Nucleic acid-based delivery systems and uses thereof

Abstract

Compositions and methods including synthetic delivery systems utilizing polynucleotides are provided. For example, the polynucleotides disclosed herein can facilitate binding, uptake, nuclear transport, and / or genomic integration of components of the synthetic delivery system, such as cargo.

Description

[0001] Cross-references

[0002] This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 369,913, filed on July 29, 2022, and U.S. Provisional Patent Application No. 63 / 506,800, filed on June 7, 2023, each of which is incorporated herein by reference in its entirety. Background Art

[0003] Transposable elements (TEs or transposons) are DNA sequences that can change position within the genome. The relationship of transposable elements to the onset of disease is not well understood.

[0004] Tumor-derived cell-free DNA may contain genetic alterations associated with tumorigenesis, suggesting that circulating tumor-derived DNA (ctDNA) acts as a medium for genetic exchange between tumor cells. It has been proposed that ctDNA can transfer oncogenic mutations to reshape the tumor microenvironment. However, the underlying processes and mechanisms remain poorly understood. Summary of the invention

[0005] In some embodiments, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs:73-75.

[0006] In some embodiments, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO: 73.

[0007] In some embodiments, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO: 13 or 14.

[0008] In some embodiments, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence comprises (a) a nucleotide sequence having at least 90% sequence identity with at least 60 consecutive nucleotides of SEQ ID NO:33, or (b) a nucleotide sequence having at least 91% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:33.

[0009] In some embodiments, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence comprises an AluSp, AluSx, AluSg2, ERV2 superfamily or ERV3 superfamily transposable element or a functional fragment thereof, and the transposable element or a functional fragment thereof promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0010] In some embodiments, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the polynucleotide comprises a nucleotide sequence having at least 86% sequence identity to any one of SEQ ID NOs: 7, 16, 25, 29 and 31.

[0011] In some embodiments, disclosed herein is a method for delivering a cargo to a target cell, the method comprising contacting the target cell with a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to the target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO: 13 or 14.

[0012] In some embodiments, disclosed herein is a method for delivering a cargo to a target cell, the method comprising contacting the target cell with a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to the target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises (a) a nucleotide sequence having at least 90% sequence identity to at least 60 consecutive nucleotides of SEQ ID NO: 33, or (b) a nucleotide sequence having at least 91% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO: 33.

[0013] In some embodiments, disclosed herein is a method for delivering a cargo to a target cell, the method comprising contacting the target cell with a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence comprises an AluSp, AluSx, AluSg2, ERV2 superfamily or ERV3 superfamily transposable element or a functional fragment thereof, and the transposable element or a functional fragment thereof promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0014] In some embodiments, disclosed herein is a method for delivering a cargo to a target cell, the method comprising contacting the target cell with a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to the target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the polynucleotide comprises a nucleotide sequence having at least 86% sequence identity to any one of SEQ ID NOs: 7, 16, 25, 29 and 31.

[0015] In some embodiments, disclosed herein is a method of treating a condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 10 consecutive nucleotides of SEQ ID NO: 13 or 14.

[0016] In some embodiments, disclosed herein is a method for treating a condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises (a) a nucleotide sequence having at least 90% sequence identity to at least 60 consecutive nucleotides of SEQ ID NO:33, or (b) a nucleotide sequence having at least 91% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO:33.

[0017] In some embodiments, disclosed herein is a method for treating a condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence comprises an AluSp, AluSx, AluSg2, ERV2 superfamily or ERV3 superfamily transposable element or a functional fragment thereof, and the transposable element or a functional fragment thereof promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0018] In some embodiments, disclosed herein is a method of treating a condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the polynucleotide comprises a nucleotide sequence having at least 86% sequence identity to any one of SEQ ID NOs: 7, 16, 25, 29 and 31.

[0019] In some aspects, disclosed herein is a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 10 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0020] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 15 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 20 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 30 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 50 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 75 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 100 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 15 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 20 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 30 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to at least 75 consecutive nucleotides of any one of SEQ ID NOs: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to at least 100 consecutive nucleotides of any one of SEQ ID NOs: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-78.In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-78. In some embodiments, the polynucleotide comprises a nucleotide sequence of any one of SEQ ID NOs: 1-78.

[0021] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide, wherein the polynucleotide comprises a transposable element, and the transposable element is AluSp, MER11C, AluY, 2L2a, ALluY, ALR / Alpha, ALU, AluJb, AluS1, AluSc8, AluSg, ALUSg2, AluSq, AluSq2, ALUSx, AluSx, AluSx1, AluSz, AluSz6, AluYc3, ASLUSq2, ERVK / LTR, ERVL, ERVL-MaLR, FLAM_C and AluY, HERV17-int, HERV9N-int, L1M1, L1MB3, L1ME4b, L1MEg, L1P1, L1P3, L1PA10, L1PA15, L1PA7, L1PB4, L2a, L2a / LTR40b / MLT1J2, LINE / L1, LINE / L2, LTR, LTR / ERV1, LTR / ERVL, LTR / ERVL-MaLR, LTR / Gypsy, LTR41C, LTR81B, Mam_R4, Mamr4, Many, MER11B, MER41E, MIR, MIRB, MIRc, MIRc-part of L2, MLT1J2, MLT2B1, MLT1J2, MLT2B4, parAluSp-FULLMTL1J2, REP522, Satellite / centr, SINE / Alu, SINE / MIR, THE1A, THE1B, THE1C, or Tigger3a transposable element.

[0022] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide that directs the migration of the synthetic delivery system to a target cell, wherein the polynucleotide comprises a nucleic acid sequence identified in circulating tumor DNA (ctDNA) from a cell type substantially similar to the target cell, wherein the nucleic acid sequence comprises a short interspersed nuclear element (SINE), a long interspersed nuclear element (LINE), ERVL, or ERVK transposable element.

[0023] In some embodiments, the polynucleotide comprises an AluSp transposable element. In some embodiments, the polynucleotide comprises a MER11C transposable element. In some embodiments, the polynucleotide comprises an AluSx transposable element. In some embodiments, the polynucleotide comprises an MLT1J transposable element. In some embodiments, the polynucleotide comprises an AluSg2 transposable element. In some embodiments, the polynucleotide comprises a THE1A transposable element. In some embodiments, the polynucleotide comprises an AluJb transposable element. In some embodiments, the polynucleotide comprises an MLT2B4 transposable element. In some embodiments, the polynucleotide comprises an L2a transposable element. In some embodiments, the polynucleotide comprises an MLT1J2 transposable element. In some embodiments, the polynucleotide comprises an AluSq transposable element. In some embodiments, the polynucleotide comprises an L1MB3 transposable element. In some embodiments, the polynucleotide comprises a THE1C transposable element. In some embodiments, the polynucleotide comprises an AluY transposable element. In some embodiments, the polynucleotide is a double-stranded DNA. In some embodiments, the synthetic delivery system further comprises a cargo. In some embodiments, the cargo comprises a nucleic acid cargo. In some embodiments, the nucleic acid cargo is attached to the 3' end of the polynucleotide. In some embodiments, the nucleic acid cargo is attached to the 5' end of the polynucleotide. In some embodiments, the synthetic delivery system comprises a promoter. In some embodiments, the nucleic acid cargo encodes a tumor suppressor protein. In some embodiments, the cargo comprises a cytotoxic cargo. In some embodiments, the cargo comprises a therapeutic cargo. In some embodiments, the synthetic delivery system does not utilize viral vectors, nanoparticles, lipid nanoparticles, liposomes, exosomes, dendrimers, gene guns, or electroporation.

[0024] In some embodiments, the present disclosure provides a method of delivering a cargo to a target cell, the method comprising contacting the target cell with the pharmaceutical composition or synthetic delivery system as described in any one of the preceding embodiments.

[0025] In some embodiments, the cargo is delivered to the nucleus of the target cell. In some embodiments, the synthetic delivery system further comprises a transposon integration signal. In some embodiments, the cargo comprises a nucleic acid cargo. In some embodiments, the nucleic acid cargo is integrated into the genome of the target cell. In some embodiments, the nucleic acid cargo is integrated into the genome of the target cell at a position identified in Table 2, Table 4, Table 7, or Table 8. In some embodiments, the nucleic acid cargo is integrated into the genome of the target cell at Chr2:32916224-32916626. In some embodiments, the nucleic acid cargo is integrated into the target cell genome at Ch16:32628381-32629000. In some embodiments, the target cell is a leukocyte. In some embodiments, the target cell is a plasma cell. In some embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a multiple myeloma cell. In some embodiments, the target cell is a pancreatic cell. In some embodiments, the target cell is a pancreatic cancer cell. In some embodiments, the target cell is a gastrointestinal cell. In some embodiments, the target cell is a colorectal cancer cell.

[0026] In some embodiments, the present disclosure provides a method of treating a subject in need thereof, the method comprising administering to the subject the pharmaceutical composition of any one of the preceding embodiments.

[0027] Incorporation by reference

[0028] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1A The acquisition of nucleotide variants in cells co-cultured with ctDNA is shown. Comparative SNV analysis is performed between cell genome, ctDNA and ctDNA-cell co-culture. The Venn diagram shows the exclusive and shared SNVs between each experimental condition. The outlined area highlights the SNVs commonly shared between ctDNA and ctDNA / cell co-culture conditions.

[0030] Figure 1B Stacked bar graphs are shown showing the change in allele depth for variant (light grey) and reference (dark grey) alleles in ctDNA, cell line genomes, and co-culture conditions. Cells in co-culture conditions have deeper depths in variant alleles at several positions compared to the control cell genome.

[0031] Figure 2A An indexed IVG variant calling image and its allele frequencies in a pancreatic cancer experimental condition are shown. The horizontal bar represents the alternative nucleotide indicated below, and the light grey represents the reference nucleotide.

[0032] Figure 2B An indexed IVG variant calling image and its allele frequencies in multiple myeloma experimental conditions are shown. The horizontal bar represents the alternative nucleotides indicated below, and the light grey represents the reference nucleotide.

[0033] Figure 2C An indexed IVG variant calling image and its allele frequencies in multiple myeloma experimental conditions are shown. The horizontal bar represents the alternative nucleotides indicated below, and the light grey represents the reference nucleotide.

[0034] Figure 2D An indexed IVG variant calling image and its allele frequencies in a pancreatic cancer experimental condition are shown. The horizontal bar represents the alternative nucleotide indicated below, and the light grey represents the reference nucleotide.

[0035] Figure 3A A BLAST alignment image is shown showing insertion transition points between cell genome contigs (dark boxes) and ctDNA contigs (light boxes) for pancreatic cancer and multiple myeloma ctDNA. Results were obtained after comparing contigs carrying insertions in co-culture conditions to the reference cell genome.

[0036] Figure 3B A BLAST alignment image is shown showing the insertion transition points between the cell genome contigs (dark boxes) and the ctDNA contigs (light boxes) of multiple myeloma ctDNA. The results were obtained after comparing the contigs carrying the insertions in the co-culture condition with the reference cell genome.

[0037] Figure 3C A BLAST alignment image is shown showing the insertion transition point between the cell genome contigs (dark boxes) and the ctDNA contigs (light boxes) of pancreatic cancer ctDNA. The results were obtained after comparing the contigs carrying the insertion in the co-culture condition with the reference cell genome.

[0038] Figure 4 A summary of the distribution of transposon-containing contigs and the fraction of transposons observed at the 5' or 3' end in inserted versus non-inserted ctDNA fragments is shown.

[0039] Figure 5A Illustrative common retrotransposon subfamilies and classes located at insertion sites in pancreatic cancer ctDNA are shown.

[0040] Figure 5B Illustrative common retrotransposon subfamilies and classes located at insertion sites in multiple myeloma ctDNA are shown.

[0041] Fig. 6A Expression levels of selected transposable elements in tumor samples are shown.

[0042] Figure 6B Expression levels of selected transposable elements in tumor samples are shown.

[0043] Figure 7 The effect of reverse transcriptase inhibitors or integrase inhibitors on ctDNA chromatid integration is shown.

[0044] Figure 8 Shown is an agarose gel of the PCR products of the transposon after incubation of the transposon construct in complete medium for 4 hours followed by PCR.

[0045] Fig.9A The time course of MM1s cells treated with Cy5-AluSp and Cy5-control sequences (1 μg / mL) is shown. CY5(+) cells were detected by flow cytometry.

[0046] Fig. 9B Results of a dose titration experiment of MM1s cells treated with Cy5-AluSp and Cy5-control sequences are shown.Before flow cytometry, half of the samples were treated with trypsin to identify how much DNA was internalized.

[0047] Fig. 9C Shown is the capture and internalization of different multiple myeloma retrotransposons and controls by MM1s cells after 4 hours of culture, as assessed by flow cytometry.

[0048] Fig.9D Shown is the capture and internalization of different multiple myeloma retrotransposons and controls by U266 cells after 4 hours of culture, as assessed by flow cytometry.

[0049] Fig.10 Illustrative flow cytometry plots are provided showing cellular capture of AluSp, MER11, and control transposon sequences in plasma cells (CD138+) and non-plasma cells (CD138-) derived from the bone marrow of a multiple myeloma patient.

[0050] Fig.11 The percentage of cells positive for fluorescently labeled AluSp, MER11, control sequence or PC-specific transposon sequence after 14 hours of incubation with bone marrow from multiple myeloma patients or normal bone marrow is shown. Data for plasma cells (CD138+) and non-plasma cells (CD138-) are shown separately.

[0051] Fig. 12A The effect of 5' or 3' deletion on the internalization of Cy5-labeled AluSp by MM1s cells is illustrated. Images were captured 8 hours after culturing cells with the retrotransposon.

[0052] Fig. 12B An image of a gel showing the deletion of AluSp is provided.

[0053] Fig. 12C is a graphical representation of adenine (A)-thymine (T) and guanine (G)-cytosine (C)-rich regions, or both, identified by multiple sequence alignments of AluSp and other MM-specific transposons.

[0054] Fig.13 Microscope images of MM1s cells cultured with AluSp-CMV-mCherry, CMV-mCherry linear vector or cells transfected with CMV-mCherry circular vector are provided. Images were captured 24 hours after co-culture with DNA.

[0055] Fig.14A is a bar graph showing a summary of the number of mCherry genomic insertions identified in MM1s cells expressing high levels of mCherry, medium levels of mCherry, or no mCherry (n=5 cells / group).

[0056] Fig. 14B is an agarose gel showing PCR bands indicating mCherry integration of chromatin extracted from cells treated with AluSp-CMV-mCherry cassette or control-CMV-mCherry cassette. * Non-specific band.

[0057] Fig. 14C The confidence in detecting the identified insertions is shown relative to the number of samples in which a particular insertion site was detected.

[0058] Fig.15 Shown are cell viability of 3 different cell lines co-cultured with TE-HSV-Tk-GFP for 24 hours before adding ganciclovir (GCV). Apoptosis was measured 96 hours after adding GVC. MM: multiple myeloma, CC: colon cancer, and PC: pancreatic cancer, TE-CMV-GFP: transposon element connected to CMV-GFP, HSV-TK: herpes simplex virus thymidine kinase. The error bars in the box whisker diagram indicate the standard deviation of triplicate experiments.

[0059] Fig.16Shown are the results of a cell viability assay measuring sensitivity to gemcitabine in pancreatic cancer cell lines (MIA and ASPC-1) cultured with plasma from gemcitabine-resistant patients, similar plasma pretreated with DNase I, or plasma from control non-cancer patients. For the corresponding DNase I-treated samples, plasma was treated with DNase I for 10 minutes. GR: gemcitabine-resistant.

[0060] Fig.17 Shown is a comparison of cell viability responses to bortezomib in OPM1 cells cultured with plasma from patients who failed to respond to bortezomib treatment, control plasma in combination with ctDNA from the same patient who was resistant to bortezomib, and control plasma alone (non-cancer patient) (top left); comparison of viability responses of RPMI to control plasma or control plasma with added ctDNA obtained from patients who achieved complete remission to bortezomib (middle); comparison of cell viability assessments of MM1s cells after bortezomib treatment, cultured with plasma from a bortezomib-resistant patient (BR#2) alone or after treatment with DNase I or co-culture with ctDNA from a different bortezomib-resistant (BR#1) patient (right). BR: bortezomib-resistant, BS: bortezomib-sensitive. Error bars indicate standard deviations of triplicate experiments.

[0061] Fig.18A A bar graph comparing cell capture results of synthetic, CY5-labeled retrotransposon sequences derived from multiple myeloma (MM) ctDNA to controls is provided. The data are grouped by cell line. In each case, the bars presented are from left to right: control, followed by synthetic MM-derived DNA (MM01, MM02, MM03, MM04, and ZIP2). The horizontal line defines the control cutoff.

[0062] Fig.18B Provided is a bar graph comparing the cell capture results of the synthetic, CY5-labeled retrotransposon sequence derived from pancreatic ductal adenocarcinoma (PDAC) ctDNA with the control. The data are grouped by cell line. In each case, the bars presented are from left to right: control, followed by synthetic PDAC-derived DNA (PC01, PC02, PC03, PC21, PC22, PC23, PC24). The horizontal line defines the control cutoff value.

[0063] Fig.19Fluorescence microscopy images showing uptake of fluorescently labeled synthetic DNA derived from multiple myeloma ctDNA (MM2(1-290), MM2(89-290), MM2(177-290) and MM2(1-201) and MM2(1-113)) or control sequences are provided.

[0064] Fig. 20 Fluorescence microscopy images are provided evaluating the uptake of fluorescently labeled synthetic DNA derived from multiple myeloma ctDNA (MM2(1-290), MM2(89-290), MM2(177-290) and MM2(1-201) and MM2(1-113)) by multiple myeloma / B cell lines (MM1S and RPMI) and cell lines of other cell types (HFF-fibroblasts, DU145-prostate cancer, MCF10A breast).

[0065] Fig.21 Microscopy images showing uptake of 5' fluorescently labeled synthetic DNA fragments derived from multiple myeloma ctDNA by MM cells (JK6L) or non-MM cells are provided. DETAILED DESCRIPTION

[0066] Provided are compositions and methods comprising synthetic delivery systems utilizing polynucleotides disclosed herein.For example, the polynucleotides disclosed herein can facilitate the binding, uptake, nuclear transport and / or genomic integration of components of the synthetic delivery system, such as cargo.

[0067] The synthetic delivery systems disclosed herein can utilize polynucleotides that promote cell-specific horizontal gene transfer (HGT) between cells (e.g., human cancer cells). Gene transfer between cells can play physiological and pathological roles in certain organisms. For example, HGT has been characterized in prokaryotes, where HGT can provide survival and evolutionary advantages for environmental stressors. The evidence for HGT in mammals and humans is much more limited, as is the understanding of the underlying mechanisms involved.

[0068] Tissue-specific retrotransposons are identified herein, which can mediate the process of targeting genetic material and delivering it to cells similar to the cell origin of ctDNA by circulating tumor DNA (ctDNA). Compositions and methods provided herein include synthetic delivery systems, which utilize polynucleotides to promote the combination, uptake, nuclear transport and / or genomic integration of components (e.g., goods) of synthetic delivery systems. The compositions and methods can be used to deliver goods to cells, including specific cell types and cancer cells.

[0069] I. Synthetic Delivery Systems

[0070] Disclosed herein are synthetic delivery systems that can provide, for example, cell, tissue and / or organ-specific targeting, delivery, combination, uptake, nuclear localization and / or genomic integration of goods. Compositions and methods provided herein include synthetic delivery systems that utilize polynucleotides to promote the combination, uptake, nuclear transport and / or genomic integration of components (e.g., goods) of synthetic delivery systems. Described compositions and methods can be used for delivering goods to cells, including specific cell types and cancer cells.

[0071] The synthetic delivery system disclosed herein can include polynucleotides. The synthetic delivery system can include, for example, polynucleotides and goods. The polynucleotides can be or can include double-stranded DNA (dsDNA). In some embodiments, the polynucleotides include single-stranded DNA. In some embodiments, the polynucleotides include RNA.

[0072] The polynucleotides of the present disclosure, their sequences or parts thereof (e.g., recognition and / or integration sequences) can be from or derived from nucleic acid sequences of biological samples (e.g., blood, plasma or tissue samples of subjects (such as humans)). The polynucleotides of the present disclosure, their sequences or parts thereof (e.g., recognition and / or integration sequences) can be from or derived from cancer cells or tissues. The polynucleotides can be recombinant or synthetic, e.g., not isolated from biological samples.

[0073] The polynucleotides or a portion thereof (e.g., recognition and / or integration sequences) in the synthetic delivery system can be derived from or derived from, for example, circulating tumor DNA (ctDNA) from humans. The ctDNA can comprise double-stranded DNA (dsDNA). In some embodiments, the ctDNA comprises single-stranded DNA. Such ctDNA or a fragment thereof can comprise a nucleic acid sequence that can have the ability to target a cell or cell population and induce the binding, uptake, nuclear localization and / or genomic integration of the polynucleotides or goods disclosed herein.

[0074] The polynucleotides in the synthetic delivery system of goods delivered to the target cell can include or derive from the nucleotide sequence of ctDNA.ctDNA can be derived from the same cell type or tissue type as the target cell.The polynucleotides for delivering goods to the target cell can include or derive from the nucleotide sequence of ctDNA of the cell type substantially the same as the target cell or substantially the same tissue type.The polynucleotides for delivering goods to the target cell can include or derive from the nucleotide sequence of ctDNA of the cell type substantially similar to the target cell or substantially similar tissue type.For example, ctDNA or its components (for example, subsequence or recognition sequence) from multiple myeloma can be used to generate a synthetic delivery system for delivering goods, combining, taking in, nuclear localization and / or genome integration to multiple myeloma target cells or related target cells or target cell types.ctDNA or its components (for example, subsequence or recognition sequence) from pancreatic cancer can be used to generate a synthetic delivery system for delivering goods, combining, taking in, nuclear localization and / or genome integration to pancreatic cancer target cells or related target cells or target cell types. The ctDNA or its components (e.g., subsequences or recognition sequences) from colorectal cancer can be used to generate a synthetic delivery system for cargo delivery, binding, uptake, nuclear localization and / or genomic integration to colorectal cancer target cells or related target cells or target cell types. The ctDNA or its components (e.g., subsequences or recognition sequences) from lung cancer can be used to generate a synthetic delivery system for cargo delivery, binding, uptake, nuclear localization and / or genomic integration to lung cancer target cells or related target cells or target cell types.

