Endogenous short enhancer element for increasing gene transcription level in rice and application thereof

Abstract

The present application provides a rice endogenous short enhancer capable of realizing site-specific activation of a plant genome, which realizes efficient activation of a gene by directional insertion into a promoter region of the plant gene. Specifically, the present inventors obtain 20 short enhancers from rice with different activation multiples through a large number of screenings, which can realize activation effects in different reporter genes and have universality. The rice enhancer of the present application can be used for efficiently and flexibly regulating transcription of complex genes of rice and the like plants.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and plant genetic engineering, and specifically to rice endogenous short enhancer elements that enhance gene transcription at the gene transcription level. Background Technology

[0002] Gene overexpression is one of the most important and widely used techniques in plant research and breeding, typically relying on transgenic technology. However, this method is severely limited by the size of the open reading frame (ORF) sequence inserted into the expression vector. Furthermore, it faces numerous problems and limitations due to the use of exogenous strong promoters and the resulting T-DNA insertion; moreover, it is difficult to precisely activate the expression of specific genes using this method. Genome editing technology has opened new avenues for gene research and plant breeding, but it is primarily used for gene knockout; recently, dCas9-based gene overexpression has also been validated and used in various plants. However, the in vivo application of dCas9-based activation remains underexplored because activation efficiencies vary greatly between different targets. Some studies have also focused on broadly randomizing promoters to activate target genes. However, the specificity of editing between different gene promoters limits the versatility of this technique.

[0003] Gene editing technology allows for the targeted insertion of specific short enhancers at appropriate gene locations to activate plant genes. However, currently, there are relatively few enhancers applicable to plants, and even fewer universal enhancers. Furthermore, in practical production and experiments, to achieve different levels of gene activation, it is necessary to discover more enhancers with varying activation folds.

[0004] Therefore, there is an urgent need in this field to develop universal enhancers that can efficiently activate plant genes. Summary of the Invention

[0005] The purpose of this invention is to provide universal, highly efficient rice endogenous enhancers that can activate plant genes. These enhancers achieve efficient gene activation through site-specific insertion into a specific region of the promoter of a target gene. Specifically, this invention provides 20 universal transcriptional enhancers from rice with different activation folds that can achieve activation effects in various reporter genes.

[0006] In a first aspect of the invention, a short enhancer (STE) element for enhancing gene transcription is provided, said short enhancer (STE) element being derived from rice and being a short nucleotide sequence having a non-palindromic structure and promoter activation function.

[0007] In another preferred embodiment, the length of the short enhancer (STE) element is 30-800 bp.

[0008] In another preferred embodiment, the length of the rice short enhancer is 40-600 bp.

[0009] In another preferred embodiment, the length of the rice short enhancer is 60-200 bp.

[0010] In another preferred embodiment, the sequence of the short enhancer (STE) element is as shown in any one of SEQ ID NO:1-20.

[0011] In another preferred embodiment, the sequence of the short enhancer (STE) is selected from the group consisting of:

[0012] (Z1) Polynucleotides as shown in any one of SEQ ID NO:1-20;

[0013] (Z2) is a polynucleotide whose nucleotide sequence is ≥95% homology (preferably ≥98%) to any of the sequences shown in SEQ ID NO:1-20 and has promoter activation function;

[0014] (Z3) A polynucleotide having 1-30 (preferably 1-20, more preferably 1-10) nucleotides truncated at the 5' and / or 3' ends of any of the polynucleotides shown in SEQ ID NO:1-20, and having promoter activation function.

[0015] In a second aspect of the invention, a genetically engineered promoter is provided, wherein the promoter is a transcriptional enhancement effector region upstream of the transcription start site in the original promoter in which the short enhancer (STE) element described in the first aspect of the invention is inserted.

[0016] In a third aspect of the invention, a recombinant expression cassette is provided, the expression cassette comprising the genetically engineered promoter described in the second aspect of the invention and a target gene operatively linked to the promoter.

[0017] In another preferred embodiment, the expression cassette is a linear nucleic acid construct.

