet-rfp+α1,2FucT, whose nucleotide sequence is shown in SEQ ID NO.9.

[0040] 2. Construction of recombinant E. coli strains

[0041] The basic method is to transform the constructed recombinant plasmid pRSFDuet-rfp+α1,2FucT into Escherichia coli K-12W3110, so that it endogenously expresses rfp and α1,2FucT genes, thereby obtaining a recombinant Escherichia coli with a lipopolysaccharide structure that terminally expresses Fuc-α1,2-Gal.

[0042] The E. coli K-12W3110 has the genotype of W3110ΔwbbL, as the function of WbbL is interrupted due to the insertion of the inserter IS5.

[0043] In another specific embodiment of the present invention, based on the characteristics of the structure and synthesis pathway of lipopolysaccharide (LPS) of Escherichia coli, the α1,2FucT gene from the genome of Helicobacter pylori and the rfp (galactosyltransferase) gene from the multi-copy free plasmid of Shigella dysenteriae type 1 pathogen are expressed in Escherichia coli, and the nucleotide oligosaccharide of Escherichia coli is used as a donor to obtain a lipopolysaccharide structure with Fuc-α1,2-Gal at the end, providing a platform for further research on engineering bacteria. Among them, the α1,2FucT gene is not limited to the genome sourced from Helicobacter pylori, but can also be its homologous sequence or a nucleic acid molecule capable of expressing the same protein, and the rfp gene is not limited to the genome sourced from Shigella dysenteriae type 1 pathogen, but can also be its homologous sequence or a nucleic acid molecule capable of expressing the same protein.

[0044] In another specific embodiment of the present invention, a method for producing extracellular polysaccharide of fucose-α1,2-galactose is provided, comprising the following steps:

[0045] 1. Fermentation of recombinant Escherichia coli

[0046] A single colony of the constructed recombinant strain (K-12W3110-rfp+α1,2FucT) was picked and placed in LB medium with a final kana concentration of 50 μg / mL, 37°C, 200 rpm / min, and cultured for 12 h.

[0047] The overnight culture was inoculated into a flask containing LB medium at a 1% (v / v) inoculation volume, with a final kana concentration of 50 μg / mL. The culture was carried out at 37°C, 200 rpm / min, and cultured for 12 h. 600 =0.6, add IPTG with a final concentration of 0.2 mM, and culture at 16°C, 180 rpm for 20 h to induce expression.

[0048] 2. Extraction of lipopolysaccharide (LPS)

[0049] Ensure bacterial concentration OD 600 =0.8-1.2, which is convenient for extracting LPS. Centrifuge the bacterial solution at room temperature at 12000rpm for 30 seconds, discard the supernatant, and harvest the bacterial cells. Use an LPS extraction kit to extract LPS from recombinant E. coli.

[0050] In another specific embodiment of the present invention, there is provided use of the above-mentioned genetically engineered bacteria in the preparation of drugs for preventing or treating immune-related diseases, and further, the drugs include vaccines.

[0051] In another specific embodiment of the present invention, a microbial agent is provided, comprising the above-mentioned genetically engineered bacteria and acceptable adjuvants or auxiliary agents.

[0052] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0053] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0054] General description: The nucleic acid molecular weight standard 1kb Marker and protein molecular weight standard (18-120kDa) involved in the following examples were purchased from ABclonal; the plasmid extraction kit and agarose gel DNA fragment recovery kit were purchased from Qingke Biotechnology, and the operation was carried out in full accordance with the corresponding instructions. Plasmid construction and gene sequencing were completed by Qingke Biotechnology. The starting bacteria Escherichia coli K-12W3110 came from Invitrogen; DH5α competent cells were purchased from Qingdao Branch of Beijing Qingke Biotechnology Co., Ltd.; LPS (Lipopolysaccharide) Extraction Kit was purchased from iNtRONBIOTECHNOLOGY; CaCl 2 The reagents and consumables were purchased from domestic reagent companies. Unless otherwise specified, other experimental methods and reagents in the examples are conventional methods and commercially available reagents in the art.

[0055] The LB liquid medium and solid medium: 10.0 g of tryptone, 5.0 g of yeast extract, 5.0 g of sodium chloride (NaCl), 10 mM NaOH, and deionized water to 1 L. After packaging, steam sterilization was performed at 121° C. under high pressure for 20 minutes. The solid medium was prepared by adding 1.5% agar to the liquid medium, and other conditions remained unchanged.