[0075] The synthetic delivery system, polynucleotide, nucleic acid sequence, recognition sequence, integration sequence or cargo can comprise natural or non-natural nucleotide analogs or bases or combinations thereof. The nucleotide analogs can comprise one or more modifications at one or more of the ribose moiety, the phosphate moiety, the nucleoside moiety or a combination thereof. Nucleotide analogs or bases can include 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-O—N-methylacetamido (2'-O-NMA) modified locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-anhydrohexanol nucleic acid (HNA), morpholine, methylphosphonic acid nucleotide, mercaptophosphonic acid nucleotide, or 2'-fluoro N3-P5'-phosphoramidite. The polynucleotide can include one or more abasic sites. Abasic sites can be functionalized with a detectable moiety.

[0076] The synthetic delivery system, polynucleotide, first nucleic acid sequence or second nucleic acid sequence can comprise a recognition sequence that can provide cell-specific targeting and / or uptake of the polynucleotide, synthetic delivery system or cargo. In some embodiments, the recognition sequence binds to a receptor that mediates the uptake of ctDNA and / or synthetic delivery system or is associated with the uptake. In some embodiments, the recognition sequence of ctDNA, synthetic delivery system or polynucleotide specifically or preferentially binds to a receptor associated with the uptake of ctDNA and / or synthetic delivery system.

[0077] In some embodiments, compared with control cells, recognition sequences promote the preferential binding of synthetic delivery systems, polynucleotides or goods to target cells. In some embodiments, compared with control cells, recognition sequences promote the preferential uptake of ctDNA, synthetic delivery systems, polynucleotides or goods by target cells. In some embodiments, compared with control cells, recognition sequences promote the preferential binding, uptake, nuclear localization and / or genomic integration of ctDNA, synthetic delivery systems, polynucleotides or goods by target cells. Control cells can be cells of, for example, different cell types (e.g., cell types disclosed herein). In some embodiments, target cells are cancer cells, and control cells are non-cancerous cells. In some embodiments, target cells are cancer cells of the first cell type, and control cells are cancer cells of the second cell type. In some embodiments, target cells are cancer cells of the first cell type, and control cells are non-cancerous cells of the second cell type.

[0078] The recognition sequence may be or may comprise a functional fragment and / or variant of a sequence disclosed herein. For example, the recognition sequence may comprise a subset of nucleotides from a nucleotide sequence disclosed herein, which promotes preferential binding to target cells compared to control cells; preferential uptake by target cells compared to control cells; preferential nuclear localization compared to control cells; and / or preferential integration into the genome of target cells compared to control cells. In some embodiments, the recognition sequence comprises a functional fragment and / or variant of a sequence disclosed herein, which retains at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the target cell binding, uptake, nuclear localization, and / or genomic integration activity of the nucleotide sequence from which the fragment and / or variant is derived.

[0079] For example, in some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence disclosed herein is a functional fragment and / or variant of SEQ ID NO: 68 or SEQ ID NO: 78 (ACCCGGCCTTGGACACGCCATTTTCAACTCCGTGGTGCGTTTT TTTTTTTTTTTTTTTTTTTTTTGTAATGGAGTTTTGCTCTTGTTGCCCAGGATGGAGTGCAAGGGATCTTGGCTCACCACAGCCTCTGCCTCCTGGGTTCAAGTGATTCTTCTGCCTCAGCCTCCCAAGTAGCTGGGATTATAAGCACCCACCACCACGCCCAGCTAATTTTGTATTTTTTAGAAGAGATGGAGTTTCTCCAGTTGGCCAGGATGGTCTGTATATCCTGACCTCATGATCTGCCCACCA), wherein the functional fragment and / or variant comprises a functional fragment and / or variant from SEQ ID NO: 68 or SEQ ID NO:78, the nucleotide subset promotes preferential binding to target cells compared to control cells; preferential uptake by target cells compared to control cells; preferential nuclear localization compared to control cells; and / or preferential integration into the genome of target cells compared to control cells. In some embodiments, the recognition sequence comprises a functional fragment and / or variant of SEQ ID NO:68 or SEQ ID NO:78, and the functional fragment and / or variant retains at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the target cell binding, uptake, nuclear localization and / or genomic integration activity of SEQ ID NO:68 or SEQ ID NO:78.

[0080] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence does not contain a nucleotide sequence having at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%, at least 97%, or at least 99% sequence identity to nucleotides 1-87 of SEQ ID NO: 68 or nucleotides 1-87 of SEQ ID NO: 78. In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence does not contain a nucleotide sequence of nucleotides 1-87 of SEQ ID NO: 68 or nucleotides 1-87 of SEQ ID NO: 78. In some embodiments, the synthetic delivery system or polynucleotide comprises a nucleotide sequence of nucleotides 1-87 of SEQ ID NO:68, nucleotides 1-87 of SEQ ID NO:78, or a sequence having at least minimal sequence identity thereto, but the sequence is not part of a recognition sequence, e.g., is not required for preferential binding, uptake, or nuclear localization in a target cell.

[0081] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence does not contain a nucleotide sequence having at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90, or at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 71. In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence does not contain a nucleotide sequence of SEQ ID NO: 71. In some embodiments, the synthetic delivery system or polynucleotide comprises SEQ ID NO: 71 or a sequence having at least minimal sequence identity thereto, but the sequence is not part of the recognition sequence, e.g., is not required for preferential binding, uptake, or nuclear localization in a target cell.

[0082] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence has at most 10%, at most 20%, at most 30%, at most 40%, at most 50%, at most 60%, at most 70%, at most 80%, or at most 90% sequence identity to SEQ ID NO:68 or SEQ ID NO:78.

[0083] The identification sequence can comprise, consist essentially of, or consist of a subset of contiguous nucleotides from a sequence disclosed herein, such as at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at most about 10, at most about 20, at most about 30, at most about 40, at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at most about 10, at most about 20, at most about 30, at most about 40, at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, , at most about 100, at most about 110, at most about 120, at most about 130, at most about 140, at most about 150, at most about 160, at most about 170, at most about 180, at most about 190, at most about 200, at most about 250, at most about 300, at most about 350, at most about 400, at most about 450, at most about 500, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160 , about 170, about 180, about 190, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 5-10, about 5-20, about 5-30, about 5-40, about 5-50, about 5-60, about 5-70, about 5-80, about 5-90, about 5-100, about 5-150, about 5-200, about 5-300, about 5-400, about 5-500, about 10-20, about 10-30, about 10-40, about 10-50, about 10-60, about 10-70, about 10-80, about 10 -90, about 10-100, about 10-150, about 10-200, about 10-300, about 10-400, about 10-500, about 15-20, about 15-30, about 15-40, about 15-50, about 15-60, about 15-70, about 15-80, about 15-90, about 15-100, about 15-150, about 15-200, about 15-300, about 15-400, about 15-500, about 20-30, about 20-40, about 20-50, about 20-60, about 20-70, about 20-80, about 20-90,about 20-100, about 20-150, about 20-200, about 20-300, about 20-400, about 20-500, about 30-40, about 30-50, about 30-60, about 30-70, about 30-80, about 30-90, about 30-100, about 30-150, about 30-200, about 30-300, about 30-400, about 30-500, about 40-50, about 40-60, about 40-70, about 40-80, about 40-90, about 40-100, about 40-15 0, about 40-200, about 40-300, about 40-400, about 40-500, about 50-60, about 50-70, about 50-80, about 50-90, about 50-100, about 50-150, about 50-200, about 50-300, about 50-400, about 50-500, about 100-150, about 100-200, about 100-300, about 100-400, about 100-500, about 200-300, about 200-400, or about 200-500 consecutive nucleotides.

[0084] The identification sequence may comprise, consist essentially of, or consist of a nucleotide sequence having at least a minimum percentage of sequence identity with a subset of contiguous nucleotides from the sequences disclosed herein.

[0085] In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 consecutive nucleotides from any one of SEQ ID NOs: 1-78.

[0086] In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 consecutive nucleotides from any one of SEQ ID NOs: 1-78.

[0087] In some embodiments, the recognition sequence has at least 85% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 consecutive nucleotides from any one of SEQ ID NOs: 1-78.

[0088] In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 consecutive nucleotides from any one of SEQ ID NOs: 1-78.

[0089] In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 consecutive nucleotides from any one of SEQ ID NOs: 1-78.

[0090] In some embodiments, the recognition sequence has at least 98% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 consecutive nucleotides from any one of SEQ ID NOs: 1-78.

[0091] In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 73.

[0092] In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO: 74.

[0093] In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 125 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence has at least 70% sequence identity to at least about 150 consecutive nucleotides of SEQ ID NO:75.

[0094] In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 73.

[0095] In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO: 74.

[0096] In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 125 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence has at least 80% sequence identity to at least about 150 consecutive nucleotides of SEQ ID NO:75.

[0097] In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 73.

[0098] In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO: 74.

[0099] In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 125 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence has at least 90% sequence identity to at least about 150 consecutive nucleotides of SEQ ID NO:75.

[0100] In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 73.

[0101] In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO: 74.

[0102] In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 30 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 40 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 50 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 60 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 70 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 80 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 90 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 100 consecutive nucleotides of SEQ ID NO:75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 125 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence has at least 95% sequence identity to at least about 150 consecutive nucleotides of SEQ ID NO:75.

[0103] In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 30 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 40 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 50 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 60 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 70 consecutive nucleotides of SEQ ID NO: 73. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 80 consecutive nucleotides of SEQ ID NO: 73.

[0104] In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 30 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 40 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 50 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 60 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 70 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 80 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 90 consecutive nucleotides of SEQ ID NO: 74. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 100 consecutive nucleotides of SEQ ID NO: 74.

[0105] In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 30 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 40 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 50 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 60 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 70 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 80 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 90 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 100 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 125 consecutive nucleotides of SEQ ID NO: 75. In some embodiments, the recognition sequence comprises, consists essentially of, or consists of about or at least about 150 consecutive nucleotides of SEQ ID NO: 75.

[0106] In some embodiments, the recognition sequence is at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides in length.

[0107] In some embodiments, the recognition sequence is at most about 10, at most about 20, at most about 30, at most about 40, at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, at most about 100, at most about 110, at most about 120, at most about 130, at most about 140, at most about 150, at most about 160, at most about 170, at most about 180, at most about 190, at most about 200, at most about 250, at most about 300, at most about 350, at most about 400, at most about 450, or at most about 500 nucleotides in length.

[0108] In some embodiments, the recognition sequence is about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 250, about 300, about 350, about 400, about 450, or about 500 nucleotides in length.

[0109] In some embodiments, the length of the recognition sequence is about 5-10, about 5-20, about 5-30, about 5-40, about 5-50, about 5-60, about 5-70, about 5-80, about 5-90, about 5-100, about 5-150, about 5-200, about 5-300, about 5-400, about 5-500, about 10-20, about 10-30, about 10-40, about 10-50, about 10-60, about 10-70, about 10-80, about 10-90, about 10-100, about 10-150, about 5-200, about 5-300, about 5-400, about 5-500, about 10-20, about 10-30, about 10-40, about 10-50, about 10-60, about 10-70, about 10-80, about 10-90, about 10-100, about 10-150, about 10-200, about 10-300, about 10-400, about 10-500, about 15-20, about 15-30, about 15-40, about 15-50, about 15-60, about 15-70, about 15-80, about 15-90, about 15-100, about 15-150, about 15-200, about 15-300, about 15-400, about 15-500, about 20-30, about 20-40, about 20-50, about 20-60, about 20-70, about 20-80, about 20-90, about 20-100, about 20-150, about 20-200, about 20-300, about 20-400, about 20-500, about 30-40, about 30-50, about 30-60, about 30-70, about 30-80, about 30-90, about 30-100, about 30-150, about 30-200, about 30-300, about 30-400, about 30-500, about 40-50, about 40-60, about 40-70, about 40-80, about 40-90, about 40-100, about 40-1 In some embodiments, the present invention relates to a polypeptide having at least one nucleotide sequence and at least one nucleotide sequence. In some embodiments, the present invention relates to a polypeptide having at least one nucleotide sequence and at least one nucleotide sequence. In some embodiments, the present invention relates to a polypeptide having at least one nucleotide sequence and at least one nucleotide sequence.

[0110] In some embodiments, the recognition sequence of the synthetic delivery system or polynucleotide promotes binding to a target cell (e.g., a population thereof) disclosed herein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold At least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 300 times, at least 350 times, at least 400 times, at least 500 times, at least 600 times, at least 700 times, at least 800 times, at least 900 times, at least 1000 times, at least 1500 times, at least 2000 times, or at least 3000 times.

[0111] In some embodiments, the recognition sequence of the synthetic delivery system or polynucleotide promotes uptake of the synthetic delivery system, polynucleotide, or cargo by target cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold, at least 43-fold At least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 300 times, at least 350 times, at least 400 times, at least 500 times, at least 600 times, at least 700 times, at least 800 times, at least 900 times, at least 1000 times, at least 1500 times, at least 2000 times, or at least 3000 times.

[0112] In some embodiments, the recognition sequence of the synthetic delivery system or polynucleotide promotes nuclear localization of the synthetic delivery system, polynucleotide, or cargo in a target cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold At least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 300 times, at least 350 times, at least 400 times, at least 500 times, at least 600 times, at least 700 times, at least 800 times, at least 900 times, at least 1000 times, at least 1500 times, at least 2000 times, or at least 3000 times.

[0113] In some embodiments, the recognition sequence of the synthetic delivery system or polynucleotide promotes genomic integration of the synthetic delivery system, polynucleotide, or cargo in a target cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold At least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 300 times, at least 350 times, at least 400 times, at least 500 times, at least 600 times, at least 700 times, at least 800 times, at least 900 times, at least 1000 times, at least 1500 times, at least 2000 times, or at least 3000 times.

[0114] In one example, a recognition sequence derived from multiple myeloma (MM) can target MM cells, rather than, for example, pancreatic cells, for binding and / or uptake of a synthetic delivery system, polynucleotides and / or cargo. A recognition sequence derived from pancreatic cancer (PC) can target pancreatic cancer cells, rather than, for example, multiple myeloma cells, for binding and / or uptake of a synthetic delivery system, polynucleotides and / or cargo.

[0115] The recognition sequence can be derived from ctDNA. For example, the recognition sequence can be a fragment of ctDNA identified by sequencing ctDNA from an object (e.g., plasma from a human object with cancer). The recognition sequence can be derived from ctDNA derived from lymphoma, leukemia, lung cancer, colon cancer (e.g., colorectal cancer), brain cancer, multiple myeloma, pancreatic cancer, blood cancer, solid cancer or other cancer types disclosed herein.

[0116] The synthetic delivery system or polynucleotide can include any suitable number of recognition sequences, such as one, two, three, four or five recognition sequences. In some embodiments, the synthetic delivery system or polynucleotide includes one recognition sequence. In some embodiments, the synthetic delivery system or polynucleotide includes two recognition sequences, such as, a first recognition sequence at the 5' district of the polynucleotide and a second recognition sequence at the 3' district of the polynucleotide, optionally separated by a non-recognition sequence or component (such as a nucleic acid cargo).

[0117] In some embodiments, the synthetic delivery system or polynucleotide comprises at least two, at least three, at least four, at least five, or another suitable number of recognition sequences at the 3' or 5' end of the polynucleotide or a combination thereof. The compositions of the present disclosure may comprise a plurality of such polynucleotides, and each polynucleotide may target one or more cell types. Therefore, the methods and compositions of the present disclosure may be used, for example, to simultaneously target one or more different target cells, one or more different target cell populations, and / or one or more different target tissues.

[0118] The synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence or a second nucleic acid sequence) can comprise a transposable element (TE) or a derivative thereof, e.g., a fragment having a functional attribute disclosed herein. The transposable element can comprise a transposon or a derivative thereof. The transposable element can comprise a retrotransposon or a derivative thereof. The transposable element or transposon can be any suitable class, subclass, family, subfamily, type, etc., including those disclosed herein. The transposable element or transposon can be a variant or derivative of a transposable element of a given class, subclass, family, subfamily or type, including those disclosed herein.

[0119] The synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence or a second nucleic acid sequence) can comprise a transposable element or a fragment thereof from or derived from, for example, a class I or class II transposon. In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from a short interspersed nuclear element (SINE), a long interspersed nuclear element (LINE), an ERVL or an ERVK transposable element.

[0120] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) comprises a transposable element or fragment thereof from or derived from AluSp, MER11C, AluY, 2L2a, ALluY, ALR / Alpha, ALU, AluJb, AluS1, AluSc8, AluSg, ALUSg2, AluSq, AluSq2, ALUSx, AluSx, AluSx1, AluSz, AluSz6, AluYc3, ASLUSq2, ERVK / LTR, ERVL, ERVL-MaLR, FLAM_C, AluY, FLAM_C and AluY, HERV17-int, HERV9N-int, L1M1, L1MB3, L1ME4b, L1MEg, L1P1, L1 P3, L1PA10, L1PA15, L1PA7, L1PB4, L2a, L2a / LTR40b / MLT1J2, LINE / L1, LINE / L2, LTR, LTR / ERV1, LTR / ERVL, LTR / ERVL-MaLR, LTR / Gypsy, LTR41C, LTR81B, Mam_R4, Mamr4, Many, MER11B, MER41E, MIR, MIRB, MIRc, MIRc-L2 portion, MLT1J2, MLT2B1, MLT1J2, MLT2B4, parAluSp-FULLMTL1J2, REP522, Satellite / centr, SINE / Alu, SINE / MIR, THE1A, THE1B, THE1C, or Tigger3a transposable element or a derivative thereof.

[0121] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from a non-LTR retrotransposon transposable element (e.g., SINE, LINE) or a complex transposable element.

[0122] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element or a fragment thereof that is from or derived from a LINE-class transposable element.In some embodiments, the transposable element or fragment thereof is or is derived from a LINE-type transposable element of the L1 group, such as L1, L1HS, L1M1B_5, L1M1_5, L1M2A1_5, L1M2A_5, L1M2B_5, L1M2C_5, L1M2_5, L1M3A_5, L1M3B_5, L1M3C_5, L1M3DE_5, L1M3D_5, L1M4B, L1M6B_5 end, L1M6_5 end, L1M7_5 end, L1MA1, L1MA10, L1MA2, L1MA3, L1MA4, L1MA4A, L1MA5, L1MA5A, L1MA6, L1MA7, L1MA8, L1MA9, L1MA9_5, L1MB1, L1MB2, L1MB3, L1MB4, L1MB5, L1MB6, L1MB7, L1MB8, L1MB9, L1MB10, L1MB111, L1MB2, L1MB3, L1MB3, L1MB4, L1MB5, L1MB6, L1MB7, L1MB8, L1MB9, L1MB112, L1MB3, L1MB3 MB3, L1MB3_5, L1 MB4, L1MB4_5, L1 MB5, L1MB6_5, L1 MB7, L1 MB8, L1MC1, L1MC2, L1MC3, L1MC4, L1MC4B, L1MC4_5terminal, L1MC5, L1MCA_5, L1MCB_5, L1MCC_5, L1MD1, L1MD1_5, L1MD2, L1MD3, L1MDA_5, L1MDB_5, L1ME1, L1ME2, L1ME3, L1ME3A, L1ME3C_3terminal, L1ME3D_3terminal, L1ME3E_3terminal, L1ME3F_3terminal, L1ME4, L1ME4A, L1ME5, L1ME5_3terminal, L1MEA_5, L1MEB_5, L1MEC_5, L1MED_ 5, L1MEE_5, L1MEe_5 end, L1MEf_5 end, L1MEg_5 end, L1ME_ORF2, L1P4a_5 end, L1P4b_5 end, L1P4c_5 end, L1P4d_5 end, L1P4e_5 end, L1PA10, L1PA11, L1PA12, L1PA12_5, L1PA13, L1PA13_5, L1PA14, L1PA14_5, L1PA15, L1PA16, L1PA16_5, L1PA17_5, L1PA2, L1PA3, L1PA4, L1PA5, L1PA6, L1PA7, L1PA7_5, L1PA8, L1 PB1, L1 PB2, L1PB2c, L1 PB3, L1 PB4, L1PBA1_5, L1PBA_5, L1PBB_5, L1PREC1, L1PREC2, L1P_MA2, HAL1, HAL1B(HAL1b), HAL1M8, IN25, MER25, or X9_LINE transposable element.In some embodiments, the transposable element or fragment thereof is or is derived from a LINE-class transposable element of the L2 group, such as an L2, L2A, L2B, L2C, L2D, X15_LINE, X24_LINE, UCON49, or UCON86 transposable element.

[0123] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from a SINE-class transposable element. In some embodiments, the transposable element or a fragment thereof is or is derived from a SINE-class transposable element of the SINE1 / 7S group, such as an AluY lineage, an AluS lineage, an AluJ lineage, or a monomeric Alu lineage transposable element.