[0018] In a fourth aspect of the invention, a vector is provided, the vector containing the short enhancer (STE) element described in the first aspect of the invention, the genetically engineered promoter described in the second aspect of the invention, or the recombinant expression cassette described in the third aspect of the invention.

[0019] In another preferred embodiment, the carrier is an expression carrier.

[0020] In another preferred embodiment, the vector comprises a plasmid.

[0021] In a fifth aspect of the invention, a genetically engineered host cell is provided, said host cell containing the vector described in the fourth aspect of the invention;

[0022] Alternatively, the host cell genome may contain the short enhancer (STE) element described in the first aspect of the present invention, the genetically engineered promoter described in the second aspect of the present invention, or the recombinant expression cassette described in the third aspect of the present invention.

[0023] In another preferred embodiment, the host cell includes a plant cell.

[0024] In another preferred embodiment, the host cell is a somatic cell.

[0025] In another preferred embodiment, the host cell includes a prokaryotic or eukaryotic cell.

[0026] In another preferred embodiment, the host cell includes Agrobacterium.

[0027] In a sixth aspect of the present invention, a method for preparing transgenic plants is provided, comprising the steps of:

[0028] (a) Providing a transgenic plant cell or plant callus, wherein the plant cell or plant callus contains the vector described in the fourth aspect of the present invention; or wherein the genome of the cell is integrated with the short enhancer (STE) element described in the first aspect of the present invention, the genetically engineered promoter described in the second aspect of the present invention, or the recombinant expression cassette described in the third aspect of the present invention; and

[0029] (b) Regenerating the plant cells or plant callus into a plant.

[0030] In a seventh aspect of the invention, a kit is provided, the kit comprising the following reagents:

[0031] (a) the short enhancer (STE) element described in the first aspect of the present invention, the genetically engineered promoter described in the second aspect of the present invention, the recombinant expression cassette described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention; or Agrobacterium containing said vector; and

[0032] (b) Gene editing reagents for editing genes at predetermined locations in the promoter corresponding to the transcriptional enhancement effector region upstream of the transcription start site.

[0033] In another preferred embodiment, the gene editing reagent comprises (1) a Cas enzyme; and / or (2) a gRNA or its coding sequence corresponding to the predetermined position.

[0034] In an eighth aspect of the invention, a method for increasing the transcription level of a target gene is provided, the method comprising:

[0035] (i) For the target gene whose expression is to be enhanced, identify the promoter operatively linked to the target gene and the transcription start site of the target gene; and

[0036] (ii) Inserting a short enhancer (STE) element as described in the first aspect of the invention into the transcriptional enhancement effector region of the target gene, thereby increasing the transcriptional level of the target gene in a predetermined cell or plant;

[0037] The transcriptional enhancement region is the area from -5 to -1500 bp upstream of the transcription start site of the target gene.

[0038] In another preferred embodiment, the insertion of short enhancer (STE) elements is performed using gene editing.

[0039] In another preferred embodiment, the gene editing employs a Cas enzyme.

[0040] In another preferred embodiment, in step (ii), the insertion of the short enhancer (STE) element is performed by gene editing of plant cells in vitro or by gene editing of the plant plant.

[0041] In another preferred embodiment, the inserted short enhancer (STE) element is used to perform gene editing on the plant during the flowering period.

[0042] In another preferred embodiment, the short enhancer (STE) element is inserted at a location 10 to 800 bp upstream of the transcription start site of the target gene.

[0043] In another preferred embodiment, the short enhancer (STE) element is inserted at a location 20 to 500 bp upstream of the transcription start site of the target gene.

[0044] In another preferred embodiment, the method includes the steps of:

[0045] (a) Providing a short enhancer (STE) element as described in the first aspect of the invention;

[0046] (b) Select an insertion site in the transcriptional enhancement region of the target gene and use a site-specific cleavage nuclease to cleave the insertion site.

[0047] (c) Insert the short enhancer (STE) element from step (a) into the insertion site after cutting in step (b) in the recipient plant cell.