[0056] Example 1 Construction of PRSFDuet / rfp+α1,2FucT gene expression vector

[0057] 1. The sequences of the galactosyltransferase (rfp) gene from Shigella dysenteriae type 1 pathogen (S.dysenteriae 1) and the α1,2 fucosyltransferase gene (α1,2FucT) from Helicobacter pylori were synthesized respectively. The nucleotide sequence of the synthesized α1,2 fucosyltransferase gene (α1,2FucT) is shown in SEQ ID NO.1, and the nucleotide sequence of the galactosyltransferase gene is shown in SEQ ID NO.2.

[0058] 2. Insert the α1,2 fucosyltransferase gene (α1,2FucT) nucleotide sequence between the NdeI and BamHI sites of the pET15b vector to synthesize the plasmid pET15b-α1,2FucT (the above was synthesized and verified by Qingke Biotechnology Co., Ltd.); insert the galactosyltransferase (rfp) gene sequence between the NdeⅠ and XhoⅠ sites of the pRSFDuet vector to synthesize the recombinant expression vector pRSFDuet-rfp (the above was synthesized and verified by Qingke Biotechnology Co., Ltd.).

[0059] 3. Using pET15b-α1,2FucT as a template, primers (F-5'-CTTTAATAAGGAGATATACCATGGGCAGCAGCCATCATC-3' (SEQ ID NO.3), R-5'-TGGTGATGGCTGCTGCCCATTTAACTTTTGGTTTCGAACTGAGATT-3' (SEQ ID NO.4)) were designed for PCR amplification to obtain the α1,2FucT target gene fragment; using pRSFDuet-rfp as a template, primers (F-5'-ATGGGCAGCAGCCATCACC-3' (SEQ ID NO.5); R-5'-GGTATATCTCCTTATTAAAGTTAAACAAAATTA-3' (SEQ ID NO.6)) were designed for PCR amplification to obtain the linearized pRSFDuet-rfp.

[0060] 4. The cloned α1,2FucT fragment was inserted into the recombinant expression vector pRSFDuet-rfp by homologous recombination to obtain a new expression vector pRSFDuet-rfp+α1,2FucT, whose nucleotide sequence is shown in SEQ ID NO.9.

[0061] The PCR amplification reaction system and reaction procedure are shown in Tables 1 and 2.

[0062] Table 1 PCR amplification reaction system

[0063] Components Volume (μL) Phanta Max Super-Fidelity DNA Polymerase 1 2×Phanta Max Buffer 25 dNTP Mix (10 μM each) 1 Upstream primer (10 μM) 2 Downstream primer (10 μM) 2 Template DNA 1 <![CDATA[ddH 2 The]]> Make up to 50 μL

[0064] Table 2 PCR reaction program

[0065]

[0066] The primer concentration was 20 μmol / L.

[0067] After 1% agarose gel electrophoresis, the target band was recovered using an agarose gel kit and homologous recombination was performed. The homologous recombination reaction system is shown in Table 3.

[0068] Table 3 Homologous recombination reaction system

[0069] Components Volume (μL) 2.5×OK Clon Master Mix 4 Linearized vector 3 Insert 0.5 <![CDATA[ddH 2 The]]> up to 10μL

[0070] Reaction conditions: 50°C, 10 min.

[0071] After the reaction, DH5α competent cells were used for transformation. The transformation process was as follows: 10 μL of the reaction solution was added to 100 μL of DH5α competent cells and mixed. Ice bath for 30 min, heat shock at 42°C for 90 s, ice bath for 2 min, add 900 μL of LB medium, 37°C, 200 rpm shaking culture for 1 h, spread on kana resistance plates, culture for 12 h, pick transformants, perform colony PCR, and respectively perform α1,2FucT (primer is F-5'-CTTTAATAAGGAGATATACCATGGGCAGCAGCCATCATC-3' (SEQ ID NO.3),

[0072] R-5'-TGGTGATGGCTGCTGCCCATTTAACTTTTGGTTTCGAACTGAGATT-3'(SEQ ID NO.4)) and rfp (primer is F-5'-GGAATTCCATATGAAGATCTCAATAATAGGGAAC-3'(SEQ ID NO.7),

[0073] R-5'-CCGCTCGAGTTAATCAGGAATCCCTAGTA-3'(SEQ ID NO.8)) was amplified, and then further sequenced to verify the correctness of the plasmid, thereby obtaining the recombinant plasmid pRSFDuet-rfp+α1,2FucT. The colony PCR reaction system and reaction procedure are shown in Tables 4 and 5.