[0124] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element from or derived from an AluY lineage element (e.g., ALU, AluY, AluYal, AluYa4, AluYa5, AluYa8, AluYb10, AluYb11, AluYb3a1, AluYb3a2, AluYb8, AluYb8a1, AluYk12, or AluYk13 transposable element) or a fragment thereof.

[0125] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from an AluS lineage transposable element (e.g., an AluSc, AluSc5, AluSc8, AluSg, AluSg1, AluSg4, AluSg7, AluSp, AluSq, AluSq10, AluSq2, AluSq4, AluSx, AluSx3, AluSx4, AluSz, or AluSz6 transposable element).

[0126] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from an AluJ lineage transposable element (e.g., an AluJb, AluJo, AluJr, or AluJr4 transposable element).

[0127] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from a monomeric Alu lineage transposable element (e.g., a FAM, FLAM, FRAM, or PB1D11 transposable element).

[0128] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from a SINE-class transposable element of the SINE2 / tRNA group (e.g., MIR, MIR3, MIRb, MIRc, THER1, THER2, MARE3, UCON3, UCON55, LFSINE_Vert, LmeSINE1b, LmeSINE1c, or MamSINE1 transposable element).

[0129] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from an LTR retrotransposon transposable element.

[0130] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element or fragment thereof from or derived from an endogenous retroviral (ERV) transposable element.

[0131] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element from or derived from the ERV1 superfamily (e.g., LTR06, LTR9, LTR24C, LTR26, LTR26B, LTR26C, LTR26D, LTR26E, LTR27, LTR27B, LTR27C, LTR29, LTR31, LTR34, LTR36, LTR44, LTR45, LTR45B, LTR45C, LTR48, LTR48B, LTR51, LTR54, LTR54B, LTR56, LTR59, LTR60, LTR60B, LTR64, LTR65, LTR68, LTR70, LTR71, LTR72, LTR73, LTR74, LTR75, LTR76, LTR77 R72, LTR72B, LTR75_1, LTR78, LTR78B, LTR81A, LTR81AB, LTR81B, LTR81C, LTR2752, MER31A, MER31B, MER34A, MER34A1, MER34C, MER34C2, MER34D, MER39, MER39B, MER49, MER50B, MER50C, MER66A, MER66B, MER66D, MER72B, MER87, MER87B, MER88, MER90, MER90a_LTR (MER90a), MER92A, MER92B, MER92C, MER93, MER95, or MER101B transposable element) or a fragment thereof.

[0132] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from an ERV2 superfamily transposable element. In some embodiments, the transposable element is an ERV2 superfamily transposable element of the HML1, HML2, HML3, HML4, HML5, HML6, HML7, HML8, HML9, or HML10 group.

[0133] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element or fragment thereof from or derived from a member of the MER (medium repeat frequency) family.

[0134] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from HERV-K14I (HERVK14), LTR14A, LTR14B, HERVK, LTR5, LTR5A, HML3, HERVK9I (HERVK9), MER9a1, MER9a2, MER9a3, HML4, HERVK13I (HERVK13), LTR13, LTR13A, HML5, HERVK22I (HERVK22), LTR22A, LTR22B, LTR22B1, LML5, TR22B2, LTR22C, LTR22C0, LTR22C2, HML6, HERVK3I, LTR3, LTR3A, LTR3B, HML7, HERVK11DI (HERVK11D), MER11D, HML8, HERVK11I (HERVK11), MER11A, MER11B, MER11C, HML9, HERV-K14CI (HERVK14C), LTR14C, HML10, HERVKC4, LTR14, LTR5B, LTR5_Hs, LTR22, LTR22E, MER9, MER9B, RLTR10B, or RLTR10C transposable element.

[0135] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from an ERV3 superfamily transposable element.

[0136] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., a recognition sequence, an integration sequence, a first nucleic acid sequence or a second nucleic acid sequence) comprises a transposable element or a fragment thereof from or derived from an ERV3 superfamily transposable element of the MaLR group (e.g., THE1_I, THE1A, THE1B, THE1C, THE1D, MLT1B, MLT1D, MLT1G, MLT1G1, MLT1G2, MLT1G3, MLT1H1, MLT1H2, MLT1I, MLT1J1, MLT1J2, MLT1K, MLT1L, MLT1M, MLT1N2, or MLT1O transposable element).

[0137] In some embodiments, the synthetic delivery system, polynucleotide or nucleic acid sequence (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) comprises an ERV3 superfamily transposable element from or derived from the ERVL lineage (e.g., HERVL, MLT2A1, MLT2A2, MLT2B3, MLT2C2, MLT2D, MLT2F, ERVL, MLT2B2, ERVL-B4, MLT2B4, ERVL-E, MLT2E, ERV3-16A3-I , ERV3–16A3_LTR, LTR16A, LTR16A1, LTR16A2, LTR16B, LTR16B1, LTR16B2, LTR16C, LTR16D, LTR16D1, LTR16D2, LTR16E, LTR16E1, LTR16E2, HERV16, LTR16, ERVL47, LTR47B, LTR47B2, LTR47B3, or LTR47B4 transposable element) or a fragment thereof.

[0138] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is an AluSp transposable element or a derivative thereof.

[0139] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is a MER11C transposable element or a derivative thereof.

[0140] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is an AluSx transposable element or a derivative thereof.

[0141] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is a MLT1J transposable element or a derivative thereof.

[0142] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element that is an AluSg2 transposable element or a derivative thereof.

[0143] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is a THE1A transposable element or a derivative thereof.

[0144] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is an AluJb transposable element or a derivative thereof.

[0145] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, a recognition sequence, an integration sequence, a first nucleic acid sequence, or a second nucleic acid sequence) comprises a transposable element that is a MTL2B4 or MLT2B4 transposable element or a derivative thereof.

[0146] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is an L2a transposable element or a derivative thereof.

[0147] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is a MLT1J2 transposable element or a derivative thereof.

[0148] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is an AluSq transposable element or a derivative thereof.

[0149] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is a L1MB3 transposable element or a derivative thereof.

[0150] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is a THE1C transposable element or a derivative thereof.

[0151] In some embodiments, the synthetic delivery system, polynucleotide, or nucleic acid sequence (eg, recognition sequence, integration sequence, first nucleic acid sequence, or second nucleic acid sequence) comprises a transposable element that is an AluY transposable element or a derivative thereof.

[0152] In some embodiments, upon contacting, reaching, or being internalized by a host cell, the transposable elements disclosed herein enlist the cellular retrotransposition machinery to integrate into the target (e.g., cancer) cell genome. In some embodiments, tissue-specific delivery, uptake, and / or integration can be determined by the sequence of the retrotransposon and the expression of the host's retrotransposition machinery.

[0153] The synthetic delivery system, polynucleotide or nucleic acid sequence can include an integration sequence that facilitates integration of the polynucleotide, synthetic delivery system or cargo into the genome of the target cell. For example, the integration sequence can include a transposon integration signal. In some embodiments, the synthetic delivery system or polynucleotide lacks an integration sequence.

[0154] In some embodiments, compared with control cells, the integration sequence promotes the preferential genome integration of target cells to ctDNA, synthetic delivery systems, polynucleotides or goods. The control cell can be, for example, a cell of a different cell type (e.g., a cell type disclosed herein). In some embodiments, the target cell is a cancer cell, and the control cell is, for example, a non-cancerous cell of the same or substantially similar cell type. In some embodiments, the target cell is a cancer cell of a first cell type, and the control cell is a cancer cell of a second cell type. In some embodiments, the target cell is a cancer cell of a first cell type, and the control cell is a non-cancerous cell of a second cell type.

[0155] The integration sequence may be or may comprise a functional fragment and / or variant of a sequence disclosed herein. For example, the integration sequence may comprise a subset of nucleotides from a nucleotide sequence disclosed herein, which promotes preferential integration into the genome of a target cell compared to a control cell. In some embodiments, the integration sequence comprises a functional fragment and / or variant of a sequence disclosed herein, which retains at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the target cell genome integration activity of the nucleotide sequence from which the fragment and / or variant is derived.

[0156] The integration sequence can comprise, consist essentially of, or consist of a contiguous subset of nucleotides from a sequence disclosed herein, e.g., at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at most about 10, at most about 20, at most about 30, at most about 40, at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at most about 10, at most about 20, at most about 30, at most about 40, at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, , at most about 100, at most about 110, at most about 120, at most about 130, at most about 140, at most about 150, at most about 160, at most about 170, at most about 180, at most about 190, at most about 200, at most about 250, at most about 300, at most about 350, at most about 400, at most about 450, at most about 500, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160 , about 170, about 180, about 190, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 5-10, about 5-20, about 5-30, about 5-40, about 5-50, about 5-60, about 5-70, about 5-80, about 5-90, about 5-100, about 5-150, about 5-200, about 5-300, about 5-400, about 5-500, about 10-20, about 10-30, about 10-40, about 10-50, about 10-60, about 10-70, about 10-80, about 10 -90, about 10-100, about 10-150, about 10-200, about 10-300, about 10-400, about 10-500, about 15-20, about 15-30, about 15-40, about 15-50, about 15-60, about 15-70, about 15-80, about 15-90, about 15-100, about 15-150, about 15-200, about 15-300, about 15-400, about 15-500, about 20-30, about 20-40, about 20-50, about 20-60, about 20-70, about 20-80, about 20-90,about 20-100, about 20-150, about 20-200, about 20-300, about 20-400, about 20-500, about 30-40, about 30-50, about 30-60, about 30-70, about 30-80, about 30-90, about 30-100, about 30-150, about 30-200, about 30-300, about 30-400, about 30-500, about 40-50, about 40-60, about 40-70, about 40-80, about 40-90, about 40-100, about 40-15 0, about 40-200, about 40-300, about 40-400, about 40-500, about 50-60, about 50-70, about 50-80, about 50-90, about 50-100, about 50-150, about 50-200, about 50-300, about 50-400, about 50-500, about 100-150, about 100-200, about 100-300, about 100-400, about 100-500, about 200-300, about 200-400, or about 200-500 consecutive nucleotides.

[0157] An integrated sequence may comprise, consist essentially of, or consist of a nucleotide sequence having at least a minimum percentage sequence identity with a contiguous subset of nucleotides from a sequence disclosed herein.

[0158] In some embodiments, the integration sequence has at least 70% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides from any one of SEQ ID NOs: 1-78.

[0159] In some embodiments, the integration sequence has at least 80% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides from any one of SEQ ID NOs: 1-78.

[0160] In some embodiments, the integration sequence has at least 85% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides from any one of SEQ ID NOs: 1-78.

[0161] In some embodiments, the integration sequence has at least 90% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides from any one of SEQ ID NOs: 1-78.

[0162] In some embodiments, the integration sequence has at least 95% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides from any one of SEQ ID NOs: 1-78.

[0163] In some embodiments, the integration sequence has at least 98% sequence identity to at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides from any one of SEQ ID NOs: 1-78.

[0164] In some embodiments, the integration sequence is at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides in length.

[0165] In some embodiments, the integration sequence is at most about 10, at most about 20, at most about 30, at most about 40, at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, at most about 100, at most about 110, at most about 120, at most about 130, at most about 140, at most about 150, at most about 160, at most about 170, at most about 180, at most about 190, at most about 200, at most about 250, at most about 300, at most about 350, at most about 400, at most about 450, or at most about 500 nucleotides in length.

[0166] In some embodiments, the integration sequence is about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 250, about 300, about 350, about 400, about 450, or about 500 nucleotides in length.

[0167] In some embodiments, the length of the integration sequence is about 5-10, about 5-20, about 5-30, about 5-40, about 5-50, about 5-60, about 5-70, about 5-80, about 5-90, about 5-100, about 5-150, about 5-200, about 5-300, about 5-400, about 5-500, about 10-20, about 10-30, about 10-40, about 10-50, about 10-60, about 10-70, about 10-80, about 10-90, about 10-100, about 10-150, about 5-200, about 5-300, about 5-400, about 5-500, about 10-20, about 10-30, about 10-40, about 10-50, about 10-60, about 10-70, about 10-80, about 10-90, about 10-100, about 10-150, about 10-200, about 10-300, about 10-400, about 10-500, about 15-20, about 15-30, about 15-40, about 15-50, about 15-60, about 15-70, about 15-80, about 15-90, about 15-100, about 15-150, about 15-200, about 15-300, about 15-400, about 15-500, about 20-30, about 20-40, about 20-50, about 20-60, about 20-70, about 20-80, about 20-90, about 20-100, about 20-150, about 20-200, about 20-300, about 20-400, about 20-500, about 30-40, about 30-50, about 30-60, about 30-70, about 30-80, about 30-90, about 30-100, about 30-150, about 30-200, about 30-300, about 30-400, about 30-500, about 40-50, about 40-60, about 40-70, about 40-80, about 40-90, about 40-100, about 40-1 In some embodiments, the present invention relates to a polypeptide having at least one nucleotide sequence and at least one nucleotide sequence. In some embodiments, the present invention relates to a polypeptide having at least one nucleotide sequence and at least one nucleotide sequence. In some embodiments, the present invention relates to a polypeptide having at least one nucleotide sequence and at least one nucleotide sequence.

[0168] In some embodiments, the integration sequence of the synthetic delivery system or polynucleotide promotes genomic integration of the synthetic delivery system, polynucleotide, or cargo in a target cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold At least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 300 times, at least 350 times, at least 400 times, at least 500 times, at least 600 times, at least 700 times, at least 800 times, at least 900 times, at least 1000 times, at least 1500 times, at least 2000 times, or at least 3000 times.

[0169] The synthetic delivery system, polynucleotide or nucleic acid sequence can comprise a recognition sequence and an integration sequence. In some embodiments, the integration sequence and the recognition sequence are coupled, for example, covalently coupled via a phosphodiester bond.

[0170] The synthetic delivery system, polynucleotide or nucleic acid sequence can comprise a transposable element (e.g., transposon) sequence or a functional fragment thereof. The synthetic delivery system, polynucleotide or nucleic acid sequence can comprise two or more transposable element (e.g., transposon) sequences or functional fragments thereof, e.g., transposable elements from the same or different sources. The transposable element (e.g., transposon) sequence or a functional fragment thereof can be from or derived from, for example, a class I or class II transposon.

[0171] The polynucleotide may comprise a first nucleic acid sequence identified in, from, or derived from ctDNA. The ctDNA may be derived from a cancer cell of the same, substantially the same, or substantially similar cell type or tissue type as the target cell.

[0172] The first nucleic acid sequence may be in the 3' region of the polynucleotide. The polynucleotide may also include a second nucleic acid sequence, for example, identified in ctDNA, from ctDNA or derived from ctDNA. The ctDNA may be from or derived from a cell type or tissue type that is identical, substantially identical, or substantially similar to the target cell. The ctDNA may be identical to the ctDNA from which the first nucleic acid sequence is derived or derived. In some embodiments, the ctDNA may be different from the ctDNA from which the first nucleic acid sequence is derived or derived. The second nucleic acid may be in the 5' region of the polynucleotide. In some embodiments, the first nucleic acid sequence is an identification sequence disclosed herein, and the second nucleic acid sequence is an integration sequence disclosed herein. In some embodiments, the first nucleic acid sequence is an integration sequence disclosed herein, and the second nucleic acid sequence is an identification sequence disclosed herein. In some embodiments, the first nucleic acid sequence is a first identification sequence disclosed herein, and the second nucleic acid sequence is a second identification sequence disclosed herein.

[0173] The first nucleic acid sequence can be or can comprise a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity to any one or more of SEQ ID NOs: 1-78 disclosed herein, or a functional fragment thereof (e.g., having at least a given number of consecutive nucleotides, having at least a given sequence identity to a given number of consecutive nucleotides, or having at least a given percentage of retained functional activity disclosed herein).

[0174] The second nucleic acid sequence can be or can comprise a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity to any one or more of SEQ ID NOs: 1-78 disclosed herein, or a functional fragment thereof (e.g., having at least a given number of consecutive nucleotides, having at least a given sequence identity to a given number of consecutive nucleotides, or having at least a given percentage of retained functional activity disclosed herein).

[0175] The first and / or second nucleic acid sequence may comprise a functional fragment (eg, a recognition sequence or an integration sequence) from or derived from any suitable sequence disclosed herein (eg, any one or more of SEQ ID NOs: 1-78).

[0176] The first nucleic acid sequence may be in the 5' region of the polynucleotide. The polynucleotide may also include a second nucleic acid sequence, for example, identified in ctDNA, from ctDNA or derived from ctDNA. The ctDNA may be from or derived from a cell type or tissue type that is identical, substantially identical, or substantially similar to the target cell. The ctDNA may be identical to the ctDNA from which the first nucleic acid sequence is derived or derived. In some embodiments, the source ctDNA of the second nucleic acid may be different from the ctDNA from which the first nucleic acid sequence is derived or derived. The second nucleic acid may be in the 3' region of the polynucleotide. The first and / or second nucleic acid sequence may include a functional fragment (e.g., a recognition sequence or an integration sequence) from or derived from any suitable sequence disclosed herein.

[0177] In some embodiments, a portion (e.g., about half) of the nucleic acid sequence can be connected to the 5' end of the target nucleic acid cargo, gene or sequence, and another portion (e.g., about half) of the sequence can be connected to the 3' end of the target nucleic acid cargo, gene or sequence. In some embodiments, the nucleic acid sequence can be directly or indirectly connected to the target nucleic acid cargo, gene or sequence. For example, the first sequence can be directly connected to the 5' end of the nucleic acid sequence containing the target nucleic acid cargo, gene or sequence, and the second sequence can be indirectly connected to the 3' end of the nucleic acid sequence containing the target nucleic acid cargo, gene or sequence. In some embodiments, the composition of the present disclosure may include a guide sequence, which is directly connected to the target nucleic acid cargo, gene or sequence at one end (e.g., 3' end) and is directly connected to the recognition sequence or integration sequence at the other end (e.g., 5' end), thereby indirectly connecting the integration sequence or insertion sequence and the target nucleic acid cargo, gene or sequence.

[0178] In some embodiments, the compositions of the present disclosure comprise a first nucleic acid sequence (e.g., comprising a recognition sequence and / or an integration sequence) that is directly or indirectly linked to one end (e.g., its 3' end) of a target nucleic acid cargo, gene or sequence; and a second nucleic acid sequence (e.g., comprising a recognition sequence and / or an integration sequence) that is directly or indirectly linked to the other end (e.g., its 5' end) of a target nucleic acid cargo, gene or sequence.

[0179] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence (e.g., a first nucleic acid sequence, a second nucleic acid sequence, a recognition sequence, or an integration sequence) comprises a sequence disclosed herein, or has a disclosed minimum sequence identity degree with a sequence disclosed herein, or a fragment thereof. Its fragment can be, for example, a functional fragment that serves as a recognition sequence or an integration sequence as disclosed herein.

[0180] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 10 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0181] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 15 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0182] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 20 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0183] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 30 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0184] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 50 contiguous nucleotides of any one of SEQ ID NOs: 1-78.

[0185] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 75 contiguous nucleotides of any one of SEQ ID NOs: 1-78.

[0186] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 100 contiguous nucleotides of any one of SEQ ID NOs: 1-78.

[0187] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 200 contiguous nucleotides of any one of SEQ ID NOs: 1-78.

[0188] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 300 contiguous nucleotides of any one of SEQ ID NOs: 1-78.

[0189] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to any one of SEQ ID NOs: 1-78.

[0190] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of any one of SEQ ID NOs: 1-78.

[0191] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:68.

[0192] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:73.

[0193] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:74.

[0194] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:75.

[0195] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:53.

[0196] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 13.

[0197] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 14.

[0198] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:33.

[0199] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to SEQ ID NO:53.

[0200] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO:53.

[0201] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 75 consecutive nucleotides of SEQ ID NO:53.

[0202] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 95.5%, at least about 96%, at least about 96.5%, at least about 97%, at least about 97.5%, at least about 98%, at least about 98.5%, at least about 99%, at least about 99.5%, or about 100% sequence identity to at least 100 contiguous nucleotides of SEQ ID NO:53.

[0203] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises, consists essentially of, or consists of a nucleic acid sequence having at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97.5%, or at most about 99% sequence identity to any one of SEQ ID NOs: 1-78.

[0204] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises a nucleic acid sequence having one or more nucleotide insertions, deletions, or substitutions compared to any one of SEQ ID NOs: 1-78.

[0205] For example, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence can comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide insertions relative to any one of SEQ ID NOs: 1-78.

[0206] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence can contain at most 1, at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 nucleotide insertions relative to any one of SEQ ID NOs: 1-78.

[0207] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 nucleotide insertions relative to any one of SEQ ID NOs: 1-78.

[0208] The one or more insertions may be at the 5' end, the 3' end, within the sequence, or a combination thereof. The one or more insertions may be continuous, discontinuous, or a combination thereof.

[0209] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 400, at least 500, at least 600, or at least 700 nucleotides deleted relative to any one of SEQ ID NOs: 1-78.

[0210] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence can comprise at most 1, at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50, at most 75, at most 100, at most 125, at most 150, at most 175, at most 200, at most 250, at most 300, at most 400, at most 500, at most 600, or at most 700 nucleotide deletions relative to any one of SEQ ID NOs: 1-78.

[0211] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 nucleotide deletions relative to any one of SEQ ID NOs: 1-78.

[0212] The one or more deletions may be at the 5' end, the 3' end, within the sequence, or a combination thereof. The one or more deletions may be continuous, discontinuous, or a combination thereof.

[0213] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide substitutions relative to any one of SEQ ID NOs: 1-78.

[0214] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence can contain at most 1, at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 nucleotide substitutions relative to any one of SEQ ID NOs: 1-78.

[0215] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence, or integration sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 nucleotide substitutions relative to any one of SEQ ID NOs: 1-78.