[0048] In another preferred embodiment, the site-specific cleavage is achieved by converting a DNA fragment encoding a site-specific cleavage nuclease into a plant receptor, thereby enabling the receptor cells to express the nuclease and thus cleaving the insertion site.

[0049] In another preferred embodiment, the DNA fragment encoding a site-specific cleavage nuclease is a DNA fragment expressing a CRISPR / Cas9 element.

[0050] In another preferred embodiment, the DNA fragment encoding the site-specific cleavage nuclease is introduced into the recipient plant via a gene gun or by Agrobacterium-mediated transformation, thereby performing site-specific cleavage.

[0051] In another preferred embodiment, the short enhancer (STE) element may be inserted into the insertion site either in the forward or reverse direction.

[0052] In another preferred embodiment, the short enhancer (STE) element is introduced into the recipient plant via a gene gun or via Agrobacterium-mediated transformation and integrated into the insertion site.

[0053] In another preferred embodiment, the short enhancer (STE) element is integrated into the insertion site via a non-terminal connection mechanism.

[0054] In another preferred embodiment, when a higher fold increase in transcriptional activation is required, the short enhancer (STE) element is inserted in a region 1 to 100 bp upstream of the transcription start site of the target gene; when a lower fold increase in transcriptional activation is required, the short enhancer (STE) element is inserted in a region 500 to 1500 bp upstream of the transcription start site of the target gene.

[0055] In a ninth aspect of the invention, a plant cell is provided, which is a plant cell treated with the method described in the eighth aspect of the invention, wherein the expression level of a specific target gene is upregulated.

[0056] In another preferred embodiment, the plant is selected from the group consisting of: rice, soybean, tomato, corn, tobacco, wheat, sorghum, salvia miltiorrhiza, and alfalfa.

[0057] In another preferred embodiment, the plant is rice.

[0058] In another preferred embodiment, the target gene is a plant endogenous gene.

[0059] In another preferred embodiment, the target gene is a single gene or multiple genes.

[0060] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0061] Figure 1A reporter system was established in rice using luciferase as the reporter gene, with nLUC driven by the 35S promoter as an internal control and firefly luciferase (fLuc) as the dualLUC reporter gene.

[0062] Figure 2 The invention demonstrates the activation effect of 20 rice STEs inserted into three different promoters on transcription.

[0063] Figure 3 This diagram illustrates the insertion of the short transcription enhancer STEos0005 at position -66 upstream of the transcription start site in the rice RFT1 gene locus. Yellow indicates the inserted STE; red numbers mark the distance of the STE insertion site relative to the TSS.

[0064] Figure 4 The activation effect of STEos0005 on the rice RFT1 gene is shown. The top figure shows the activation effect on the rice RFT1 gene at the transcriptional level; the bottom figure shows the phenotype of the activation effect on the rice EUI gene. Detailed Implementation

[0065] Through extensive and in-depth research and screening, the inventors have, for the first time, screened a class of highly versatile and efficient enhancer-like enhancers (STEs or STE elements) in rice. Specifically, the inventors screened 20 short enhancers (STEs) with different activation effects in rice. By targeting and inserting them into specific locations within a range of the gene promoter (i.e., predetermined locations upstream of the TSS), efficient activation of the gene was achieved, resulting in a significant enhancement of its expression level. This invention was completed based on this achievement.

[0066] The rice short enhancer (STE) element of the present invention

[0067] As used herein, the terms "rice short transcription enhancer of the present invention," "rice short enhancer of the present invention," "rice STE of the present invention," "rice endogenous STE of the present invention," "STE element of the present invention," and "rice STE element of the present invention" are used interchangeably and all refer to the enhancer element derived from rice that can efficiently enhance plant gene expression in the present invention. When the STE element of the present invention is inserted into the promoter region, it can significantly increase or upregulate the expression of the target gene operatively linked to the promoter. The STE of the present invention is shorter than that of conventional enhancers, and is therefore simply referred to as a short enhancer. Since the STE of the present invention does not rely on palindromic structures, it is a non-palindromic STE.