[0074] Table 4 Colony PCR reaction system

[0075] Components Volume (μL) 2×Taq Master Mix 12.5 Forward Primer 2 Reverse primer 2 template 2.5 <![CDATA[ddH 2 The]]> up to 25μL

[0076] Table 5 Colony PCR reaction procedure

[0077]

[0078] After the reaction was completed, the amplification results were detected by 1% agarose gel electrophoresis.

[0079] Example 2 Construction of recombinant Escherichia coli strains

[0080] (1) Preparation of competent E. coli K-12W3110

[0081] (I) Take out the Escherichia coli W3110 strain stored in the ultra-low temperature refrigerator, streak it on solid LB medium, and culture it upside down at 37°C overnight;

[0082] (II) Pick a single colony from the plate and add it to 5 mL of liquid LB medium (without antibiotics) and culture at 37°C with shaking for 12 h;

[0083] (III) Take an appropriate amount of the above seed culture medium and inoculate it into 50 mL of new liquid LB medium and continue to culture until the culture OD 600 =0.4-0.5;

[0084] (IV) Transfer the bacterial solution to a pre-cooled 50 mL centrifuge tube, place on ice for 10 min, centrifuge at 4500 rpm for 10 min at 4°C, discard the supernatant, and collect the bacterial cells;

[0085] (V) Add 30 mL of pre-cooled CaCl 2 solution, resuspend the cells, centrifuge at 4500 rpm for 10 min at 4°C, discard the supernatant, and collect the cells;

[0086] (VI) Add 10 mL of pre-cooled CaCl 2 Solution, suspend the bacteria, dispense 100 μL into sterile centrifuge tubes, and store in an ultra-low temperature refrigerator for later use.

[0087] (2) Construction of recombinant Escherichia coli strains

[0088] After transformation with DH5α competent cells, a single colony was picked and inoculated into 5 mL LB medium, shaken and cultured for 8 h, the plasmid was extracted, 2 μL was taken and transformed into Escherichia coli K-12W3110 competent cells, and kana resistance (final concentration of 50 μg / mL) was used to screen and obtain the recombinant strain K-12W3110 / rfp+α1,2FucT.

[0089] Example 3 Extraction and analysis of recombinant Escherichia coli lipopolysaccharide (LPS)

[0090] (1) Fermentation of recombinant Escherichia coli

[0091] A single colony of the constructed recombinant strain (K-12W3110 / rfp+α1,2FucT) was picked and placed in a test tube containing 5 mL of LB medium, with a final kana concentration of 50 μg / mL, and cultured at 37°C, 200 rpm, for 12 h.

[0092] The overnight culture was inoculated into a flask containing 50 mL of LB medium at a 1% (v / v) inoculation volume. The final concentration of kana was 50 μg / mL. The culture was carried out at 37°C, 200 rpm / min, and cultured for 12 h. 600 =0.6, add IPTG with a final concentration of 0.2 mM, and culture at 16°C, 180 rpm for 20 h to induce expression. The starting strain of Escherichia coli K-12W3110 was induced at the same time as a negative control.

[0093] (2) Extraction of lipopolysaccharide (LPS)

[0094] (Ⅰ) Ensure bacterial concentration OD 600 =0.8-1.2, which is convenient for extracting LPS. Take 1-5mL of bacterial solution and centrifuge at room temperature at 12000rpm for 30 seconds, discard the supernatant, and harvest the bacterial cells. Use the LPS extraction kit to extract LPS from recombinant E. coli.

[0095] (II) Add 1 mL of Lysis buffer to the bacterial pellet and vortex vigorously to resuspend the cells.

[0096] (III) Add 200 μL of chloroform, vortex thoroughly, and incubate at room temperature for 5 min;

[0097] (IV) Centrifuge at 12000 rpm for 15 min at 4°C, and transfer 400 μL of supernatant into a new 1.5 mL centrifuge tube;

[0098] (V) Add 800 μL of Purification Buffer, mix well by pipetting, and incubate at -20°C for 10 min;

[0099] (VI) Centrifuge at 12000 rpm for 15 min at 4°C and discard the supernatant;

[0100] (VII) Wash the LPS particles with 1 mL of 70% ethanol, centrifuge at 12,000 rpm for 3 min at 4°C, carefully discard the supernatant, and air-dry at room temperature;

[0101] (VIII) Add 50 μL of 10 mM Tris-HCl (pH = 8.0) to the LPS particles and boil for 2 min;

[0102] (Ⅸ) Add 2.5 μL of proteinase K solution (30 mg / mL) and treat at 50°C for 30 min;

[0103] (Ⅹ) Take 10 μL of sample and add 2.5 μL of protein loading buffer and boil in water for 10 min.