[0216] The one or more substitutions may be at the 5' terminus, the 3' terminus, within the sequence, or a combination thereof. The one or more substitutions may be continuous, discontinuous, or a combination thereof.

[0217] The length of the polynucleotide or nucleic acid sequence disclosed herein (e.g., identification sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) can be about 10 base pairs (bp) to about 1000bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be about 100 base pairs (bp) to about 900bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be about 200bp to about 800bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be about 300bp to about 700bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be about 400bp to about 600bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 50bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 100bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 200bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 300bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 400bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 500bp. The length of the polynucleotide or nucleic acid sequence disclosed herein can be at least about 1000bp.

[0218] The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 50bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 100bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 200bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 300bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 400bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 500bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 1000bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 5000bp. The length of the polynucleotides or nucleic acid sequences disclosed herein may be at most about 10000bp.

[0219] In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) is at least 10 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein is at least 20 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein is at least 50 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein is at least 100 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein is at least 200 base pairs. In some cases, the length of the polynucleotide or nucleic acid sequence disclosed herein can be at least 400 base pairs.

[0220] In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein (e.g., recognition sequence, integration sequence, first nucleic acid sequence or second nucleic acid sequence) is about 10 base pairs to about 100 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be about 10 base pairs to about 200 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be about 20 base pairs to about 100 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be about 100 base pairs to about 200 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be about 100 base pairs to about 500 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be about 200 base pairs to about 800 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be about 400 base pairs to about 2,000 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 400 base pairs to about 5,000 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 1,500 base pairs to about 7,200 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 1,900 base pairs to about 5,800 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 2,000 base pairs to about 10,000 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 5,000 base pairs to about 15,000 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 600 base pairs to about 16,900 base pairs. In some embodiments, the length of the polynucleotide or nucleic acid sequence disclosed herein can be from about 8,000 base pairs to about 18,000 base pairs. In some embodiments, the polynucleotides or nucleic acid sequences disclosed herein may be about 10,000 base pairs to about 20,000 base pairs in length. In some embodiments, the polynucleotides or nucleic acid sequences disclosed herein may be about 400 base pairs to about 20,000 base pairs in length.

[0221] In some embodiments, the synthetic delivery system, polynucleotide, nucleic acid sequence, first nucleic acid sequence, second nucleic acid sequence, recognition sequence or integration sequence comprises about 1 to about 20 insertions, deletions and / or substitutions relative to any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide or nucleic acid sequence comprises about 20 to about 100 insertions, deletions and / or substitutions relative to any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide or nucleic acid sequence comprises about 50 to about 250 insertions, deletions and / or substitutions relative to any one of SEQ ID NO: 1-78. In some embodiments, the polynucleotide or nucleic acid sequence comprises about 150 to about 500 insertions, deletions and / or substitutions relative to any one of SEQ ID NO: 1-78.

[0222] In some embodiments, the disclosed synthetic delivery systems can be functional without the need for commonly used delivery vectors or delivery systems (e.g., as "naked" DNA). For example, in some embodiments, the synthetic delivery systems do not require or utilize viral vectors, nanoparticles, lipid nanoparticles, liposomes, exosomes, dendrimers, gene guns, or electroporation.

[0223] In some embodiments, targeted cargo delivery via the synthetic delivery systems disclosed herein can significantly reduce off-target and unwanted adverse effects associated with alternative delivery systems (e.g., non-targeted delivery systems).

[0224] In some embodiments, the synthetic delivery systems of the present disclosure may be combined with or utilize a carrier, such as a viral vector, a nanoparticle, a lipid nanoparticle, a liposome, an exosome, or a dendrimer.

[0225] In some embodiments, the candidate polynucleotides for use in the synthetic delivery system include full-length transposable elements (e.g., retrotransposons). In some embodiments, the candidate polynucleotides for use in the synthetic delivery system include high identification mutation rates, or more than a mutation (e.g., SNV) identified, for example, are conducive to the mutation of a higher number relative to a reference sequence. Mutations can be shared between ctDNA-target cell co-culture conditions and a single ctDNA, and do not exist or do not exist in the genome of untreated control cells in fact. In some embodiments, the candidate polynucleotides for use in the synthetic delivery system are not located in the intron of a gene, or if present in an intron, are not close to exons (e.g., at least 3kb, 5kb or 10kb from exons).

[0226] Table 1 provides sequences of illustrative polynucleotides that can be used in the synthetic delivery systems disclosed herein (e.g., for delivery to cancer cells, e.g., hematological cancer cells such as multiple myeloma cells, B cells, and / or plasma cells).

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234] Table 2 provides some details of illustrative polynucleotides that can be used in synthetic delivery systems disclosed herein, including, for example, genomic insertion sites identified in experiments disclosed herein and / or many single nucleotide variants (SNVs or SNPs) identified. Some of the polynucleotides provided can correspond to the sequences provided in Table 1, and can be used in synthetic delivery systems disclosed herein, for example, for delivery to cancer cells, e.g., hematological cancer cells, such as multiple myeloma cells, B cells and / or plasma cells.

[0235]

[0236]

[0237] Table 3 provides sequences of illustrative polynucleotides that can be used in the synthetic delivery systems disclosed herein (eg, for delivery to cancer cells, such as pancreatic cancer cells).

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254] Table 4 provides some details of illustrative polynucleotides that can be used in synthetic delivery systems disclosed herein, including, for example, genomic insertion sites identified in experiments disclosed herein and / or a number of single nucleotide variants (SNVs or SNPs) identified. Some of the polynucleotides provided can correspond to the sequences provided in Table 3, and can be used in synthetic delivery systems disclosed herein, for example, for delivery to cancer cells, such as pancreatic cancer cells.

[0255]

[0256]

[0257]

[0258] In some embodiments, the synthetic delivery systems disclosed herein elicit no, substantially no, or a reduced immunogenic response compared to alternative delivery systems, such as viral vectors.

[0259] In some embodiments, the synthetic delivery system disclosed herein comprises a conjugated moiety. The conjugated moiety can be attached at the 5' end, 3' end or internal site along the length of the polynucleotide. The conjugated moiety can be a nucleotide analog (such as bromodeoxyuridine). The conjugated moiety can be a conjugated functional group. The conjugated functional group can be an azido or alkynyl group. The conjugated moiety can be a modified nucleotide that promotes conjugation with a compound. The conjugated moiety can be a modified nucleotide comprising a functional group that can be conjugated with a compound. In some embodiments, the synthetic delivery system disclosed herein comprises multiple conjugated moieties. In some embodiments, multiple conjugated moieties are the same. In some embodiments, multiple conjugated moieties are different. In some embodiments, the synthetic delivery system or polynucleotide comprises a first conjugated moiety and a second conjugated moiety.

[0260] The conjugate moiety may be or may comprise a selected single modified nucleotide (e.g., a modified A, C, G, U or T containing an azide at the 2' position) that is site-specifically incorporated under optimized conditions (e.g., via solid phase chemical synthesis). The conjugate moiety may be or may comprise a plurality of nucleotides containing an azide at the 2' position that are incorporated, for example, by replacing a nucleotide during an in vitro transcription reaction (e.g., replacing 5-azido-C3-UTP with UTP). Non-limiting examples of conjugated moieties include modified UTP analogs, 5-azidomethyl-UTP, 5-azido-C3-UTP, 5-azido-PEG4-UTP, 5-ethynyl-UTP, DBCO-PEG4-UTP, vinyl-UTP, 8-azido-ATP, 3'-azido-2',3'-ddATP, 5-azido-PEG4-CTP, 5-DBCO-PEG4-CTP, N6-azidohexyl-3'-dATP, 5-azidopropyl-UTP, and 5-DBCO-PEG4-dCpG.

[0261] The conjugated moiety can also be derivatized by a chemical reaction such as click chemistry or any other bioconjugation reaction. The conjugated group can be conjugated via a chemical reaction, for example, using click chemistry or a Staudinger reaction of the compound. Click chemistry can include a copper (I)-catalyzed [3+2]-Huisgen 1,3-dipolar cycloaddition reaction of alkynes and azides to produce 1,2,3-triazoles. Click chemistry can be a copper-free variant of the reaction. Click chemistry can be a Diels-Alder reaction of the reverse electron demand between trans-cyclooctadiene and tetrazine.

[0262] Polynucleotides can be conjugated to conjugation partners (e.g., cargoes) using copper-catalyzed click reactions, for example, copper-catalyzed 1,3-dipolar azide-alkyne cycloaddition (CuAAC) of alkyne-functionalized conjugation partners (e.g., cargoes such as small molecules) and azide-functionalized nucleic acids. Linear polynucleotides can be modified at their 3' termini by poly(A) polymerase and azide-derivatized nucleotides. Azides can be conjugated to conjugation partners via copper-catalyzed or strain-promoted azide-alkyne click reactions.

[0263] The polynucleotide can be conjugated to a conjugation partner (e.g., cargo) using the Staudinger reaction. For example, a polynucleotide comprising one or more azide-functionalized nucleotides can be conjugated to an alkyne-functionalized small molecule in the presence of triphenylphosphine-3,3',3"-trisulfonic acid (TPPTS).

[0264] The polynucleotide can be conjugated to a conjugation partner (e.g., cargo) using the Suzuki-Miyaura reaction. For example, a polynucleotide comprising a halogenated nucleotide analog can be subjected to the Suzuki-Miyaura reaction in the presence of a homologous reactive conjugation partner (e.g., cargo). For example, a polynucleotide comprising 5-iodouridine triphosphate (IUTP) can be used in a catalytic system with Pd(OAc)2 and 2-aminopyrimidine-4,6-diol (ADHP) or dimethylamino-substituted ADHP (DMADHP) to functionalize iodouridine-labeled polynucleotides in the presence of various suitable boronic acid and ester substrates. In another example, a polynucleotide containing 8-bromoguanosine can be reacted with an arylboronic acid in the presence of a catalytic system made of Pd(OAc)2 and a water-soluble triphenylphosphine-3,3',3"-trisulfonate ligand.

[0265] For example, Michael addition reactions can be used to generate polynucleotide conjugates via the reaction of an electron-rich Michael Donor with an α,β-unsaturated compound (Michael Acceptor).

[0266] In some embodiments, the conjugated moiety as used herein may include a hapten group. The hapten group may include digoxin, 2,4-dinitrophenyl, biotin, avidin, or may be selected from azoles, nitroaryl compounds, benzofurazans, triterpenes, ureas, thioureas, rotenone, oxazoles, thiazoles, coumarins, cyclolignans, heteroaryl compounds, azoaryl compounds or benzodiazepines. The hapten group may include biotin. The nucleic acid comprising the conjugated moiety may also be connected to, for example, a second nucleic acid, a fluorescent moiety (such as a dye, such as a quantum dot) or a conjugated partner (such as a polymer (such as PEG)), a macromolecule (such as a carbohydrate, a lipid, a polypeptide).

[0267] In some embodiments, the synthetic delivery system disclosed herein comprises a polynucleotide conjugated to a cargo. The polynucleotide can be conjugated to, for example, a compound (e.g., a small molecule), an antibody or fragment thereof, a peptide, a protein, an aptamer, a drug, a second polynucleotide, or a combination thereof.

[0268] In some embodiments, a chelator is used to conjugate a polynucleotide to a conjugation partner (eg, cargo).

[0269] In some embodiments, the synthetic delivery systems disclosed herein comprise a first conjugation moiety conjugated to a first conjugation partner (e.g., a cargo) and a second conjugation moiety conjugated to a second conjugation partner (e.g., the same or different conjugation partner and / or cargo).

[0270] II. Goods

[0271] In some embodiments, the disclosure provides compositions and methods for cell, tissue and / or organ specific binding, targeting, uptake, nuclear localization and / or genomic integration of goods. Synthetic delivery systems disclosed herein can be used to deliver goods to target cells. For example, the recognition sequence of a synthetic delivery system can be combined with a component (e.g., a receptor) of a target cell to promote the binding, uptake, nuclear localization and / or genomic integration of the goods of a synthetic delivery system.

[0272] The cargo may be delivered to the membrane or surface of the target cell. The cargo may be delivered to the cytoplasm of the target cell. The cargo may be delivered to the cytosol of the target cell. The cargo may be delivered to the nucleus of the target cell.

[0273] The cargo may be or may comprise, consist essentially of, or consist of a nucleic acid cargo. The cargo may be or may comprise DNA, such as dsDNA or ssDNA. The cargo may be, comprise, or encode RNA, such as mRNA, rRNA, tRNA, siRNA, shRNA, or ncRNA. The cargo may be or may comprise a transgene.

[0274] The cargo may be or may include a nucleic acid encoding a protein. The cargo may be or may include a nucleic acid encoding a therapeutic protein. The cargo may be or may include a nucleic acid encoding the following: for example, a cytotoxic polypeptide (e.g., a caspase, such as a self-activated, inducible or non-inducible caspase, a protein that induces p53-mediated apoptotic cell killing CASP3, CASP8, CASP9, BAX, DNA fragmentation factor (DFF) 40, or herpes simplex virus thymidine kinase (HSV-TK)), a tumor suppressor, an antigenic peptide, an antibody or its antigen-binding fragment, an enzyme, a cytokine, a signaling molecule, a microorganism (e.g., a bacteria or virus) antigen or epitope, a polypeptide that increases an immune response, or a polypeptide that reduces an immune response. The cargo may be or may include a nucleic acid encoding a diagnostic protein. The cargo may be or may include a diagnostic protein. The cargo may be, include, or encode an immunomodulatory factor. The cargo may be, include, or encode an immune checkpoint regulator, such as an immune checkpoint inhibitor or activator. The cargo may be, include, or encode one or more new antigens or tumor-associated antigens. The cargo may be, contain or encode a factor that changes the sensitivity of the target cell to the drug. The cargo may be a nucleic acid encoding an immune receptor, such as a chimeric antigen receptor (CAR).

[0275] The cargo gene encoding the protein may be operably linked to a promoter (such as a promoter that is also part of the cargo) and / or under the regulatory control of the promoter. For example, the promoter may be constitutive, inducible and / or cell type specific for expressing RNA and / or protein in the target cell. The cargo may be or may comprise a nucleic acid that does not encode a protein.

[0276] In some embodiments, the cargo encodes an endogenous protein or functional RNA molecule that is lacking or functionally impaired in the subject. In some embodiments, the subject carries a genetic mutation, such as a cancerous mutation, a loss-of-function mutation, or a gain-of-function mutation, which can be treated by providing a therapeutic cargo (e.g., a transgene that encodes a missing or impaired protein or RNA or inhibits a pathogenic protein or RNA).

[0277] In some embodiments, the cargo is a nucleic acid that inserts into the genome and causes genetic or genomic instability and / or cell death (e.g., of a cancer target cell).

[0278] In some embodiments, the cargo is a nucleic acid comprising natural or non-natural nucleotide analogs or bases.

[0279] The cargo may be or may comprise a polypeptide. The polypeptide may be a therapeutic polypeptide. The polypeptide may be a diagnostic polypeptide. The polypeptide may be an anti-cancer polypeptide. The polypeptide may be a cytotoxic peptide, for example, for inducing cell death of target cells, such as apoptosis, necroptosis or necrosis. The cargo may be or may comprise, for example, a tumor suppressor, an antigenic peptide, an antibody or antigen-binding fragment thereof, an enzyme, a cytokine, a signaling molecule, a polypeptide that increases an immune response, or a polypeptide that decreases an immune response.

[0280] Cargo can be or can comprise a small molecule or organic molecule (e.g., a small molecule therapeutic agent or a fluorescent dye). A small molecule or organic molecule can be or can comprise a therapeutic agent. A small molecule or organic molecule can be or can comprise a diagnostic agent. A small molecule or organic molecule can be or can comprise a cytotoxic agent. In some embodiments, a small molecule or organic molecule is or comprises a radiolabeled molecule or a radioactive cytotoxic molecule. A small molecule or organic molecule can be an anticancer drug. A small molecule or organic molecule can be a kinase inhibitor. A small molecule can be a compound (e.g., an organic compound) having a molecular weight of, for example, at most 500, at most 600, at most 700, at most 800, at most 900, at most 1000, at most 1100, at most 1200, or at most 1500 Daltons.

[0281] The cargo may be or may contain a therapeutic agent. Non-limiting examples of therapeutic agents that the cargo may be or may contain include vaccines (e.g., mRNA vaccines), AKT inhibitors, alkylating agents, anti-angiogenic agents, antibiotic agents, antifolates, anti-hormone therapy, anti-inflammatory agents, antimetabolites, anti-VEGF agents, apoptosis promoters, aromatase inhibitors, ATM regulators, biologics, BRAF inhibitors, BTK inhibitors, chimeric antigen receptors (e.g., nucleotides encoding CAR), CDK inhibitors, cell growth arrest inducers, chemotherapeutic agents, cytokines, cytotoxic drugs, demethylating agents, differentiation inducers, estrogen receptor antagonists, gene therapy agents, growth factor inhibitors, growth factor receptor inhibitors, HDAC inhibitors, heat shock protein inhibitors, hematopoietic stem cell transplantation (HSCT), hormones, hydrazines, immune checkpoint inhibitors, immunomodulators, immunosuppressants, kinase inhibitors, KRAS inhibitors, genes In some embodiments, the cargo may be a nucleic acid of any of the foregoing agents, such as a metalloproteinase inhibitor, a MEK inhibitor, a mitotic inhibitor, an mTOR inhibitor, a multispecific (e.g., bispecific) immune cell engager, a multispecific (e.g., bispecific) killer cell engager, a multispecific (e.g., bispecific) T cell engager, a nitrogen mustard, an oncolytic virus, an oxophosphine, a p53 reactivator, a plant alkaloid, a platinum-based agent, a proteasome inhibitor, a purine analog, a purine antagonist, a pyrimidine antagonist, a radiotherapy, a ribonucleotide reductase inhibitor, a signal transduction inhibitor, an RNA silencing (e.g., RNAi) agent, a gene editing agent, a CRISPR / Cas system or a component thereof, an RNA replacement therapy, a protein replacement therapy, a gene therapy, an antibody drug conjugate, surgery, a taxane, a therapeutic antibody, a topoisomerase inhibitor, a tyrosine kinase inhibitor, a vinca alkaloid, and encoding any of the foregoing agents applicable. For example, the cargo may be an anticancer therapeutic agent.

[0282] The cargo may be or may include a drug. The cargo may be or may include a non-cancer therapeutic agent, for example, a therapeutic agent for a metabolic disease, an autoimmune disease, a neurological disease, or a degenerative disease. The cargo may be or may include a vaccine (e.g., a cancer vaccine), a drug, an immunotherapy, an immune checkpoint inhibitor, a kinase inhibitor, a small molecule, a chemotherapeutic agent, a radiotherapy, a biologic, or any combination thereof.

[0283] Goods as therapeutic agents or containing therapeutic agents can regulate (e.g., increase or decrease) the activity of a target gene (e.g., an abnormally expressed gene) or a product (such as a protein or RNA) encoded by the target gene. Goods as therapeutic agents or containing therapeutic agents can regulate (e.g., increase or decrease) the expression of a target gene (e.g., an abnormally expressed gene). Goods as therapeutic agents or containing therapeutic agents can regulate (e.g., increase or decrease) the activity of a ligand or receptor of a target gene (e.g., an abnormally expressed gene). In some embodiments, goods as or containing therapeutic agents can, for example, change the gene product of an abnormally expressed gene by targeting a gene product, a transcript of a gene, or an epigenetic factor that affects a gene property (e.g., expression). Non-limiting examples include proteins encoded by targeted genes, using gene therapy or RNAi to reduce the expression level of a gene, and using RNA vaccines to establish an immune response.

[0284] In some embodiments, the cargo can be or can comprise a dye (eg, a fluorescent dye), a radioisotope, or a contrast agent for use in in vivo diagnostic imaging.

[0285] In some embodiments, the cargo is a detectable label (e.g., a fluorescent label, quantum dots, Quasar dyes, or radioactive labels). The detectable label can be a radioactive label (e.g., a radioisotope) that facilitates visualization of the distribution of the constructs disclosed herein via positron emission tomography (PET) or single photon emission computed tomography (SPECT). The detectable moiety can comprise a radioisotope of at least one element.

[0286] The cargo may be or may comprise a radionucleotide. The cargo may be or may comprise a polymer. The cargo may be or may comprise a nanoparticle. In some embodiments, the cargo may cause DNA damage from outside the target cell or from inside the target cell.

[0287] The cargo can be covalently or non-covalently attached to the polynucleotide or synthetic delivery system.

[0288] In some embodiments, the synthetic delivery system does not include cargo. For example, in some embodiments, the polynucleotides disclosed herein can directly affect target cells, for example, by inducing cell death after binding, uptake, nuclear transport and / or genomic integration of the polynucleotides. In some embodiments, the synthetic delivery system acts as an antagonist to reduce the uptake of ctDNA.

[0289] III. Target Cells

[0290] The compositions and methods disclosed herein can be used to deliver goods to target cells. For example, by contacting the target cells with the synthetic delivery systems and / or polynucleotides disclosed herein, the target cells can be induced to take up the synthetic delivery systems or goods. The methods disclosed herein can include delivering goods to target cells.

[0291] The target cell can be a primary cell. The target cell can be a cancer cell, such as a blood tumor cell or a solid tumor cell. The target cell can be a cell line.

[0292] The target cell may be a eukaryotic cell. The target cell may be a mammalian cell. The target cell may be a human cell.

[0293] The target cell may be a leukocyte, such as a lymphoid cell or a myeloid cell. The target cell may be a plasma cell. The target cell may be a multiple myeloma cell. The target cell may be a B cell. The target cell may be a T cell. The target cell may be a lymphocyte. The target cell may be a monocyte or a macrophage. The target cell may be a tumor myeloid cell. The target cell may be a tumor lymphoid cell. The target cell may be a multiple myeloma cell. The target cell may be a leukemia cell. The target cell may be a lymphoma cell.