[0068] Typically, the lower limit (L) of the length of the rice short reinforcing element of the present invention minThe length of the fragment (L) of the rice short enhancer in this invention is at least 100 bp, such as ≥100 bp, ≥130 bp, ≥150 bp, ≥200 bp, or ≥300 bp. Furthermore, the upper limit of the fragment length (L) of the rice short enhancer in this invention is... max The length of the STE is at most 800bp, such as ≤700bp, ≤600bp, ≤500bp, ≤200bp, ≤150bp, ≤100bp. Preferably, the length of the STE of the present invention can be any of the above lower limits (L). min ) and upper limit (L) max The value should be reasonably determined, for example, 100-800bp, preferably 100-300bp, and more preferably 120-200bp.

[0069] Preferably, the non-palindromic STE of the present invention does not contain any palindromic structures in its structure; more preferably, it does not contain any palindromic structures of 6-20 bp or longer. The inventors' research shows that the presence of palindromic structures can lead to an inability to effectively enhance plant gene expression.

[0070] As used herein, the term "palindrome" refers to a double-stranded DNA structure containing two identical but oppositely oriented sequences, where each single strand reads identically to the other strand read in the opposite direction. Typically, in a palindrome, the identical and oppositely oriented sequences are at least 6 bp or at least 8 bp in length.

[0071] The names, lengths, and sequences of the preferred rice short enhancers of this invention are shown in the table below.

[0072]

[0073]

[0074]

[0075] When the STE element of this invention is introduced or inserted at different positions upstream of the TSS of different promoters, it can efficiently improve the driving efficiency of the original promoter, thereby significantly enhancing the transcription and expression of the target gene. Furthermore, when the introduction or insertion site of the STE element of this invention is approximately close to the TSS, the degree (or fold increase) of transcriptional activation is even higher.

[0076] The STE transcriptional enhancement effector region of the present invention

[0077] In numerous experiments, the inventors unexpectedly discovered that inserting a short enhancer into a suitable region of a gene promoter can significantly increase the expression level of that gene. This suitable region is named the STE transcriptional enhancement effector region. Inserting the STE element of this invention into the STE transcriptional enhancement effector region can efficiently activate the expression of the target gene.

[0078] Experiments show that the STE element of this invention, when introduced or inserted at different positions upstream of the TSS of different promoters, can universally and efficiently improve the driving efficiency of the original promoter, thereby significantly enhancing the transcription and expression of the target gene. Furthermore, the location of the insertion site (or introduction site) affects the activation efficiency. The activation level of the gene by STE is highly correlated with the distance of the insertion site from the transcription start site (TSS); insertion sites closer to the TSS show higher activation levels.

[0079] For a given promoter, there are no particular restrictions on the transcriptional enhancement effector region suitable for insertion into the STE element of this invention, as long as it is upstream of the TSS. Typically, the 3' end of the transcriptional enhancement effector region can be located upstream of the TSS at positions such as -1, -5, -10, -20, -40, -50, -100, -200, and -300. The 5' end of the transcriptional enhancement effector region can be located upstream of the TSS at positions such as -50, -100, -200, -400, -500, -800, -1000, and -1500. Preferably, the transcriptional enhancement effector region of this invention can be reasonably determined by the aforementioned 3' and 5' end positions, for example, positions from -1 to -1500, and positions from -5 to -100.

[0080] Preferably, in this invention, the transcriptional enhancement effector region is a region 5-1000 bp upstream of the transcription start site (TSS), a region 10-800 bp upstream, and more preferably, a region 20-500 bp upstream. When the TSS is taken as the origin, the suitable introduction site for STE in this invention is -5 to -1000 nt, preferably -10 to -800 nt, and more preferably -20 to -500 nt.