[0104] (3) Analysis of lipopolysaccharide (LPS)

[0105] The extracted and purified lipopolysaccharide samples were analyzed by SDS-PAGE and identified by silver staining and lectin blotting. Lectin Blotting detection uses Biotin-UEA as the primary antibody and streptavidin as the secondary antibody for detection and analysis. Lipopolysaccharide shows ladder-like bands due to the addition of Fuc-α1,2-Gal-α1,3-GlcNAc with different chain lengths, and can be recognized by Biotin-UEAⅠ. The negative control E.coli K-12W3110 has an O16 defective type due to the insertion of the insert IS5, which interrupts the function of WbbL. The result is that there is only one GlcNAc residue at the end of E.coli K-12W3110 LPS, which cannot be recognized by Biotin-UEA Ⅰ. In addition, LPS monosaccharide analysis showed that it contains fucose and galactose, the results are shown in Figure 1. Figure 3 , Figure 4 .

[0106] Example 4 Chemoenzymatic Labeling of Recombinant Escherichia coli

[0107] (1) Dilute the bacterial solution to OD with 0.01M PBS (pH = 7.4) 600 =0.6, take 200 μL of bacterial suspension into a 1.5 mL centrifuge tube;

[0108] (2) Add 500 μM UDP-GalNAz and 10 mM MgCl to the bacterial solution. 2 and 1 μg / μL enzyme, react at 37°C for 40 min, and centrifuge at 10,000 rpm for 3 min;

[0109] (3) Add 200 μL PBS to resuspend the precipitate, centrifuge at 10,000 rpm for 3 min, and obtain the precipitate again;

[0110] (4) Repeat the above steps once more;

[0111] (5) Add 200 μL PBS to resuspend the pellet, and add 50 μM biotin and 50 μM CuSO to the bacterial suspension. 4 , incubate at room temperature for 40 min;

[0112] (6) Perform centrifugation washing three times;

[0113] (7) Resuspend the pellet with 200 μL PBS, add 1 μL streptavidin-FITC, and incubate in the dark at room temperature for 40 min;

[0114] (8) Perform centrifugation washing three times;

[0115] (9) Resuspend the pellet in 200 μL PBS for fluorescence imaging under an inverted microscope.

[0116] The results showed that the self-constructed recombinant strain (K-12W3110-rfp+α1,2FucT) was fluorescently labeled, while W3110ΔwbbL was not fluorescently labeled. Figure 5 .

[0117] Based on the above determination of LPS extracted from recombinant E. coli and the monosaccharide composition results, it can be concluded that the recombinant E. coli described in the present invention can produce a lipopolysaccharide structure with Fuc-α1,2-Gal at the end, and this engineering bacterium can be used to further conduct a more in-depth study on the disaccharide structure.

[0118] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria endogenously express an α(1,2) fucosyltransferase gene and / or a galactosyltransferase gene, and the α(1,2) fucosyltransferase gene and / or a galactosyltransferase gene has any of the nucleotide sequences (a1) to (a3): (a1) the nucleotide sequence shown in SEQ ID NO.1 and / or SEQ ID NO.2; (a2) a nucleotide sequence complementary to (a1); (a3) A nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule of (a2) and which can encode a protein with the same or similar function.

2. The genetically engineered bacterium according to claim 1, characterized in that The genetically engineered bacteria is Escherichia coli.

3. The method for constructing a genetically engineered bacterium according to any one of claims 1 to 2, characterized in that: The method comprises transferring the recombinant expression vector into the host bacteria.

4. The construction method according to claim 3, characterized in that: The method for preparing the recombinant expression vector comprises: connecting the α(1,2) fucosyltransferase gene and the galactosyltransferase gene into a plasmid.

5. The construction method according to claim 4, characterized in that: The pRSFDuet-1 vector was used in the construction of the plasmid.

6. The construction method according to claim 3, characterized in that: The host bacteria is Escherichia coli K-12W3110.

7. A method for producing an extracellular polysaccharide of fucose-α1,2-galactose, characterized in that: The method comprises the following steps: culturing the genetically engineered bacteria according to claim 2; and separating the extracellular polysaccharide of fucose-α1,2-galactose from the obtained culture.

8. The production method according to claim 7, characterized in that Inducers were added during the culture process.

9. Use of the genetically engineered bacteria according to any one of claims 1-2 or the genetically engineered bacteria obtained by the construction method according to any one of claims 3-6 in the preparation of drugs for preventing or treating immune-related diseases, wherein the drugs include vaccines.

10. A microbial agent, characterized in that: The invention comprises the genetically engineered bacteria as claimed in claim 1 and acceptable auxiliary materials or additives.

Images