[0294] The target cell may be a pancreatic cell. The target cell may be an exocrine pancreatic cell. The target cell may be an endocrine pancreatic cell. The target cell may be a pancreatic cancer cell. The target cell may be a bile duct cell. The target cell may be a gallbladder cell.

[0295] The target cell may be a gastrointestinal cell. The target cell may be, for example, an intestinal cell, such as a colon cell. The target cell may be a colorectal cancer cell.

[0296] The target cell can be, for example, a lymphoma, leukemia, lung cancer, colon cancer, or brain cancer cell.

[0297] In some embodiments, the target cell is a blood or hematopoietic cell. In some embodiments, the target cell is a bone marrow-derived cell.

[0298] In some embodiments, the target cell is a solid tumor cell, a liquid tumor cell, a blood cancer cell, a leukemia cell, a lymphoma cell, a B cell, a bladder cancer cell, a brain cancer (e.g., an astrocytoma, a glioblastoma, a meningioma, or an oligodendroglioma) cell, a breast cancer (e.g., ER+, PR+, HER2+, or triple-negative breast cancer) cell, a bone cancer cell, a cervical cancer cell, a colon cancer cell, a colorectal cancer cell, an esophageal cancer cell, a head and neck cancer cell, a kidney cancer cell, a liver cancer cell, a lung cancer cell, a medullary thyroid cancer cell, an oral cancer cell, a nasal cancer cell, an ovarian cancer (e.g., mucinous, endometrioid, clear cell, or undifferentiated) cell, a pancreatic cancer cell, a renal cancer cell, a skin cancer cell, a stomach cancer cell, a laryngeal cancer cell, a thyroid cancer cell, a uterine cancer cell, a cancer cell, a sarcoma cell, an adenocarcinoma cell, a cancer cell of unknown primary tissue, or a neuroendocrine tumor cell.

[0299] In some embodiments, the synthetic delivery systems, polynucleotides, nucleic acid sequences, first nucleic acid sequences, second nucleic acid sequences, recognition sequences, or integration sequences disclosed herein, or functional fragments thereof, can specifically or preferentially mediate binding, uptake, and / or genomic integration of target cells. For example, in some embodiments, the synthetic delivery systems disclosed herein can be at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 2-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 50-fold, at least The target cell disclosed herein is at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 300 times, at least 350 times, at least 400 times, at least 500 times, at least 600 times, at least 700 times, at least 800 times, at least 900 times, at least 1000 times, at least 1500 times, at least 2000 times, or at least 3000 times binding to the target cell disclosed herein, entering the target cell, localizing to the nucleus of the target cell, and / or integrating into the genome of the target cell. The control cell can be, for example, a different cell or tissue type. Compared to the target cell that is a cancer cell, the control cell can be, for example, a corresponding cell type that is a non-cancerous cell.

[0300] In some embodiments, specificity for target cells can reduce off-target effects and unwanted side effects, for example, compared to conventional cargo delivery systems (eg, nanoparticles or viral vectors).

[0301] IV. Pharmaceutical Compositions

[0302] The compositions disclosed herein can be pharmaceutical compositions (e.g., formulations), and the methods can utilize pharmaceutical compositions. For example, in some embodiments, a pharmaceutical composition is provided, comprising a compound, such as a synthetic delivery system, a polynucleotide, a cargo, a therapeutic agent and / or a diagnostic agent, and a pharmaceutically acceptable excipient, carrier, vehicle, or diluent. In some embodiments, the disclosure provides a pharmaceutical composition comprising a synthetic delivery system or polynucleotide disclosed herein and a pharmaceutically acceptable excipient, carrier, vehicle, or diluent.

[0303] Active agents or compounds described herein (e.g., synthetic delivery systems, polynucleotides, goods, therapeutic agents and / or diagnostic agents) can be used in combination with other chemical and / or pharmaceutically acceptable components, such as carriers, stabilizers, diluents, dispersants, suspending agents, thickeners, antioxidants, solubilizers, buffers, permeants, salts, surfactants, amino acids, encapsulating agents, fillers, cryoprotectants and / or excipients to form pharmaceutical compositions. The composition can facilitate the application of any active agent described herein (e.g., polynucleotides or synthetic delivery systems) to an organism. The composition can be administered as a pharmaceutical composition in a therapeutically effective amount by various forms and approaches, including, for example, intravenous, subcutaneous, intramuscular, rectal, aerosol, parenteral, ocular, pulmonary, transdermal, vaginal, optical, nasal, oral, sublingual, inhalation, dermal, intrathecal, intranasal and topical administration (e.g., for use in melanoma). The pharmaceutical composition can be administered in a local or systemic manner, for example, by direct injection of nucleic acid molecules as described herein into an organ, optionally in a reservoir.

[0304] Parenteral injection can be formulated for bolus injection or continuous infusion. Pharmaceutical compositions as described herein can be in the form of sterile suspensions, solutions or emulsions in oily or aqueous vehicles suitable for parenteral injection, and contain preparatons, such as suspending agents, stabilizers and / or dispersants. Pharmaceutical formulations for parenteral administration include aqueous solutions of compounds, such as synthetic delivery systems, polynucleotides, goods, therapeutic agents and / or diagnostic agents described herein in water-soluble forms. Suspensions of one or more active compounds can be prepared as oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils (such as sesame oil) or synthetic fatty acid esters (such as ethyl oleate or triglycerides) or liposomes. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran. The suspension can also contain suitable stabilizers or increase the solubility of the compound and / or reduce the aggregation of the compound to allow the preparation of a medicament for a highly concentrated solution. Alternatively or in addition, the compound can be lyophilized or in powder form for reconstitution with a suitable vehicle (e.g., sterile pyrogen-free water) prior to use. In some cases, the compound (such as a synthetic delivery system, polynucleotides, goods, therapeutic agents and / or diagnostic agents) is injected directly into a tissue. The compounds described herein, such as synthetic delivery systems, polynucleotides, goods, therapeutic agents and / or diagnostic agents, can be administered to a subject, homed, targeted, migrated to, penetrated an organ (e.g., pancreas) or cell (e.g., multiple myeloma cell).

[0305] During surgery, the compounds of the present disclosure (such as synthetic delivery systems, polynucleotides, goods, therapeutic agents and / or diagnostic agents) can be directly applied to organs or organ tissues or cells, such as lungs or pancreas. Compounds (such as synthetic delivery systems, polynucleotides, goods, therapeutic agents and / or diagnostic agents) can be applied topically and can be formulated into various topically applied compositions, such as solutions, suspensions, lotions, gels, slurries, medical sticks, skin creams, creams and ointments. Such pharmaceutical compositions can contain solubilizers, stabilizers, tension enhancers, buffers and preservatives.

[0306] In practicing the treatments or methods of use provided herein, a therapeutically effective amount of a compound (such as a synthetic delivery system, polynucleotide, cargo, therapeutic agent and / or diagnostic agent) can be administered in a pharmaceutical composition to a subject suffering from a disease or condition to be treated (e.g., cancer). In some embodiments, the subject is a mammal, such as a human. The therapeutically effective amount can vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the compound used, and other factors.

[0307] Pharmaceutical compositions can be prepared using one or more physiologically acceptable carriers (including excipients and adjuvants), which can help to process the active compound into a pharmaceutically usable preparation. The formulation can be modified and adapted according to the selected route of administration. The pharmaceutical composition comprising polynucleotides as described herein or synthetic delivery systems can be manufactured, for example, by expressing polynucleotides, purifying polynucleotides or comprising polynucleotides in a recombinant system, a complex, lyophilized nucleic acid molecules, mixing, dissolving, granulating, preparing dragees, pulverizing, emulsifying, encapsulating, embedding or compression processes. The pharmaceutical composition can include at least one pharmaceutically acceptable carrier, diluent or excipient and a compound described herein as a free alkali or a pharmaceutically acceptable salt form. The pharmaceutical composition can contain a solubilizing agent, a stabilizer, a tension enhancer, a buffer and a preservative.

[0308] Methods for preparing compositions of compounds described herein (e.g., synthetic delivery systems, polynucleotides, nucleic acids, or polynucleotides attached to cargo) include formulating the compounds with one or more inert, pharmaceutically acceptable excipients or carriers to form solid, semisolid or liquid compositions. Solid compositions include, for example, powders, tablets, dispersible granules, capsules, cachets, and suppositories. These compositions may also contain small amounts of auxiliary substances such as wetting agents or emulsifiers, pH buffers, and other pharmaceutically acceptable additives.

[0309] Liquid compositions include, for example, solutions in which the compound is dissolved, emulsions containing the compound, or solutions containing liposomes, micelles, or nanoparticles containing the compound as disclosed herein. Semisolid compositions include, for example, gels, suspensions, and creams. The composition can be in the form of a liquid solution or suspension, a solid form suitable for dissolution or suspension in a liquid prior to use, or in the form of an emulsion.

[0310] The disclosed compositions may optionally contain a pharmaceutically acceptable preservative.

[0311] Non-limiting examples of pharmaceutically acceptable excipients can be found, for example, in Remington: The Science and Practice of Pharmacy, 19th edition (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, L., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th edition (Lippincott Williams & Wilkins 1999), each of which is incorporated by reference in its entirety.

[0312] Non-limiting examples of pharmaceutically acceptable carriers include physiological saline, Ringer's solution and glucose solution. In some embodiments, the pH of the solution can be from about 5 to about 8, from about 7 to 8, or from about 7 to about 7.5. Additional carriers include sustained release formulations, such as semipermeable matrices of solid hydrophobic polymers containing the compound. The matrix can be in the form of a shaped article, such as a film, a liposome, a microparticle or a microcapsule.

[0313] The pharmaceutical compositions described herein can be in a unit dosage form suitable for single administration of precise doses. In a unit dosage form, the formulation can be divided into unit doses containing an appropriate amount of one or more synthetic delivery systems, antagonists or therapeutic agents. The unit dose can be in the form of a package containing a discrete amount of the formulation. Non-limiting examples are packaged injections, vials and ampoules. The aqueous suspension compositions disclosed herein can be packaged in a single dose non-reclosable container. A multi-dose reclosable container can be used, for example, with or without a preservative. The formulations disclosed herein for injection can be presented in a unit dosage form, for example, in an ampoule with a preservative or in a multi-dose container.

[0314] V. Methods

[0315] In some embodiments, disclosed herein is a method of delivering a cargo to a target cell. Various assays can be used to demonstrate receptor binding, uptake, nuclear localization and / or genomic integration of a cargo, synthetic delivery system, or polynucleotide.

[0316] The present disclosure provides methods for the identification, characterization, isolation, synthesis, in vitro testing, and in vivo testing of cell- and tissue-type specific synthetic delivery systems.

[0317] The methods disclosed herein may include administering a therapeutic agent to a subject. The subject may be a subject in need, e.g., a subject suffering from a condition to be treated. The therapeutic agent administered to the subject may be or may comprise a synthetic delivery system disclosed herein, e.g., for the delivery of a cargo.

[0318] In some embodiments, methods using the synthetic delivery systems disclosed herein can be used to treat cancer, inflammatory diseases, or autoimmune diseases. In some embodiments, methods using synthetic delivery systems to deliver goods disclosed herein can be used to administer vaccines, for example, goods can include vaccines or components thereof, such as antigens and / or adjuvants, or nucleic acid sequences encoding antigens and / or adjuvants.

[0319] The synthetic delivery systems disclosed herein can be used to treat solid tumors. The synthetic delivery systems disclosed herein can be used to treat liquid tumors, such as blood cancers. The synthetic delivery systems disclosed herein can be used to treat any type of cancer disclosed herein.

[0320] The methods of the present disclosure can be used to treat a condition in a subject in need thereof, such as cancer. The cancer can be a solid tumor or a liquid cancer, such as a leukemia or lymphoma. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a blood disease, such as a B-cell cancer, such as multiple myeloma. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is colon cancer or colorectal cancer. In some embodiments, the cancer is lung cancer.

[0321] In some embodiments, cancer includes bladder cancer, brain cancer (e.g., astrocytoma, glioblastoma, meningioma or oligodendroglioma), breast cancer (e.g., ER+, PR+, HER2+ or triple-negative breast cancer), bone cancer, cervical cancer, colon cancer, colorectal cancer, esophageal cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, medullary thyroid cancer, oral cancer, nasal cancer, ovarian cancer (e.g., mucinous carcinoma, endometrioid carcinoma, clear cell or undifferentiated), pancreatic cancer, kidney cancer, skin cancer, stomach cancer, laryngeal cancer, thyroid cancer or uterine cancer. In some embodiments, cancer includes bladder cancer, brain cancer, breast cancer, colon cancer, colorectal cancer, lung cancer or ovarian cancer. In some embodiments, cancer is lung cancer. In some embodiments, cancer is brain cancer. In some embodiments, cancer is breast cancer, for example, triple-negative breast cancer. In some embodiments, cancer is ovarian cancer. In some embodiments, cancer is bladder cancer.

[0322] In some embodiments, the cancer is a carcinoma. In some embodiments, the cancer is a sarcoma. In some embodiments, the cancer is an adenoma. In some embodiments, the cancer is an adenocarcinoma.

[0323] In some embodiments, the cancer is a cancer of unknown primary tissue. In some embodiments, the methods disclosed herein are used to identify the primary tissue type. In some embodiments, the cancer is a neuroendocrine tumor.

[0324] Treatment can include administering a synthetic delivery system to a subject. Treatment can include administering a synthetic delivery system of the present disclosure to a subject by the following means: intravenously, subcutaneously, intramuscularly, by inhalation, dermal, intradermal, topical, oral, sublingual, intrathecal, transdermal, intranasal, intracerebral, intraspinal, intraarticular, ocular, rectal, via a peritoneal route, or directly into the brain, for example, via an intracerebral ventricular route. The synthetic delivery system can be administered topically. The synthetic delivery system can be administered systemically. The synthetic delivery system can be administered parenterally. The synthetic delivery system or antagonist can be administered by absorption of an epithelial or mucocutaneous lining (e.g., oral mucosa, rectal and / or intestinal mucosa).

[0325] The synthetic delivery systems or therapeutic agents described herein can be administered before, during, or after the onset of a disease or condition, and the time limit for administering the composition containing the synthetic delivery system or therapeutic agent can vary. For example, the composition can be used as a prophylactic and can be continuously administered to an object with a condition or disease tendency to reduce the likelihood of the disease or condition occurring. The composition can be administered to an object that already has a disease or condition in a dosage sufficient to cure or at least partially prevent the symptoms of the disease or condition, or to cure, heal, improve, or alleviate the condition. The composition can be administered to the object as soon as possible during or after the onset of symptoms.

[0326] The various synthetic delivery systems or therapeutic agents disclosed herein can be administered in any order or simultaneously. If administered simultaneously, the various synthetic delivery systems or therapeutic agents can be provided in a single unified form or in multiple forms (e.g., as multiple separate injections or infusions). The synthetic delivery systems or therapeutic agents can be packaged together or individually, in a single package or in multiple packages. One or all synthetic delivery systems or therapeutic agents can be given in multiple doses.

[0327] In some embodiments, the components of the cargo or polynucleotide are integrated into the target cell genome at the positions identified in Table 2, Table 4, Table 7, or Table 8. In some embodiments, the components of the cargo or polynucleotide are integrated into the target cell genome at Chr2: 32916224-32916626. In some embodiments, the components of the cargo or polynucleotide are integrated into the target cell genome at Chl6: 32628381-32629000.

[0328] The methods and compositions of the present disclosure can be used to change the phenotype of target cells and / or target cell colonies. In some cases, the phenotypic changes of target cells in an object can improve the treatment and / or clinical response of the object to therapeutic intervention. In some embodiments, the methods and compositions of the present disclosure can be used to change the sensitivity of target cells or target cell colonies to drugs, for example, to increase the sensitivity of cancer cells to anticancer drugs, or to limit or reduce the sensitivity of cancer cells to anticancer drugs.

[0329] The compositions or methods disclosed herein can be used to induce an immune response in an object, for example, when a synthetic delivery system is used. For example, an immune response can be induced by administering a nucleic acid construct comprising a cargo nucleic acid sequence encoding one or more antigenic or immunogenic peptides or proteins, and such immunogenic peptides or proteins can induce an immune response in an object when expressed. In some embodiments, a synthetic delivery system induces an immune response based on the presence of cytoplasmic nucleic acids (e.g., DNA). In some embodiments, a synthetic delivery system induces an immune response based on the expression of a transgenic by a nucleic acid cargo (e.g., encoding a cytokine, antigen, or other immunomodulator).

[0330] In some embodiments, the high specificity and / or efficiency of delivery to target cells (e.g., multiple myeloma cells) by the synthetic delivery systems disclosed herein facilitates the use of the synthetic delivery systems as therapeutic vectors. For example, in some embodiments, the synthetic delivery systems facilitate preferential delivery to target cells (e.g., hematological cancer cells, such as multiple myeloma cells), with lower or substantially no delivery to non-target cells (e.g., bone marrow cells that are not hematological cancer cells, multiple myeloma cells, precursors thereof, cancer stem cells, or a combination thereof).

[0331] In some embodiments, the nucleic acid cargo or components of the polynucleotide are integrated into the target cell genome via homologous recombination or homology-directed repair. In some embodiments, the polynucleotide sequences disclosed herein can largely define the direction of insertion. In some embodiments, the polynucleotide comprises one or more guide nucleic acid sequences to facilitate insertion at a specific insertion site within the genome of the target cell.

[0332] In some embodiments, the synthetic delivery systems or polynucleotides disclosed herein can be used for various chronic, infectious or hereditary (e.g., genetic) diseases (including cancer and certain disorders associated with, for example, blood cells (e.g., anemia, thalassemia, hemophilia or platelet disorders)) for diagnosis and monitoring purposes. In some cases, the presence of cell and / or tissue-specific recognition sequences as disclosed herein can be used as biomarkers for specific diseases or conditions and / or can be used to monitor responses to specific therapeutic interventions (e.g., chemotherapy, targeted therapy, immunotherapy, cell therapy and / or gene therapy). In some embodiments, the synthetic delivery systems or polynucleotides disclosed herein can be used as diagnostic agents or in diagnostic methods. For example, integrating a polynucleotide or a portion thereof into the genome of a cell can be used as a measurement or marker to determine the degree of integration of a cargo nucleic acid sequence (e.g., a therapeutic gene sequence) with the genome. In some embodiments, cell targeting and genomic integration of polynucleotides, nucleic acid sequences, cargoes or synthetic delivery systems described herein or components thereof can be used as markers for specific biological effects. In an example, the extent of uptake or genomic integration of a cargo, polynucleotide, or portion thereof can be a marker or measure of a therapeutic effect (e.g., cell killing, cargo delivery, or expression of a nucleic acid cargo).

[0333] In some embodiments, synthetic delivery systems are used to deliver therapeutic and / or diagnostic cargo to specific cells, cell types, tissues, tissue types, or target organs.

[0334] In some embodiments, the synthetic delivery system is used to visualize and / or track a disease or condition (e.g., cancer) in vivo, for example, by delivering a chemical dye (e.g., a fluorescent dye) or a radioisotope to one or more cells associated with the disease or condition. In another example, by using a synthetic delivery system disclosed herein, tumor cells can be visualized and tracked in vivo by delivering, for example, a chemical dye (e.g., a fluorescent dye), a radioisotope, or a contrast agent to one or more tumor sites (e.g., a primary tumor site and / or a metastatic site).

[0335] In some embodiments, the modular nature of the synthetic delivery systems disclosed herein facilitates the use of prevention, treatment and / or diagnosis of various diseases and conditions, which may include chronic, metabolic and infectious diseases or conditions such as cancer. The method may include administering an effective amount of a synthetic delivery system, polynucleotide or pharmaceutical composition to a subject. In some embodiments, an effective amount is an amount sufficient to alleviate (e.g., partially or completely alleviate) one or more signs or symptoms of the disease or condition being treated.

[0336] The synthetic delivery system, polynucleotide, or pharmaceutical composition can be administered in combination with one or more other therapeutic agents (e.g., a small molecule drug, an immunotherapeutic agent (e.g., an immune checkpoint blocker), a therapeutic antibody, or any other therapeutic agent disclosed herein).

[0337] Non-limiting examples of therapeutic agents that can be administered to a subject in combination with the synthetic delivery systems or polynucleotides disclosed herein include anti-cancer therapeutics, vaccines (e.g., mRNA vaccines), cancer vaccines, AKT inhibitors, alkylating agents, anti-angiogenic agents, antibiotic agents, antifolates, anti-hormone therapy, anti-inflammatory agents, antimetabolites, anti-VEGF agents, apoptosis promoters, aromatase inhibitors, ATM modulators, biologics, BRAF inhibitors, BTK inhibitors, CAR-T cells, CAR-NK cells, CDK inhibitors, cell growth arrest inducers, cell therapy, chemotherapy, cytokine therapy, cytotoxic drugs, demethylating agents, differentiation inducers, estrogen receptor antagonists, gene therapy agents, growth factor inhibitors, growth factor receptor inhibitors, HDAC inhibitors, heat shock protein inhibitors, hematopoietic stem cell transplantation (HSCT), hormones, hydrazines, immune checkpoint inhibitors (e.g., targeting the PD-1 / PD-L1 axis or other immune checkpoints, such as cytotoxic T lymphocyte-associated molecule 4 (CTLA-4) or LAG-3, TIM -3, TIGIT, VISTA or B7 / H3), immunomodulators, kinase inhibitors, KRAS inhibitors, matrix metalloproteinase inhibitors, MEK inhibitors, mitotic inhibitors, mTOR inhibitors, multispecific (e.g., bispecific) immune cell engagers, multispecific (e.g., bispecific) killer cell engagers, multispecific (e.g., bispecific) T cell engagers, nitrogen mustards, oncolytic viruses, oxaphos, p53 reactivators, plant alkaloids, platinum-based agents, proteasome inhibitors, purine analogs, purine antagonists, pyrimidine antagonists, radiation therapy, ribonucleotide reductase inhibitors, signal transduction inhibitors, RNA silencing (e.g., RNAi) agents, gene editing agents, CRISPR / Cas systems or components thereof, RNA replacement therapy, protein replacement therapy, gene therapy, antibody drug conjugates, surgery, taxanes, therapeutic antibodies, topoisomerase inhibitors, transgenic T cells, tyrosine kinase inhibitors, vinca alkaloids, and nucleic acids encoding any of the foregoing agents as applicable.