[0081] Furthermore, the closer the introduction or insertion site of the STE element of this invention is to the TSS, the higher the degree (or fold increase) of transcriptional activation. This unexpected characteristic is unique to the STE element of this invention; therefore, the transcriptional enhancement effect of the STE element of this invention is adjustable. That is, the transcriptional activation effect corresponding to a predetermined enhancement fold can be obtained by adjusting the introduction site of the STE element of this invention. When a higher fold increase in transcriptional activation effect is required, the STE element of this invention can be inserted immediately upstream of the TSS, for example, at positions -1 to -100, -5 to -80, or -10 to -60. When a higher fold increase in transcriptional activation effect is required, the STE element of this invention can be inserted 100 positions upstream of the TSS, for example, at positions -100 to -500, -120 to -400, or -150 to -300. When a lower fold of transcriptional activation is required, the STE element of this invention can be inserted 500 positions upstream of the TSS, for example, -500 to -1500, or -600 to -1200, or -700 to -1000 positions.

[0082] It should be understood that when inserting the STE element of this invention into the STE transcriptional enhancement effector region of a promoter (such as a plant promoter), a certain number of original nucleotides (such as 1-50 nt of the original sequence) can be deleted on one or both sides of the insertion site, or the original nucleotide sequence can be left undeleted. Research in this invention shows that the deletion of a small number of nucleotides at the insertion site does not affect the enhancing function of the STE element of this invention.

[0083] In this invention, one or more STE elements of this invention can be inserted into the STE transcriptional enhancement effector region of a promoter (such as a plant promoter), such as 1-3, preferably 1-2. When two or more STE elements of this invention are inserted, these STE elements can be adjacent or spaced apart by a certain distance.

[0084] application

[0085] The rice STE element of this invention can be used for in-locus activations, that is, a universal method for upregulating the expression of target genes by targeting the transcriptional enhancement effector region of target genes with the rice short enhancer (STE) element of this invention. This method can efficiently and universally enhance the driving efficiency of plant endogenous promoters, thereby enhancing the expression of the corresponding plant endogenous genes.

[0086] Furthermore, the promoters, constructs, or expression cassettes containing the STE element of this invention can also be used to express exogenous genes in plants, thereby improving agronomic traits (such as the quality of edible parts, leaf shape, leaf color, flower shape, flower color, etc.) or enhancing the plant's resistance to adverse environments (such as freezing, high temperature, drought, rice, pathogens, pests, or artificial herbicides). This invention can also be used to produce specific protein products (such as antigen proteins and biological agents) in plants, or to study the specific functions of exogenous genes in plant parts (such as leaves and floral organs) (such as their effects on mesophyll cell development or floral organ formation, etc.).

[0087] The in-situ activation technology of this invention has high efficiency, wide applicability and stable heritability, and can be used as a potential alternative to traditional transgenic overexpression in plant research and breeding.

[0088] The main advantages of this invention include:

[0089] (1) Through extensive screening, this invention has obtained several short rice enhancers that can efficiently activate plant genes. These enhancers can activate target genes to varying degrees, with enhancement effects ranging from 2 to 2000 times. Different short rice enhancers of this invention can be selected as needed to achieve regulated activation of genes.

[0090] (2) The rice short enhancer of the present invention can activate different types of genes, including genes that are not suitable for ectopic expression, such as genes with long ORFs and genes that are difficult to amplify, and has versatility.

[0091] (3) The rice short enhancer inserted into the gene of the present invention has stable heritability, and its activation effect can be stably passed on to offspring.

[0092] (4) The rice short enhancer of the present invention can not only achieve efficient activation of a single gene, but also achieve activation of multiple genes.

[0093] (5) The rice short enhancer of the present invention has a high tolerance for the insertion site. The STE element of the present invention can be inserted and function in a large region upstream of the promoter. Moreover, even if the insertion site is slightly deviated, it can still exert an enhancement effect.

[0094] (6) The rice short enhancer of the present invention has wide applicability in different plants and has broad application prospects in plant research and breeding.

[0095] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to the conditions described in the conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0096] General methods and materials

[0097] (1) STE mining and data analysis

[0098] The JASPAR database (https: / / jaspar.genereg.net) was used to mine potential transcription factor (TF) binding sites at different locations in the genome, comprehensively collecting transcription factor binding motifs from different genes. TFs with a relative score higher than 90% were selected to ensure high specificity. The promoter regions of different genes were obtained from the rice genome (MSU 7.0), and the upstream regions of transcription start sites were screened using 1 kb. ggplot2 was used to further visualize the density of TF binding sites and identify segments with high activity-enhancing effects.