[0338] The methods and compositions of the present disclosure can be used to prevent, treat, prevent, reverse or alleviate the symptoms of a condition. The treatment may include treating a subject (e.g., an individual, domestic animal, wild animal, or laboratory animal suffering from a disease or condition) with a synthetic delivery system, polynucleotide, or pharmaceutical composition disclosed herein. The disease may be or include cancer or a tumor. When treating a condition, the delivery system, polynucleotide, or pharmaceutical composition of the present disclosure may be in contact with a tumor or cancer cell. The subject may be a mammal. The subject may be a human. The subject may be, for example, a human; a non-human primate, such as a chimpanzee and other apes and monkey species; farm animals, cattle, horses, sheep, goats, and pigs; or domestic animals, such as rabbits, dogs, and cats; laboratory animals, including rodents, such as rats, mice, and guinea pigs. In some embodiments, the subject is a non-rodent subject. The subject may be a female subject. The subject may be a male subject. Treatment may be provided to the subject before, during, or after the clinical onset of the disease.

[0339] In some embodiments, disclosed herein is a method of delivering a cargo to a target cell. The method may include contacting the target cell or a receptor on the target cell with a synthetic delivery system comprising a polynucleotide disclosed herein.

[0340] Compositions and methods disclosed herein can utilize receptors. The disclosed method can include, for example, by contacting a receptor with a synthetic delivery system or polynucleotides binding to a receptor and / or administering a binding receptor and / or an agent induced to be taken in via a receptor to deliver goods to a target cell. The receptor can be expressed by a target cell disclosed herein. In some embodiments, the expression of the receptor is specific to a target cell, a target cell type, or a target cell colony, thereby facilitating the specific delivery of goods to a target cell, a target cell type, or a target cell colony. In some embodiments, the expression of the receptor is relatively higher on a target cell, a target cell type, or a target cell colony than on a control cell, a control cell type, or a control cell colony, thereby facilitating the delivery of goods to a target cell, a target cell type, or a target cell colony. In some embodiments, the expression of the receptor is not specific to a target cell, a target cell type, or a target cell colony. Binding of the synthetic delivery system or polynucleotide to a receptor disclosed herein can induce uptake of the synthetic delivery system, polynucleotide, or cargo associated therewith, for example, by endocytosis, receptor-mediated endocytosis, clathrin-dependent endocytosis, caveolae-dependent endocytosis, CLIC / GEEC pathway uptake, lipid raft-associated endocytosis, phagocytosis, macropinocytosis, micropinocytosis, pinocytosis, or endosomal recycling.

[0341] The receptor may be or may comprise an MHC protein or a component thereof. The receptor may be or may comprise a human leukocyte antigen or a component thereof. The receptor may be or may comprise an MHC class I protein or a component thereof. For example, the receptor may be or may comprise HLA-A or a component thereof. The receptor may be or may comprise a protein that interacts with an MHC class I molecule, for example, APLP2.

[0342] The receptor may be or may comprise a G protein coupled receptor (GPCR) or a component thereof. The GPCR may be a class A (rhodopsin-like), class B (e.g., secretin and adhesion subfamily), class C (glutamate) or class F (Frizzled) family or subfamily GPCR. The GPCR may be a GPCR that triggers a cyclic adenosine 3,5-monophosphate (cAMP) response, calcium mobilization, or extracellular regulated protein kinase 1 / 2 (pERK1 / 2) phosphorylation. For example, the receptor may be or may comprise CD97 or a component thereof.

[0343] The receptor may be or may comprise an adhesion protein or a component thereof. For example, the receptor may be or may comprise CD97 or a component thereof, PTK7 or a component thereof, ITGB5 or a component thereof, ITGA2B or a component thereof, or αVβ5 integrin or a component thereof.

[0344] The receptor may be or may comprise an integrin or a component thereof. The receptor may be or may comprise, for example, ITGB5 or a component thereof, ITGA2B or a component thereof, or αVβ5 integrin or a component thereof.

[0345] The receptor may be or may comprise a tyrosine phosphatase or a component thereof. The receptor may be or may comprise a protein tyrosine phosphatase or a component thereof. The receptor may be or may comprise a protein tyrosine phosphatase receptor or a component thereof. The receptor may be or may comprise, for example, PTPRF or a component thereof.

[0346] The receptor may be or may comprise an ion channel or a component thereof. The receptor may comprise a sensory neuron ion channel, such as a nociceptor ion channel. The receptor may comprise a mechanical sensory function. The receptor may be or may comprise, for example, TMEM120A or a component thereof.

[0347] The receptor may be or may comprise a mineral transporter or a component thereof. The receptor may be or may comprise a ferroxidase or a component thereof. The receptor may be or may comprise, for example, ceruloplasmin or a component thereof.

[0348] The receptor may be or may comprise a metalloprotein or a component thereof. The receptor may be or may comprise, for example, ceruloplasmin or a component thereof.

[0349] The receptor may be or may comprise a nutrient transporter or a component thereof. The receptor may be or may comprise a monocarboxylate transporter or a component thereof. The receptor may be or may comprise, for example, SLC16A1 or a component thereof. The receptor may be or may comprise an amino acid transporter or a component thereof. The receptor may be or may comprise, for example, SLC7A5 or a component thereof.

[0350] The receptor may be or may comprise a receptor for fibronectin, fibrinogen, plasminogen, prothrombin, thrombin, vitronectin, or a combination thereof. For example, the receptor may be or may comprise ITGA2B or a component thereof.

[0351] The receptor may be or may comprise an ATPase or a component thereof. The receptor may be or may comprise a sodium / potassium transporting ATPase or a component thereof. The receptor may be or may comprise, for example, ATP1B1 or a component thereof. The receptor may be or may comprise a calcium transporter or a component thereof. The receptor may be or may comprise an ion transporting ATPase or a component thereof. The receptor may be, for example, ATP2B4 or a component thereof.

[0352] The receptor may be or may comprise an armadillo-like protein, e.g., comprising one or more armadillo repeats. The receptor may be or may comprise a member of the p120(ctn) / desmosome phycoerythrin protein subfamily of armadillo-like proteins, including, e.g., CTNND1, CTNND2, PKP1, PKP2, PKP4, or ARVCF. In some embodiments, the receptor is PKP4.

[0353] The receptor may be or may comprise an APP (amyloid precursor protein) family member, such as APP, APLP1 or APLP2. In some embodiments, the receptor is APLP2.

[0354] The receptor may be or may comprise a kinase. The receptor may be or may comprise a lipid kinase. The receptor may be or may comprise a phosphatidylinositol kinase. The receptor may be or may comprise a phosphatidylinositol-5-phosphate 4-kinase family member. The receptor may be capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The receptor may be or may comprise PIP4K2A.

[0355] The receptor may be or may comprise P142A or a component thereof.

[0356] In some embodiments, a particular cargo or cargo type disclosed herein can be delivered by targeting a synthetic delivery system to a receptor or receptor type disclosed herein (eg, via polynucleotide and / or recognition sequence targeting).

[0357] In some embodiments, targeting a synthetic delivery system to a receptor or receptor type disclosed herein can increase specific binding, uptake, nuclear localization, and / or genomic integration of the synthetic delivery system, polynucleotide, and / or cargo by target cells relative to control cells.

[0358] In some embodiments, the receptor comprises, consists essentially of, or consists of a single protein, receptor, or subunit disclosed herein. In some embodiments, the receptor comprises, consists essentially of, or consists of two proteins or subunits disclosed herein, or two receptors, proteins, or subunits facilitate uptake. In some embodiments, the receptor comprises, consists essentially of, or consists of three proteins or subunits disclosed herein, or three receptors, proteins, or subunits facilitate uptake.

[0359] The methods disclosed herein may include measuring the expression level of a receptor associated with the uptake of ctDNA, polynucleotides, transposable elements, or synthetic delivery systems. For example, a biological sample may be determined to determine whether the expression level of a receptor in a biological sample is associated with the uptake of ctDNA, polynucleotides, transposable elements, or synthetic delivery systems. The assay may measure the expression of a receptor at a protein level and / or an mRNA level, for example, the expression level of a receptor protein or mRNA encoding a receptor may be quantitatively or qualitatively determined. Any suitable assay may be used to determine the expression level of a receptor. Non-limiting examples of assays that can be used include immunohistochemistry, ELISA, multiple immunoassays, mass spectrometry (e.g., targeted or non-targeted), fluorescence microscopy, flow cytometry, quantitative PCR (e.g., quantitative reverse transcriptase real-time PCR), digital PCR, and RNA sequencing. In some embodiments, the assay is quantitative. In some embodiments, the assay is semi-quantitative, for example, providing an expression level relative to a control. The biological sample may include or may be a liquid. The biological sample may be a liquid biopsy. The biological sample may be or may include, for example, blood (e.g., whole blood). The biological sample may be or may include a solid. The biological sample can be or can comprise a solid tissue sample from any organ or tissue. The biological sample can be or can comprise a biopsy that includes tumor tissue or is suspected of including tumor tissue. The biological sample can comprise tumor tissue of, for example, any cancer or tumor type disclosed herein. The biological sample can comprise cancer cells of, for example, any cancer or tumor type disclosed herein. The biological sample can comprise primarily cells from a particular organ or from tissue within a particular organ.

[0360] The degree of sequence identity between two sequences can be determined, for example, by comparing two sequences using a computer program (such as a global or local alignment algorithm) that is generally used for this purpose. Non-limiting examples include BLASTp, BLASTn, Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT or another suitable method or algorithm. Needleman and Wunsch global alignment algorithms can be used to compare two sequences over the entire length, maximizing the number of matches and minimizing the number of spaces. Default settings can be used.

[0361] VI. Implementation Plan

[0362] Embodiment 1. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to at least 10 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0363] Embodiment 2. The pharmaceutical composition of embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with at least 15 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0364] Embodiment 3. The pharmaceutical composition of embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with at least 20 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0365] Embodiment 4. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with at least 30 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0366] Embodiment 5. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0367] Embodiment 6. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with at least 75 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0368] Embodiment 7. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity with at least 100 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0369] Embodiment 8. The pharmaceutical composition of any one of Embodiments 1-7, wherein the polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-78.

[0370] Embodiment 9. The pharmaceutical composition of embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0371] Embodiment 10. The pharmaceutical composition of embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 15 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0372] Embodiment 11. The pharmaceutical composition of embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with at least 20 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0373] Embodiment 12. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to at least 30 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0374] Embodiment 13. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to at least 50 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0375] Embodiment 14. The pharmaceutical composition of embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to at least 75 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0376] Embodiment 15. The pharmaceutical composition of Embodiment 1, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to at least 100 consecutive nucleotides of any one of SEQ ID NOs: 1-78.

[0377] Embodiment 16. The pharmaceutical composition of any of the preceding embodiments, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-78.

[0378] Embodiment 17. The pharmaceutical composition of any of the preceding embodiments, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOs: 1-78.

[0379] Embodiment 18. The pharmaceutical composition of any of the preceding embodiments, wherein the polynucleotide comprises a nucleotide sequence having at least 97% sequence identity to any one of SEQ ID NOs: 1-78.

[0380] Embodiment 19. The pharmaceutical composition according to embodiment 1, wherein the polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs: 1-78.

[0381] Embodiment 20. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide, wherein the polynucleotide comprises a transposable element, and the transposable element is AluSp, MER11C, AluY, 2L2a, ALluY, ALR / Alpha, ALU, AluJb, AluS1, AluSc8, AluSg, ALUSg2, AluSq, AluSq2, ALUSx, AluSx, AluSx1, AluSz, AluSz6, AluYc3, ASLUSq2, ERVK / LTR, ERVL, ERVL-MaLR, FLAM_C, and AluY, HERV17-int, HERV9N-int, L1M1, L1MB3, L1ME4b, L1MEg, L1P1, L1P3, L1P A10, L1PA15, L1PA7, L1PB4, L2a, L2a / LTR40b / MLT1J2, LINE / L1, LINE / L2, LTR, LTR / ERV1, LTR / ERVL, LTR / ERVL-MaLR, LTR / Gypsy, LTR41C, LTR81B, Mam_R4, Mamr4, Many, MER11B, MER41E, MIR, MIRB, MIRc, MIRc-part of L2, MLT1J2, MLT2B1, MLT1J2, MLT2B4, parAluSp-FULLMTL1J2, REP522, Satellite / centr, SINE / Alu, SINE / MIR, THE1A, THE1B, THE1C, or Tigger3a transposable element.

[0382] Embodiment 21. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence facilitates binding or uptake of the synthetic delivery system by a target cell, wherein the recognition sequence comprises a nucleic acid sequence identified in circulating tumor DNA (ctDNA) from a cell type substantially similar to the target cell, wherein the polynucleotide comprises a short interspersed nuclear element (SINE), a long interspersed nuclear element (LINE), an ERVL, or an ERVK transposable element.

[0383] Embodiment 22. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an AluSp transposable element.

[0384] Embodiment 23. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises a MER11C transposable element.

[0385] Embodiment 24. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an AluSx transposable element.

[0386] Embodiment 25. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises a MLT1J transposable element.

[0387] Embodiment 26. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an AluSg2 transposable element.

[0388] Embodiment 27. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises a THE1A transposable element.

[0389] Embodiment 28. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an AluJb transposable element.

[0390] Embodiment 29. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises a MLT2B4 transposable element.

[0391] Embodiment 30. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an L2a transposable element.

[0392] Embodiment 31. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an MLT1J2 transposable element.

[0393] Embodiment 32. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an AluSq transposable element.

[0394] Embodiment 33. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an L1MB3 transposable element.

[0395] Embodiment 34. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises a THE1C transposable element.

[0396] Embodiment 35. The pharmaceutical composition of any one of Embodiments 1-21, wherein the polynucleotide comprises an AluY transposable element.

[0397] Embodiment 36. The pharmaceutical composition of any of the preceding embodiments, wherein the polynucleotide comprises double-stranded DNA.

[0398] Embodiment 37. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system further comprises a cargo.

[0399] Embodiment 38. The pharmaceutical composition of Embodiment 37, wherein the cargo comprises a nucleic acid cargo.

[0400] Embodiment 39. The pharmaceutical composition according to Embodiment 38, wherein the nucleic acid cargo is attached to the 3' end of the polynucleotide.

[0401] Embodiment 40. The pharmaceutical composition according to Embodiment 38, wherein the nucleic acid cargo is attached to the 5' end of the polynucleotide.

[0402] Embodiment 41. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system comprises a promoter.

[0403] Embodiment 42. The pharmaceutical composition of any one of Embodiments 38-41, wherein the cargo nucleic acid encodes a tumor suppressor protein.

[0404] Embodiment 43. The pharmaceutical composition of any one of Embodiments 37-42, wherein the cargo comprises a cytotoxic cargo.

[0405] Embodiment 44. The pharmaceutical composition of any one of Embodiments 37-43, wherein the cargo comprises a therapeutic cargo.

[0406] Embodiment 45. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system does not utilize viral vectors, nanoparticles, lipid nanoparticles, liposomes, exosomes, dendrimers, gene guns, or electroporation.

[0407] Embodiment 46. A method of delivering a cargo to a target cell, the method comprising contacting the target cell with the pharmaceutical composition or synthetic delivery system according to any one of the preceding embodiments.

[0408] Embodiment 47. The method of Embodiment 46, wherein the cargo is delivered to the nucleus of the target cell.

[0409] Embodiment 48. The method of embodiment 46 or embodiment 47, wherein the synthetic delivery system further comprises an integration sequence that facilitates integration of the polynucleotide, synthetic delivery system, or cargo into the genome of the target cell.

[0410] Embodiment 49. The method of any one of Embodiments 46-48, wherein the cargo comprises a nucleic acid cargo.

[0411] Embodiment 50. The method of Embodiment 49, wherein the cargo nucleic acid is integrated into the genome of the target cell.

[0412] Embodiment 51. The method of Embodiment 49, wherein the cargo nucleic acid is integrated into the genome of the target cell at the position identified in Table 2, Table 4, Table 7, or Table 8.

[0413] Embodiment 52. The method of embodiment 49, wherein the nucleic acid cargo is integrated into the target cell genome at Chr2:32916224-32916626.

[0414] Embodiment 53. The method of embodiment 49, wherein the nucleic acid cargo is integrated into the target cell genome at Ch16:32628381-32629000.

[0415] Embodiment 54. The method of any one of Embodiments 46-53, wherein the target cell is a leukocyte.

[0416] Embodiment 55. The method of any one of Embodiments 46-53, wherein the target cell is a plasma cell.

[0417] Embodiment 56. The method of any one of Embodiments 46-53, wherein the target cell is a cancer cell.

[0418] Embodiment 57. The method of any one of Embodiments 46-53, wherein the target cell is a multiple myeloma cell.

[0419] Embodiment 58. The method of any one of Embodiments 46-53, wherein the target cell is a pancreatic cell.

[0420] Embodiment 59. The method of any one of Embodiments 46-53, wherein the target cell is a pancreatic cancer cell.

[0421] Embodiment 60. The method of any one of Embodiments 46-53, wherein the target cell is a gastrointestinal cell.

[0422] Embodiment 61. The method of any one of Embodiments 46-53, wherein the target cell is a colorectal cancer cell.

[0423] Embodiment 62. A method of treating a condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition as described in any one of Embodiments 1-45.

[0424] Embodiment 63. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 10 consecutive nucleotides of SEQ ID NO: 13 or 14.

[0425] Embodiment 64. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:13.

[0426] Embodiment 65. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:13.

[0427] Embodiment 66. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:13.

[0428] Embodiment 67. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:13.

[0429] Embodiment 68. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:13.

[0430] Embodiment 69. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:13.

[0431] Embodiment 70. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:13.

[0432] Embodiment 71. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:13.

[0433] Embodiment 72. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:13.

[0434] Embodiment 73. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:13.

[0435] Embodiment 74. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:13.

[0436] Embodiment 75. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:13.

[0437] Embodiment 76. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:13.

[0438] Embodiment 77. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:14.

[0439] Embodiment 78. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:14.

[0440] Embodiment 79. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:14.

[0441] Embodiment 80. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:14.

[0442] Embodiment 81. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:14.

[0443] Embodiment 82. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:14.

[0444] Embodiment 83. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:14.

[0445] 84. A pharmaceutical composition as described in embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:14.

[0446] Embodiment 85. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:14.

[0447] Embodiment 86. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:14.

[0448] Embodiment v87. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:14.

[0449] Embodiment 88. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:14.

[0450] Embodiment 89. The pharmaceutical composition of Embodiment 63, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:14.

[0451] Embodiment 90. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises (a) a nucleotide sequence having at least 90% sequence identity to at least 60 consecutive nucleotides of SEQ ID NO: 33, or (b) a nucleotide sequence having at least 91% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO: 33.

[0452] Embodiment 91. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 60 consecutive nucleotides of SEQ ID NO:33.

[0453] Embodiment 92. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 91% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:33.

[0454] Embodiment 93. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 75 consecutive nucleotides of SEQ ID NO:33.

[0455] Embodiment 94. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:33.

[0456] Embodiment 95. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:33.

[0457] Embodiment 96. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:33.

[0458] Embodiment 97. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:33.

[0459] Embodiment 98. The pharmaceutical composition of Embodiment 90, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:33.

[0460] Embodiment 99. The pharmaceutical composition of embodiment 90, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:33.

[0461] Embodiment 100. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence comprises an AluSp, AluSx, AluSg2, ERV2 superfamily or ERV3 superfamily transposable element or a functional fragment thereof, and the transposable element or a functional fragment thereof promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0462] Embodiment 101. The pharmaceutical composition of Embodiment 100, wherein the recognition sequence comprises the AluSp transposable element or a functional fragment thereof.

[0463] Embodiment 102. The pharmaceutical composition of Embodiment 100, wherein the recognition sequence comprises the AluSx transposable element or a functional fragment thereof.

[0464] Embodiment 103. The pharmaceutical composition of Embodiment 100, wherein the recognition sequence comprises the AluSg2 transposable element or a functional fragment thereof.

[0465] Embodiment 104. The pharmaceutical composition according to Embodiment 100, wherein the recognition sequence comprises the ERV2 superfamily transposable element or a functional fragment thereof.

[0466] Embodiment 105. The pharmaceutical composition according to Embodiment 104, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises an HML8 group transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0467] Embodiment 106. The pharmaceutical composition according to embodiment 104 or 105, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises a MER family transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0468] Embodiment 107. The pharmaceutical composition of any one of Embodiments 104-106, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises a MER11C transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0469] Embodiment 108. The pharmaceutical composition according to Embodiment 100, wherein the recognition sequence comprises the ERV3 superfamily transposable element or a functional fragment thereof.