[0099] (2) Carrier construction

[0100] CRISPR-P2.0 was used to select the best-performing target, and the corresponding oligonucleotide aptamers were designed. The target plasmid pCBSG032 and the oligonucleotide aptamers were assembled and ligated using Golden Gate Assembly. First, a 25 μL reaction system was established containing 50 ng of the pCBSG032 vector and 0.05 pmol of the oligonucleotide aptamer, and the following thermal cycling conditions were applied: 37 °C for 5 min, then 16 °C for 5 min, repeated 30 times, followed by incubation at 60 °C for 5 min. The assembled plasmid was directly transformed into *E. coli* (Novizan Biotechnology Co., Ltd.) to generate the CRISPR-Cas9 plasmid. For the reporter vectors p35Smini-dualLUC, pEUI-dualLUC, and pRFT1-dualLUC, the pCambia1300-LUC vector was used as the backbone. The upstream 2K sequences of EU (LOC_05g40384) and RFT1 (LOC_06g06300) were amplified and cloned into the target plasmid using Gibson assembly. The vector containing the candidate STE was amplified using the same method and cloned into the target region.

[0101] (3) Plant materials and culture conditions

[0102] CRISPR-Cas9 edited rice line (Oryza sativa L.) ssp. japonica Xiushui134 (XS134) was planted in experimental fields in Shanghai, China (31.13°N, 121.28°E) from May to October and in Hainan, China (18.25°N, 109.50°E) from January to April.

[0103] (4) Isolation and transformation of protoplasts

[0104] One hundred shelled rice seeds were inverted in 75% ethanol for about 1 minute, then rinsed with sterile water. The seeds were then inverted in 50% sodium hypochlorite solution for 20 minutes, followed by rinsing four times with sterile water. Sterile seeds were germinated on 1 / 2 MS medium and grown in the dark at 26-28℃ for 8-12 days. Transformation of rice protoplasts was performed using conventional methods. The average transformation efficiency was 70-80%, using 20 μg of sgRNA plasmid. Rice protoplasts were transformed using the above method. An average of 10 seeds were transformed per vector. 5 Each protoplast uses 10 μg of transiently validated plasmid per transformation, with an average transformation efficiency of 70-80%.

[0105] (5) Dual-luciferase gene reporter system

[0106] A schematic diagram of the construction of a dual-luciferase gene reporter system is shown below. Figure 1 As shown. Using firefly luciferase (nLuc) as an internal control, Luciferase (fLuc) is a reporter gene, and the activation effect of enhancers is assessed by the fLuc / nLuc ratio.

[0107] use The Discover System (Promega) was used to measure fluorescence in a dual-luciferase reporter assay system. Specifically, different reporter gene plasmids were transfected into 100 μL (10⁶ ml⁻¹) of rice protoplasts. Transfection was performed using PEG4000, and after incubation for 12–16 hours, centrifugation and washing were followed by the addition of 100 μL (1×) lysis buffer (Promega) to the protoplasts. After incubation for 15 minutes, an equal volume of 80 μL ONE-Glo was added to each well of a 96-well plate. TM After incubating with EX reagent (Promega) for approximately 3 minutes to detect firefly luciferase activity, add an equal volume of NanoDLR to each well. TM Stop & Add the reagent (Promega) and mix thoroughly. Add an equal volume of NanoDLR to each well as the original culture medium. TM Stop & Reagent (Promega) reagent and mix thoroughly to detect NanoLuc luciferase activity.

[0108] (6) Stable transformation of rice

[0109] CRISPR-Cas9 plasmids carrying the target were extracted using the midipreps Volume Kit (Tiangen) and diluted to 1 μg / μl. The plasmid and donor DNA were mixed (1 μg plasmid + 2 pmol donor for a single STE insertion, each STE containing 1 μg plasmid + 1 pmol donor for multiple different STE-KI lines), then 50 μL of Gold-Micro solution (60 mg / ml) was added and bombarded. Biotransformation was performed using a PDS1000 / He particle bombardment system (Bio-Rad) at a target distance of 6.0 cm from the stop plate and a helium pressure of 7.5 MPa. One-month-old rice XS134 callus was used for transformation. Hygromycin B (50 mg / L; YEASEN) was used to select hygromycin-resistant callus. Plantlets were regenerated from hygromycin-resistant callus using conventional rice transformation methods.