[0470] Embodiment 109. The pharmaceutical composition according to Embodiment 108, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises a MaLR group transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0471] Embodiment 110. The pharmaceutical composition according to embodiment 108 or 109, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises a THE1A transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0472] Embodiment 111. The pharmaceutical composition of embodiment 108 or 109, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises an MLT1J2 transposable element or a functional fragment thereof that facilitates the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0473] Embodiment 112. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the polynucleotide comprises a nucleotide sequence having at least 86% sequence identity to any one of SEQ ID NOs: 7, 16, 25, 29 and 31.

[0474] Embodiment 113. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:7.

[0475] Embodiment 114. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:16.

[0476] Embodiment 115. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:25.

[0477] Embodiment 116. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:29.

[0478] Embodiment 117. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:31.

[0479] Embodiment 118. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:7.

[0480] Embodiment 119. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:16.

[0481] Embodiment 120. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:25.

[0482] Embodiment 121. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:29.

[0483] Embodiment 122. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:31.

[0484] Embodiment 123. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:7.

[0485] Embodiment 124. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:16.

[0486] Embodiment 125. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:25.

[0487] Embodiment 126. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:29.

[0488] Embodiment 127. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:31.

[0489] Embodiment 128. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:7.

[0490] Embodiment 129. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:16.

[0491] Embodiment 130. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:25.

[0492] Embodiment 131. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:29.

[0493] Embodiment 132. The pharmaceutical composition of Embodiment 112, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:31.

[0494] Embodiment 133. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell.

[0495] Embodiment 134. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell by at least 50% compared to a control synthetic delivery system lacking the recognition sequence.

[0496] Embodiment 135. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell by at least 50% compared to a control cell of a different cell type.

[0497] Embodiment 136. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes uptake of the synthetic delivery system or a component thereof by the target cell.

[0498] Embodiment 137. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes at least 50% greater uptake of the synthetic delivery system by the target cells compared to a control synthetic delivery system lacking the recognition sequence.

[0499] Embodiment 138. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes at least 50% greater uptake of the synthetic delivery system by the target cells compared to a control cell of a different cell type.

[0500] Embodiment 139. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes nuclear localization of the synthetic delivery system within the target cell by at least 50% compared to a control synthetic delivery system lacking the recognition sequence.

[0501] Embodiment 140. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes nuclear localization of the synthetic delivery system in the target cell by at least 50% compared to a control cell of a different cell type.

[0502] Embodiment 141. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell and uptake of the synthetic delivery system or its components by the target cell.

[0503] Embodiment 142. The pharmaceutical composition of any of the preceding embodiments, wherein the recognition sequence comprises a nucleic acid sequence identified in circulating tumor DNA (ctDNA) from a cell type substantially similar to the target cell.

[0504] Embodiment 143. The pharmaceutical composition of any of the preceding embodiments, wherein the polynucleotide comprises double-stranded DNA.

[0505] Embodiment 144. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system further comprises a cargo.

[0506] Embodiment 145. The pharmaceutical composition of Embodiment 144, wherein the cargo comprises an anti-cancer therapeutic agent.

[0507] Embodiment 146. The pharmaceutical composition of Embodiment 144 or 145, wherein the cargo comprises a cargo nucleic acid.

[0508] Embodiment 147. The pharmaceutical composition according to Embodiment 147, wherein the cargo nucleic acid encodes a tumor suppressor protein

[0509] Embodiment 148. The pharmaceutical composition of any one of Embodiments 144-147, wherein the cargo is attached to the 3' end of the polynucleotide.

[0510] Embodiment 149. The pharmaceutical composition of any one of Embodiments 144-148, wherein the cargo is attached to the 5' end of the polynucleotide.

[0511] Embodiment 150. The pharmaceutical composition of any one of Embodiments 144-149, wherein the cargo comprises a cytotoxic cargo.

[0512] Embodiment 151. The pharmaceutical composition of any one of Embodiments 144-150, wherein the cargo comprises a therapeutic cargo.

[0513] Embodiment 152. The pharmaceutical composition of any one of Embodiments 144-151, wherein the cargo comprises a polypeptide.

[0514] Embodiment 153. The pharmaceutical composition of any one of Embodiments 144-152, wherein the cargo comprises a small molecule.

[0515] Embodiment 154. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system further comprises a promoter.

[0516] Embodiment 155. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system further comprises an integration sequence that facilitates integration of the polynucleotide, the synthetic delivery system, cargo, or components thereof into the genome of the target cell.

[0517] Embodiment 156. The pharmaceutical composition of embodiment 155, wherein the integration sequence promotes genomic integration of the synthetic delivery system, the polynucleotide, the cargo, or a component thereof in a target cell by at least 50% compared to a control synthetic delivery system lacking the integration sequence.

[0518] Embodiment 157. The pharmaceutical composition of any one of Embodiments 155-156, wherein the integration sequence promotes genomic integration of the synthetic delivery system, the polynucleotide, the cargo, or a component thereof by target cells by at least 50% compared to a control cell of a different cell type.

[0519] Embodiment 158. The pharmaceutical composition of any of the preceding embodiments, wherein the synthetic delivery system does not utilize viral vectors, nanoparticles, lipid nanoparticles, liposomes, exosomes, dendrimers, gene guns, or electroporation for delivery to the target cells.

[0520] Embodiment 159. The pharmaceutical composition of any one of Embodiments 62-158, wherein the target cell is a leukocyte.

[0521] Embodiment 160. The pharmaceutical composition of any one of Embodiments 62-159, wherein the target cell is a plasma cell.

[0522] Embodiment 161. The pharmaceutical composition of any one of Embodiments 62-160, wherein the target cell is a cancer cell.

[0523] Embodiment 162. The pharmaceutical composition of any one of Embodiments 62-161, wherein the target cell is a multiple myeloma cell.

[0524] Embodiment 163. The pharmaceutical composition of any one of Embodiments 62-158 and 161, wherein the target cell is a pancreatic cell.

[0525] Embodiment 164. The pharmaceutical composition of any one of Embodiments 62-158, wherein the target cell is a pancreatic cancer cell.

[0526] Embodiment 165. The pharmaceutical composition of any one of Embodiments 62-158, wherein the target cell is a gastrointestinal cell.

[0527] Embodiment 166. The pharmaceutical composition of any one of Embodiments 62-158, wherein the target cell is a colorectal cancer cell.

[0528] Embodiment 167. A method of delivering a cargo to a target cell, the method comprising contacting the target cell with the pharmaceutical composition or synthetic delivery system of any one of the preceding embodiments.

[0529] Embodiment 168. The method of Embodiment 167, wherein the cargo is delivered to an intracellular compartment of the target cell.

[0530] Embodiment 169. The method of Embodiment 167 or 168, wherein the cargo is delivered to the nucleus of the target cell.

[0531] Embodiment 170. The method of any one of Embodiments 167-169, wherein the cargo comprises a cargo nucleic acid, wherein the cargo nucleic acid is integrated into the genome of the target cell.

[0532] Embodiment 171. The method of Embodiment 170, wherein the cargo nucleic acid is integrated into the genome of the target cell at the position identified in Table 2, Table 4, Table 7, or Table 8.

[0533] Embodiment 172. The method of embodiment 170, wherein the nucleic acid cargo is integrated into the genome of the target cell at Chr2:32916224-32916626.

[0534] Embodiment 173. The method of embodiment 170, wherein the nucleic acid cargo is integrated into the genome of the target cell at Ch16:32628381-32629000.

[0535] Embodiment 174. A method of treating a disorder in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition as described in any of the preceding embodiments.

[0536] Embodiment 175. The method of embodiment 174, wherein the subject is a mammal.

[0537] Embodiment 176. The method of any one of Embodiments 174, wherein the subject is a human.

[0538] Embodiment 177. The method of any one of Embodiments 174-176, wherein the disorder is cancer.

[0539] Embodiment 178. The method of embodiment 177, wherein the cancer is a blood cancer.

[0540] Embodiment 179. The method of Embodiment 177, wherein the cancer is multiple myeloma.

[0541] Embodiment 180. The method of Embodiment 177, wherein the cancer is a solid tumor.

[0542] Embodiment 181. The method of Embodiment 177 or 180, wherein the cancer is pancreatic cancer.

[0543] Embodiment 182. The method of Embodiment 177 or 180, wherein the cancer is colorectal cancer.

[0544] Embodiment 183. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 73-75.

[0545] Embodiment 184. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:73.

[0546] Embodiment 185. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:73.

[0547] Embodiment 186. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:73.

[0548] Embodiment 187. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of SEQ ID NO:73.

[0549] Embodiment 188. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:74.

[0550] Embodiment 189. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:74.

[0551] Embodiment 190. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:74.

[0552] Embodiment 191. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of SEQ ID NO:74.

[0553] Embodiment 192. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:75.

[0554] Embodiment 193. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:75.

[0555] Embodiment 194. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:75.

[0556] Embodiment 195. The pharmaceutical composition of Embodiment 183, wherein the recognition sequence consists essentially of the nucleotide sequence of SEQ ID NO:75.

[0557] Embodiment 196. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with SEQ ID NO:71.

[0558] Embodiment 197. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:71.

[0559] Embodiment 198. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:71.

[0560] Embodiment 199. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain the nucleotide sequence of SEQ ID NO:71.

[0561] Embodiment 200. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with nucleotides 1-87 of SEQ ID NO:68.

[0562] Embodiment 201. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with nucleotides 1-87 of SEQ ID NO:68.

[0563] Embodiment 202. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with nucleotides 1-87 of SEQ ID NO:68.

[0564] Embodiment 203. The pharmaceutical composition of any one of Embodiments 183-195, wherein the recognition sequence does not contain the nucleotide sequence of nucleotides 1-87 of SEQ ID NO:68.

[0565] Embodiment 204. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:73.

[0566] Embodiment 205. The pharmaceutical composition of Embodiment 204, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:74.

[0567] Embodiment 206. The pharmaceutical composition of Embodiment 204, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:74.

[0568] Embodiment 207. The pharmaceutical composition of embodiment 204, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:74.

[0569] Embodiment 208. The pharmaceutical composition of Embodiment 204, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:75.

[0570] Embodiment 209. The pharmaceutical composition of Embodiment 204, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:75.

[0571] Embodiment 210. The pharmaceutical composition of Embodiment 204, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:75.

[0572] Embodiment 211. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with SEQ ID NO:71.

[0573] Embodiment 212. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:71.

[0574] Embodiment 213. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:71.

[0575] Embodiment 214. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain the nucleotide sequence of SEQ ID NO:71.

[0576] Embodiment 215. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with nucleotides 1-87 of SEQ ID NO:68.

[0577] Embodiment 216. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with nucleotides 1-87 of SEQ ID NO:68.

[0578] Embodiment 217. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with nucleotides 1-87 of SEQ ID NO:68.

[0579] Embodiment 218. The pharmaceutical composition of any one of Embodiments 204-210, wherein the recognition sequence does not contain the nucleotide sequence of nucleotides 1-87 of SEQ ID NO:68.

[0580] Embodiment 219. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 10 consecutive nucleotides of SEQ ID NO: 13 or 14.

[0581] Embodiment 220. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:13.

[0582] Embodiment 221. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:13.

[0583] Embodiment 222. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:13.

[0584] Embodiment 223. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:13.

[0585] Embodiment 224. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:13.

[0586] Embodiment 225. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:13.

[0587] Embodiment 226. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:13.

[0588] Embodiment 227. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:13.

[0589] Embodiment 228. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:13.

[0590] Embodiment 229. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:13.

[0591] Embodiment 230. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:13.

[0592] Embodiment 231. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:13.

[0593] Embodiment 232. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:13.

[0594] Embodiment 233. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:14.

[0595] Embodiment 234. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:14.

[0596] Embodiment 235. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:14.

[0597] Embodiment 236. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:14.

[0598] Embodiment 237. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:14.

[0599] Embodiment 238. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:14.

[0600] Embodiment 239. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:14.

[0601] Embodiment 240. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:14.

[0602] Embodiment 241. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:14.

[0603] Embodiment 242. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 200 consecutive nucleotides of SEQ ID NO:14.

[0604] Embodiment 243. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:14.

[0605] Embodiment 244. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:14.

[0606] Embodiment 245. The pharmaceutical composition of Embodiment 219, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:14.

[0607] Embodiment 246. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the recognition sequence comprises (a) a nucleotide sequence having at least 90% sequence identity to at least 60 consecutive nucleotides of SEQ ID NO:33, or (b) a nucleotide sequence having at least 91% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO:33.

[0608] Embodiment 247. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 60 consecutive nucleotides of SEQ ID NO:33.

[0609] Embodiment 248. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 91% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:33.

[0610] Embodiment 249. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 75 consecutive nucleotides of SEQ ID NO:33.

[0611] Embodiment 250. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 100 consecutive nucleotides of SEQ ID NO:33.

[0612] Embodiment 251. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 200 consecutive nucleotides of SEQ ID NO:33.

[0613] Embodiment 252. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:33.

[0614] Embodiment 253. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:33.

[0615] Embodiment 254. The pharmaceutical composition of Embodiment 246, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:33.

[0616] Embodiment 255. The pharmaceutical composition of embodiment 246, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:33.

[0617] Embodiment 256. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence comprises an AluSp, AluSx, AluSg2, ERV2 superfamily or ERV3 superfamily transposable element or a functional fragment thereof, and the transposable element or a functional fragment thereof promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0618] Embodiment 257. The pharmaceutical composition of Embodiment 256, wherein the recognition sequence comprises the AluSp transposable element or a functional fragment thereof.

[0619] Embodiment 258. The pharmaceutical composition of Embodiment 256, wherein the recognition sequence comprises the AluSx transposable element or a functional fragment thereof.

[0620] Embodiment 259. The pharmaceutical composition of Embodiment 256, wherein the recognition sequence comprises the AluSg2 transposable element or a functional fragment thereof.

[0621] Embodiment 260. The pharmaceutical composition of Embodiment 256, wherein the recognition sequence comprises the ERV2 superfamily transposable element or a functional fragment thereof.

[0622] Embodiment 261. The pharmaceutical composition of Embodiment 260, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises an HML8 group transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

[0623] Embodiment 262. The pharmaceutical composition of Embodiment 260, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises a MER family transposable element or a functional fragment thereof that facilitates the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0624] Embodiment 263. The pharmaceutical composition according to Embodiment 260, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises a MER11C transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0625] Embodiment 264. The pharmaceutical composition of Embodiment 256, wherein the recognition sequence comprises the ERV3 superfamily transposable element or a functional fragment thereof.

[0626] Embodiment 265. The pharmaceutical composition of Embodiment 264, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises a MaLR group transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0627] Embodiment 266. The pharmaceutical composition of Embodiment 264, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises a THE1A transposable element or a functional fragment thereof that facilitates the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0628] Embodiment 267. The pharmaceutical composition of Embodiment 264, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises an MLT1J2 transposable element or a functional fragment thereof that facilitates the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or a component thereof by the target cell.

[0629] Embodiment 268. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes binding of the synthetic delivery system to a target cell or uptake of the synthetic delivery system or a component thereof by the target cell, wherein the polynucleotide comprises a nucleotide sequence having at least 86% sequence identity to any one of SEQ ID NOs: 7, 16, 25, 29, and 31.

[0630] Embodiment 269. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:7.

[0631] Embodiment 270. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:16.

[0632] Embodiment 271. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:25.

[0633] Embodiment 272. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:29.

[0634] Embodiment 273. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:31.

[0635] Embodiment 274. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:7.

[0636] Embodiment 275. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:16.

[0637] Embodiment 276. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:25.

[0638] Embodiment 277. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:29.

[0639] Embodiment 278. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:31.

[0640] Embodiment 279. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:7.

[0641] Embodiment 280. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:16.

[0642] Embodiment 281. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:25.

[0643] Embodiment 282. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:29.

[0644] Embodiment 283. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:31.

[0645] Embodiment 284. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:7.

[0646] Embodiment 285. The pharmaceutical composition of Embodiment 268, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:16.

[0647] Embodiment 286. The pharmaceutical composition of embodiment 268, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:25.

[0648] Embodiment 287. The pharmaceutical composition of embodiment 268, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:29.

[0649] Embodiment 288. The pharmaceutical composition of embodiment 268, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:31.

[0650] Embodiment 289. The pharmaceutical composition of any one of Embodiments 183-288, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell.

[0651] Embodiment 290. The pharmaceutical composition of any one of embodiments 183-289, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell by at least 50% compared to a control synthetic delivery system lacking the recognition sequence.

[0652] Embodiment 291. The pharmaceutical composition of any one of Embodiments 183-290, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell by at least 50% compared to a control cell of a different cell type.

[0653] Embodiment 292. The pharmaceutical composition of any one of Embodiments 183-291, wherein the recognition sequence promotes uptake of the synthetic delivery system or a component thereof by the target cell.

[0654] Embodiment 293. The pharmaceutical composition of any one of Embodiments 183-292, wherein the recognition sequence promotes at least 50% greater uptake of the synthetic delivery system by the target cell compared to a control synthetic delivery system lacking the recognition sequence.

[0655] Embodiment 294. The pharmaceutical composition of any one of Embodiments 183-293, wherein the recognition sequence promotes at least 50% greater uptake of the synthetic delivery system by the target cell compared to a control cell of a different cell type.

[0656] Embodiment 295. The pharmaceutical composition of any one of embodiments 183-294, wherein the recognition sequence promotes nuclear localization of the synthetic delivery system within the target cell by at least 50% compared to a control synthetic delivery system lacking the recognition sequence.

[0657] Embodiment 296. The pharmaceutical composition of any one of Embodiments 183-295, wherein the recognition sequence promotes nuclear localization of the synthetic delivery system in the target cell by at least 50% compared to a control cell of a different cell type.

[0658] Embodiment 297. The pharmaceutical composition of any one of Embodiments 183-296, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell and uptake of the synthetic delivery system or a component thereof by the target cell.

[0659] Embodiment 298. The pharmaceutical composition of any one of Embodiments 183-297, wherein the recognition sequence comprises a nucleic acid sequence identified in circulating tumor DNA (ctDNA) from a cell type substantially similar to the target cell.

[0660] Embodiment 299. The pharmaceutical composition of any one of Embodiments 183-298, wherein the polynucleotide comprises double-stranded DNA.

[0661] Embodiment 300. The pharmaceutical composition of any one of Embodiments 183-299, wherein the synthetic delivery system further comprises a cargo.

[0662] Embodiment 301. The pharmaceutical composition of Embodiment 300, wherein the cargo comprises an anti-cancer therapeutic agent.

[0663] Embodiment 302. The pharmaceutical composition of embodiment 300 or 301, wherein the cargo comprises a nucleic acid cargo.

[0664] Embodiment 303. The pharmaceutical composition according to Embodiment 302, wherein the nucleic acid cargo encodes a tumor suppressor protein

[0665] Embodiment 304. The pharmaceutical composition of any one of Embodiments 300-303, wherein the cargo is attached to the 3' end of the polynucleotide.

[0666] Embodiment 305. The pharmaceutical composition of any one of Embodiments 300-304, wherein the cargo is attached to the 5' end of the polynucleotide.

[0667] Embodiment 306. The pharmaceutical composition of any one of Embodiments 300-305, wherein the cargo comprises a cytotoxic cargo.

[0668] Embodiment 307. The pharmaceutical composition of any one of Embodiments 300-306, wherein the cargo comprises a therapeutic cargo.

[0669] Embodiment 308. The pharmaceutical composition of any one of Embodiments 300-307, wherein the cargo comprises a polypeptide.

[0670] Embodiment 309. The pharmaceutical composition of any one of Embodiments 300-308, wherein the cargo comprises a small molecule.

[0671] Embodiment 310. The pharmaceutical composition of any one of Embodiments 183-309, wherein the synthetic delivery system further comprises a promoter.

[0672] Embodiment 311. The pharmaceutical composition of any one of Embodiments 183-310, wherein the synthetic delivery system further comprises an integration sequence that facilitates integration of the polynucleotide, the synthetic delivery system, the cargo, or a component thereof, into the genome of the target cell.

[0673] Embodiment 312. The pharmaceutical composition of embodiment 311, wherein the integration sequence promotes genomic integration of the synthetic delivery system, the polynucleotide, the cargo, or a component thereof in a target cell by at least 50% compared to a control synthetic delivery system lacking the integration sequence.

[0674] Embodiment 313. The pharmaceutical composition of any one of Embodiments 311-312, wherein the integration sequence promotes genomic integration of the synthetic delivery system, the polynucleotide, the cargo, or a component thereof by target cells by at least 50% compared to a control cell of a different cell type.

[0675] Embodiment 314. The pharmaceutical composition of any one of Embodiments 183-313, wherein the synthetic delivery system does not utilize viral vectors, nanoparticles, lipid nanoparticles, liposomes, exosomes, dendrimers, gene guns, or electroporation for delivery to the target cells.

[0676] Embodiment 315. The pharmaceutical composition of any one of Embodiments 183-314, wherein the target cell is a leukocyte.

[0677] Embodiment 316. The pharmaceutical composition of any one of Embodiments 183-315, wherein the target cell is a plasma cell.

[0678] Embodiment 317. The pharmaceutical composition of any one of Embodiments 183-316, wherein the target cell is a cancer cell.

[0679] Embodiment 318. The pharmaceutical composition of any one of Embodiments 183-317, wherein the target cell is a multiple myeloma cell.

[0680] Embodiment 319. The pharmaceutical composition of any one of Embodiments 183-314, wherein the target cell is a pancreatic cell.

[0681] Embodiment 320. The pharmaceutical composition of any one of Embodiments 183-314, wherein the target cell is a pancreatic cancer cell.

[0682] Embodiment 321. The pharmaceutical composition of any one of Embodiments 183-314, wherein the target cell is a gastrointestinal cell.

[0683] Embodiment 322. The pharmaceutical composition of any one of Embodiments 183-314, wherein the target cell is a colorectal cancer cell.