[0110] (7) Mutant Identification Methods

[0111] Genomic DNA was extracted from leaves using the CTAB method. The mutant products were purified and amplified using touchdown PCR. The PCR products were then analyzed using Hi-TOM to identify the mutations. Plantlets with a Hi-TOM chimerism rate higher than 1% were identified as valid inserts. Results were compared between different mutations and the predicted full-length insertion (WT) results.

[0112] (8) RNA extraction and RT-qPCR

[0113] Total RNA was extracted from transgenic seedling leaves using the RNA Isolator Total RNA Extraction Reagent (Novizan Biotechnology Co., Ltd.). Reverse transcription was performed using oligomeric (dT) primers and M-MLV reverse transcriptase (TransGen Biotech), followed by quantitative PCR (qPCR) experiments using designed primers. Each reverse transcription-quantitative PCR (RT-qPCR) experiment was repeated at least three times with three independent RNA preparations. The rice ACT1 gene was used as an internal control.

[0114] Example 1: Screening of endogenous STEs in rice

[0115] To explore effective endogenous STEs in rice, 13 endogenous rice housekeeping genes were selected. The upstream segment of the TSS of each gene was truncated to a length of 130 bp, resulting in a total of 78 fragments. Each fragment was constructed into three different promoters, generating a total of 234 reporter plasmids. In vitro transformation was performed using rice protoplasts for validation.

[0116] A reporter system was established in rice using luciferase as the reporter gene, with nLUC driven by the 35S promoter serving as the control and firefly luciferase (fLuc) serving as the dualLUC reporter gene. (See schematic diagram below.) Figure 1 Three different promoters—miniCMV promoter, rice EUI promoter, and rice RFT1 promoter—were used to compare the activation potential and stability of different STEs. For the validated candidate STEs with activation effects, their key motifs were analyzed to derive shorter STEs with effective activation levels.

[0117] Ultimately, 20 STEs with activating effects were successfully screened from genes such as CDC48E, EFA1, TCTP, and GapC3, and named STEos0001-STEos0020. These endogenous STEs have broad applicability for gene activation.

[0118] Example 2: Activation effect of rice STE in three different reporter vectors

[0119] The activation effects of the rice STE of the present invention on reporter genes were compared using the reporter system described in Example 1, with nLUC driven by the 35S promoter as a control and firefly luciferase (fLuc) as the dualLUC reporter gene. The activation potential of different STEs was compared using three different promoters: the miniCMV promoter (SEQ ID NO:21), the rice EUI promoter (SEQ ID NO:22), and the rice RFT1 promoter (SEQ ID NO:23).

[0120] The results are as follows Figure 2 As shown in Tables 1-3, the results indicate that the STE of this invention exhibits different folds of gene activation effects on reporter genes.

[0121] Table 1. Activation effects of different rice STEs in the 35S mini promoter.

[0122]

[0123]

[0124] Table 2. Activation effects of different rice STEs in the rice EUI promoter.

[0125]

[0126] Table 3. Activation effects of different rice STEs on the rice RFT1 promoter.

[0127]

[0128] Example 3: Highly efficient activation effect of rice STE in rice cells

[0129] To verify the gene activation effect of STE in vivo, STEos0005 was inserted at position -66 upstream of the TSS of the rice RFT1 gene (see...). Figure 3 RFT1 is a flowering-related gene that primarily induces the reproductive development of the shoot apical meristem (SAM).

[0130] STEos0005 insert material was successfully obtained at the designated site of RFT1, and several homozygous insert plants were found. RFT1 was significantly upregulated in these plants: in plants #6-1, #6-8, and #6-13, the transcriptional level of the RFT1 gene was increased by approximately 50-fold, and it could directly induce spikelet development in regenerated callus cells. Figure 4 ).

[0131] The above results indicate that rice STE can be used to directly regulate cellular processes in vivo, and the STE of this invention produced a very significant phenotype for high-level activation of RFT1.

[0132] sequence

[0133] miniCMV promoter (SEQ ID NO:21):

[0134] ATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTTCATTTCATTTGGAGAGA

[0135] Rice EUI promoter (SEQ ID NO:22):

[0136]

[0137] Rice RFT1 promoter (SEQ ID NO:23):

[0138]

[0139] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A short enhancer (STE) element for enhancing gene transcription, characterized in that, The short enhancer (STE) element is derived from rice and is a short nucleotide sequence with a non-palindromic structure and promoter activation function; the sequence of the short enhancer (STE) element is shown in any one of SEQ ID NO: 1-3, 7, 10-15, 18-20.

2. The short enhancer (STE) element as described in claim 1, characterized in that, The sequence of the short enhancer (STE) element is shown in any one of SEQ ID NO:1-3.

3. The short enhancer (STE) element as described in claim 1, characterized in that, The sequence of the short enhancer (STE) element is shown in SEQ ID NO:

1.

4. A genetically engineered promoter, characterized in that, The promoter is a transcriptional enhancement effector region corresponding to the transcription start site upstream of the original promoter containing the short enhancer (STE) element as described in claim 1.

5. A recombinant expression cassette, characterized in that, The expression cassette includes the genetically engineered promoter of claim 4 and the target gene operatively linked to the promoter.

6. A carrier, characterized in that, The vector contains the short enhancer (STE) element as described in claim 1, the genetically engineered promoter as described in claim 4, or the recombinant expression cassette as described in claim 5.

7. A genetically engineered host cell, characterized in that, The host cell contains the vector as described in claim 6; Alternatively, the host cell genome may contain the short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 4, or the recombinant expression cassette of claim 5.

8. A method for preparing transgenic plants, characterized in that, Including the following steps: (a) Providing a transgenic plant cell or plant callus, said plant being rice; wherein the plant cell or plant callus contains the vector of claim 6; or wherein the short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 4, or the recombinant expression cassette of claim 5 is integrated into the genome of said cell; and (b) Regenerate the plant cells or plant callus into a plant.

9. A reagent kit, characterized in that, The kit contains the following reagents: (a) The short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 4, the recombinant expression cassette of claim 5, the vector of claim 6; or Agrobacterium containing the vector; and (b) Gene editing reagents for editing genes at predetermined locations in the promoter corresponding to the transcriptional enhancement effector region upstream of the transcription start site.

10. A method for increasing the transcription level of a target gene, characterized in that, The method includes: (i) For the target gene whose expression is to be enhanced, identify the promoter operatively linked to the target gene and the transcription start site of the target gene; and (ii) Inserting the short enhancer (STE) element as described in claim 1 into the transcriptional enhancement effector region of the target gene, thereby increasing the transcriptional level of the target gene in a predetermined cell or plant; The transcriptional enhancement region is the area from -5 to -1500 bp upstream of the transcription start site of the target gene; The cells are rice cells, and the plant is rice.

11. The method as described in claim 10, characterized in that, The method includes the following steps: (a) Providing the short enhancer (STE) element as described in claim 1; (b) Select an insertion site in the transcriptional enhancement region of the target gene and use a site-specific cleavage nuclease to cleave the insertion site. (c) Inserting the short enhancer (STE) element from step (a) into the insertion site after cutting in step (b) in a recipient plant cell; the plant cell is a rice cell.

12. The method as described in claim 10, characterized in that, In step (ii), inserting a short enhancer (STE) element involves gene editing of plant cells in vitro or gene editing of the plant itself; the plant cells are rice cells, and the plant is rice.

13. The method as described in claim 10, characterized in that, The inserted short enhancer (STE) element is used to perform gene editing on the plant during the flowering period.

14. A plant cell, characterized in that, The plant cells are plant cells treated with the method described in claim 10, wherein the expression level of a specific target gene is upregulated; the plant cells are rice cells.

Images