[0684] Embodiment 323. A method of delivering a cargo to a target cell, the method comprising contacting the target cell with the pharmaceutical composition or synthetic delivery system of any one of the preceding embodiments.

[0685] Embodiment 324. The method of Embodiment 323, wherein the cargo is delivered to an intracellular compartment of the target cell.

[0686] Embodiment 325. The method of any one of Embodiments 323-324, wherein the cargo is delivered to the nucleus of the target cell.

[0687] Embodiment 326. The method of any one of Embodiments 323-325, wherein the cargo comprises a cargo nucleic acid, wherein the cargo nucleic acid is integrated into the genome of the target cell.

[0688] Embodiment 327. The method of any one of Embodiments 323-326, wherein the cargo nucleic acid is integrated into the genome of the target cell at the position identified in Table 2, Table 4, Table 7, or Table 8.

[0689] Embodiment 328. The method of any one of Embodiments 323-327, wherein the nucleic acid cargo is integrated into the genome of the target cell at Chr2:32916224-32916626.

[0690] Embodiment 329. The method of any one of Embodiments 323-327, wherein the cargo nucleic acid is integrated into the genome of the target cell at Ch16:32628381-32629000.

[0691] Embodiment 330. A method of treating a disorder in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition as described in any of the preceding embodiments.

[0692] Embodiment 331. The method of embodiment 330, wherein the subject is a mammal.

[0693] Embodiment 332. The method of any one of Embodiments 330-331, wherein the subject is a human.

[0694] Embodiment 333. The method of any one of Embodiments 330-332, wherein the disorder is cancer.

[0695] Embodiment 334. The method of embodiment 333, wherein the cancer is a blood cancer.

[0696] Embodiment 335. The method of any one of Embodiments 333-334, wherein the cancer is multiple myeloma.

[0697] Embodiment 336. The method of embodiment 333, wherein the cancer is a solid tumor.

[0698] Embodiment 337. The method of embodiment 333, wherein the cancer is pancreatic cancer.

[0699] Embodiment 338. The method of any one of Embodiments 333, wherein the cancer is colorectal cancer.

[0700] VII. Examples

[0701] Example 1: Identification of genomic integration sites of ctDNA

[0702] Integration of ctDNA into the host cell genome was evaluated. ctDNA was extracted from patient plasma, cultured with cells of matched or mismatched cancer cell types for 24 hours, and whole genome sequencing was performed. The cell lines used were MM1s (multiple myeloma, MM) and MIA (pancreatic cancer, PC).

[0703] Identify single nucleotide variants (SNVs) unique to ctDNA found in the host cell genome under matched co-culture conditions. Comparison of sequences from each experimental condition after alignment with the reference human genome (Hg38) identified multiple SNVs shared between the co-culture conditions and ctDNA that were absent in the genome of untreated control cells (referred to herein as "target SNVs"). Figure 1A Additional detail on these target SNVs showed that cells co-cultured with ctDNA showed a skew in variant allele frequency toward the frequency of the variant ctDNA allele compared to cells alone ( Figure 1B ). Examples of SNVs that exhibit ctDNA ‘skew’ in variant allele frequency (VAF) after co-incubation with ctDNA are Figure 2A-2D Shown in.

[0704] Sequence data were used to reconstruct genomic contigs for each experimental condition by de novo assembly. Comparative analysis of contig sequences between the cell lines, ctDNA, and co-culture conditions described above detected ctDNA fragments that integrated into the cell genome under co-culture conditions. NucDiff analysis was used to identify co-culture contigs carrying ctDNA insertions. BLAST alignment analysis further validated the acquisition of ctDNA fragments under co-culture conditions and identified ctDNA insertion transition points ( Figure 3A-3C ). Analysis of the incorporated ctDNA fragments and genomic insertion sites identified from both tumor models indicated that the majority (about 67%) of the inserted ctDNA fragments originated from chromosomes 3 and 7. In addition, about 80% of the ctDNA fragments targeted cellular chromosome regions near the genomic location from which the ctDNA originated, indicating a high probability that the ctDNA was inserted into the homologous target region. The remaining 20% ​​were inserted into chromosomal locations different from their source sites.

[0705] Example 2: Identification of transposable elements in ctDNA

[0706] Experiments were designed to identify the presence of transposons in ctDNA fragments. To more accurately map ctDNA genomic junctions, PACBIO probes were ligated to multiple myeloma and pancreatic cancer ctDNA samples to mark their 5' and 3' ends. Whole-genome sequencing of DNA from cells with ctDNA genomic integration was performed using the Illumina platform. The sequencing output was assembled de novo. ctDNA contigs containing PACBIO adapters were then matched to those contigs containing inserted ctDNA sequences identified in co-culture experiments. RepeatMaster was used to detect and classify transposable elements on ctDNA sequences at the insertion point (<100 nucleotides from the transition point between cells and ctDNA). This analysis showed that ctDNA fragments integrated into the cellular genome contained more transposable elements ( Figure 4 ). These findings suggest that retrotransposons mediate horizontal gene transfer in cancer cells.

[0707] Search for transposons that preferentially target cells of matching tumor types. Compare the list of transposons identified at ctDNA insertion sites under matched and mismatched co-culture conditions (e.g., MM ctDNA with MM cells or PC cells). Select transposons that are uniquely or preferentially inserted under matching conditions.

[0708] Class I transposons ERV-L, LTR, SINE, and LINE constitute the majority of transposable elements at switch points in pancreatic cancer or multiple myeloma.

[0709] Within the matched PC ctDNA, AluSx, MIRc, and MTL1J were the most common retrotransposon subfamilies located at the insertion site ( Figure 5A and Table 8).

[0710] In multiple myeloma, retrotransposon subfamilies such as AluSp, MER11, MER11C, AluJb, and L2a have been identified at the MM ctDNA insertion sites ( Figure 5B and Table 7).

[0711] Activation of short interspersed nuclear elements (SINEs) and long interspersed nuclear elements (LINEs) has been observed in cancer, leaving open the possibility of retrotransposition. The expression of transposable elements was evaluated in RNA sequencing data from 60 MM and 23 PC patient samples. Batch-normalized raw data were used to measure expression variability. The analysis confirmed that several tissue-specific retrotransposons were highly expressed in pancreatic cancer or multiple myeloma. These findings showed that in these cancer types, the retrotransposons identified at the insertion site were transcriptionally active ( Fig. 6A and Figure 6B ).

[0712] To functionally evaluate the role of retrotransposons in horizontal gene transfer of ctDNA, experiments were performed to test the effect of inhibiting reverse transcriptase or integrase on ctDNA integration. Multiple myeloma (MM1s), pancreatic cancer (MIA), and colon cancer (HCT116) cell lines were treated with the reverse transcriptase inhibitors zidovudine or didanosine and the integrase inhibitor raltegravir, and then ctDNA was added to the culture medium. Treatment with reverse transcriptase inhibitors or integrase inhibitors significantly reduced ctDNA chromatid integration compared to untreated controls ( Figure 7 ), which provides evidence that retrotransposons play an important role in ctDNA horizontal gene transfer.

[0713] Example 3: Evaluation of synthetic transposable elements and cargo delivery

[0714] Several MM retrotransposons containing point mutations specific to tumor types were synthesized and tested for integration ability. Retrotransposons that can be synthesized via the gBlock gene fragment method were selected (including AluSp, AluSg2, MER11C, THE1A, and AluSx). For controls, a PC retrotransposon (AluSx1) and a synthetic sequence of similar length and GC content without retrotransposon sequences were included.

[0715] The ability of the retrotransposon to resist degradation induced by DNases contained in complete culture medium was evaluated. Agarose gel electrophoresis showed that all fragments remained intact under culture conditions ( Figure 8 ).

[0716] The retrotransposon was labeled with CY5 to determine uptake by MM cell lines using a flow cytometric approach. The kinetics of retrotransposon capture was monitored by flow cytometry. The results showed that cell capture of CY5-AluSp increased more efficiently over time than the control sequence ( Fig.9A ).

[0717] Dose titration experiments were performed to evaluate cell capture and internalization. DNA was considered internalized if it was not removed from the cells by trypsin treatment. This experiment depicted more efficient dose-dependent CY5-AluSp cell capture and internalization ( Fig. 9B ).

[0718] The variability of cell capture of several transposons was tested in two MM cell lines after 4 hours of culture. These experiments identified that CY5-AluSp and CY5-MER11C had higher cell capture than other transposons, control sequences, and PC transposons ( Fig. 9C and Fig.9D ).

[0719] Cell targeting of AluSp and MER11C sequences was tested in bone marrow samples from patients with and without multiple myeloma. After 14 hours of cell culture, CY5-positive plasma cells ( Fig.10 The samples cultured with the control sequence or PC-specific sequence ( Fig.10 Interestingly, plasma cells derived from MM patients had higher levels of plasma cell targeting than those from non-MM patients. This result suggests that malignant plasma cells are better suited to capture these retrotransposons ( Fig.11 AluSp and MER11C showed higher signal levels in plasma cells of MM patients than in non-MM CD138(-) cell compartments, thus validating their tissue-specific cell targeting capabilities ( Fig.10 Bottom right and Fig.11 ).

[0720] To test whether the retrotransposon sequence contains a cell recognition signal, several deletion mutants of the AluSp sequence were generated and the effect of the deletion on cell capture was evaluated. The results showed that lack of the 3' end of the AluSp sequence reduced MM cell capture, indicating that the last approximately 230 base pairs contain the MM cell recognition sequence ( Fig. 12A and Fig. 12BMultiple sequence alignment of AluSp and all MM-specific transposons revealed several conserved nucleotides and two GC- and AT-rich regions toward the 3' end ( Fig. 12C ).

[0721] Experiments were designed to test the ability of the AluSp sequence to transfer genetic material between cells. Delivery of the mCherry reporter cassette to MM cell lines via the AluSp sequence was tested. To do this, AluSp was ligated to both ends of the linearized CMV promoter-mCherry cassette. This AluSp-CMV-mCherry ligation product was then added to the culture medium of MM1s cells for 24 hours, and mCherry expression was evaluated. Microscopy experiments showed that the number of cells expressing mCherry in cells treated with AluSp-CMV-mCherry was greater than that in cells treated with the linearized vector after transfection with the circularized CMV-mCherry vector alone ( Fig.13 ). The expression of mCherry in MM1s cells cultured with AluSp-CMV-mCherry was also detected by flow cytometry.

[0722] To evaluate genomic integration of the AluSp-CMV-mCherry cassette, whole-genome single-cell sequencing was performed on MM1s cells expressing different levels of mCherry. mCherry insertions were identified by identifying sequences where one read aligned to the cell genome and the mate aligned to either the CMV or mCherry sequence. This analysis detected different levels of mCherry insertion in cells with medium or high expression levels, whereas no insertions were identified in cells that did not express mCherry ( Fig.14A In contrast, when cells were cultured with the control-mCherry sequence, only a few cells were found to have high levels of mCherry insertion and expression. mCherry integration was confirmed by mCherry PCR in cells cultured with the AluSp-mCherry vector, but not in control-mCherry treated cells ( Fig. 14B The AluSp-CMV-mCherry vector was integrated with high confidence into two specific regions in the genome (Chr2:32916224-32916626 and Ch16:32628381-32629000), which are rich in simple repeats and AluSp ( Fig. 14C ).

[0723] The tissue-specific cell targeting ability and ability to deliver payloads of AluSp were evaluated by linking the herpes simplex virus tyrosine kinase (HSV-Tk) cytotoxic gene (AluSp-HSV-Tk-GFP) between the AluSp sequences and testing the effects of the construct on the viability of MM, PC, and CC cell lines. Cells were cultured with AluSp-HSV-Tk-GFP for 24 hours and then treated with ganciclovir (GCV) for 96 hours, which is converted into a toxic product by HSV-Tk. When treated with MM-AluSp-HSV-Tk, GCV specifically reduced the cell viability of MM cells ( Fig.15 ). In contrast, AluSp-HSV-Tk / GCV treatment produced no or virtually no changes in the viability of PC or CC cell lines.

[0724] These results show that synthetic AluSp can transfer and integrate genetic cargo into specific cells and can be combined with cytotoxic cargo to target cancer cells for killing.

[0725] Example 4: ctDNA changes the drug response phenotype of MM or PC cell lines

[0726] The effect of ctDNA horizontal gene transfer on cellular drug sensitivity was evaluated.

[0727] Gemcitabine (GEM)-sensitive pancreatic cancer cell lines (MIA Paca-2 [MIA] and PANC1) were cultured for 24 h with DNase-treated or untreated plasma from (GEM)-resistant (GR) patients or control plasma. Both cell lines acquired resistance to GEM when cultured with GR plasma without DNase treatment compared with control serum. Exposure to GR plasma treated with DNase restored the cells' inherent sensitivity to the treatment ( Fig.16 ). In contrast, treatment of control serum with DNase resulted in increased resistance of PC cells to gemcitabine.

[0728] To further validate the contribution of ctDNA to drug response delivery, cell-free ctDNA was extracted from bortezomib-resistant (BR) or sensitive (BS) patients and added to culture media containing plasma from cancer-free or bortezomib-resistant patients. The results showed that the addition of ctDNA from BR patients to non-cancer patient plasma reduced the sensitivity of MM1s and OPM1 to bortezomib ( Fig.17). In addition, when ctDNA from BR patients was added to plasma from BR patients, resistance to bortezomib increased further. In contrast, adding ctDNA from BS patients to RPMI cells cultured with control plasma from non-cancer patients led to increased sensitivity to bortezomib. These findings suggest that ctDNA can transmit genetic material that confers drug sensitivity or resistance from one cell to another.

[0729] Example 5: Additional Materials and Methods

[0730] Clinical samples and sample preparation: Retrospective plasma samples of 10 patients with multiple myeloma (MM), 10 pancreatic cancer (PC), 3 colon cancer (CC) and 2 lung cancer (LC) were obtained from samples stored in tissues and collections. 10 patients newly diagnosed with MM were treated with a regimen containing bortezomib (5 of which were responders and 5 were non-responders). Among the 10 PC patients, 7 advanced cancer patients were treated with gemcitabine (2 patients had partial remission and 5 patients had disease progression when plasma samples were obtained), and 3 early patients underwent surgical resection. The remission of MM was determined using the International Uniform Response Criteria for Multiple Myeloma, and PC patients were evaluated using the solid tumor response evaluation criteria (RECIST). Blood samples were centrifuged at 1500rpm for 10 minutes before plasma separation. Plasma supernatant was collected for storage. Plasma from non-cancer patients was purchased from commercial suppliers.

[0731] Cell lines and reagents: The following cell lines were grown in Roswell Park Memorial Institute (RPMI)-1640 medium: four multiple myeloma (OPM1, RPMI, JK6L, and MM1S); one PC (ASPC-1); and one LC (A549). Colon cancer cell lines (HCT-116 and HT-29) were cultured in McCoy medium. Pancreatic cancer cell lines (PANC1 and MIA Paca-2 [MIA]) were cultured in DMEM medium, and CC cell line RKO was cultured in EMEM. All media were supplemented with 10% fetal bovine plasma, 1% L-glutamine, 1 mM sodium pyruvate, and 50 μg / ml penicillin-streptomycin. In MIA cells, 2.5% horse serum was also added to the culture medium.

[0732] Cell viability: Cell viability assays were performed in 96-well black transparent bottom microplates. For MM cell line studies, 3x10^4 cells were cultured with medium containing 10% human plasma from bortezomib-resistant or sensitive patients or control non-cancer patients for 24 hours. The cells were then cultured with titrated concentrations of bortezomib (dose: 0, 5, 10, 15, 50nM; Sigma) for 24 hours. For PC cell line viability studies, 1x10^4 cells were incubated with medium containing plasma from gemcitabine-resistant patients or non-cancer patients for 24 hours. Subsequently, titrated concentrations of gemcitabine (dose: 0, 10, 25, 50, 100, 200 μM; Sigma-Aldrich, MO) were added to the culture medium, and the cells were then incubated for 96 hours. Cell viability was evaluated using the CellTiter-Blue cell viability assay according to the manufacturer's instructions (Promega). Cell viability was measured by a fluorescence protocol in a microplate reader. Experiments for 3 independent studies were performed in triplicate.

[0733] ctDNA extraction and immunofluorescence labeling: ctDNA was isolated following the QIAamp MinElute ccfDNA kit protocol (Qiagen, Cambridge, MA). The ctDNA was fluorescently labeled with Cx-rhodamine or CY5 using a nucleic acid labeling kit (Mirus Bio LLC, WI).

[0734] Image acquisition: 1x 10 cells cultured in 1 ml of culture medium 6 The cells were incubated with rhodamine or CY5 labeled DNA at different time points.Before treatment, adherent cells (2.5x 10^5 cells) were grown on coverslips.After cells were attached to slides, slides were washed twice with PBS, and then cells were counterstained with 4,6-diamidino-2-phenylindole (DAPI) to perform nuclear detection (ThermoFisher MA).For live cell imaging, cellLight PlasmaMembrane-green fluorescent protein (GFP) Bacman 2.0 scheme (ThermoFisher MA) was followed to mark plasma membrane.The images presented are from three experiments.Images were collected using Leica SP8 LIGHTING confocal microscope.

[0735] Xenograft experiments: Pilot and validation xenograft studies were conducted to evaluate the accumulation of ctDNA in mouse tumors. For the pilot time course study, three mice bearing pancreatic cancer MIA cell xenografts were generated by injecting 1x10^6 cells in the back of J:NU (007850) distant nude mice. After the tumor volume reached 0.5 cm, the mice were assigned to specific experimental groups: some mice underwent tail vein injection of rhodamine-labeled ctDNA or synthetic delivery system, and other mice received tail vein injection of PBS as a control. Tumors of tail vein ctDNA-injected mice were harvested 24 hours and 48 hours after injection. For mice in the control group, tumors were harvested 48 hours after injection. Based on the results of these experiments, the harvest time point was selected, such as 48 hours after injection. For validation studies, human-derived PC (MIA), MM (MM1s) and CC (HCT-116) cell lines were used to develop xenograft models. Following the pilot study protocol, 3 mice / tumor xenografts were administered to evaluate the tumor localization of labeled ctDNA. At harvest, tumors and selected organs (liver, lung, large intestine, pancreas, and spleen) were dissected for cryosectioning.Each slide was fixed with 4% paraformaldehyde and stained with DAPI before mounting coverslips.

[0736] Whole-genome sequencing and whole-exome sequencing: ctDNA was extracted from 10 MM and 10 PC patients. DNA from CD138(+) cells and cell lines used in in vitro experiments (MM1s and MIA) was extracted using the Blood and Cell Culture DNA Mini Kit (Quiagen, MD). DNA was obtained from fresh-frozen paraffin-embedded pancreatic tumors using the QIAamp DNA FFPE Tissue Print Kit (Qiagen, MD).

[0737] After extraction, ctDNA was ligated to PACBIO adapters (GCGCTCTGTGTGCT) using the ABM DNA library preparation kit for Illumina sequencing (Applied Biological Materials, Canada). Standard methods for library preparation and sequencing were used for PACBio-labeled ctDNA and conventional ctDNA using Illumina and Agilent protocols, respectively. Applied Biological Materials prepared the libraries and performed whole exon and genome sequencing. The average target coverage was 50X.

[0738] Nucleotide variant concordance between tumor and ctDNA: Quality control checks were performed on raw sequence data using FastQC (https: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ). Samples that failed the QC check were trimmed using BBDuk (https: / / jgi.doe.gov / data-and-tools / bbtools / bb-tools-user-guide / bbduk-guide / ) in the adapter trimming mode for paired reads. Sequence reads were then aligned to the human genome GRCh38 assembly (https: / / www.ncbi.nlm.nih.gov / assembly / GCF_000001405.39) using the Falcon Accelerated Genomics Pipeline (https: / / github.com / falconcomputing / falcon-genome). This program is an accelerated version of the GATK Best Practices Pipeline. Starting with paired-end FASTQ sequence files, the first step maps the sequences to a reference. The resulting mapped BAM files were sorted and ...

Claims

1. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 73-75.

2. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

73.

3. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

73.

4. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 95% sequence identity with SEQ ID NO:

73.

5. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of SEQ ID NO:

73.

6. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

74.

7. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

74.

8. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 95% sequence identity with SEQ ID NO:

74.

9. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of SEQ ID NO:

74.

10. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

75.

11. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

75.

12. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

75.

13. The pharmaceutical composition of claim 1, wherein the recognition sequence consists essentially of the nucleotide sequence of SEQ ID NO:

75.

14. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with SEQ ID NO:

71.

15. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

71.

16. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

71.

17. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain the nucleotide sequence of SEQ ID NO:

71.

18. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with nucleotides 1-87 of SEQ ID NO:

68.

19. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with nucleotides 1-87 of SEQ ID NO:

68.

20. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with nucleotides 1-87 of SEQ ID NO:

68.

21. The pharmaceutical composition of claim 1, wherein the recognition sequence does not contain the nucleotide sequence of nucleotides 1-87 of SEQ ID NO:

68.

22. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:

73.

23. The pharmaceutical composition of claim 22, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

74.

24. The pharmaceutical composition of claim 22, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

74.

25. The pharmaceutical composition of claim 22, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:

74.

26. The pharmaceutical composition of claim 22, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:

75.

27. The pharmaceutical composition of claim 22, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

75.

28. The pharmaceutical composition of claim 22, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:

75.

29. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with SEQ ID NO:

71.

30. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

71.

31. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

71.

32. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain the nucleotide sequence of SEQ ID NO:

71.

33. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain a nucleotide sequence having at least 50% sequence identity with nucleotides 1-87 of SEQ ID NO:

68.

34. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain a nucleotide sequence having at least 80% sequence identity with nucleotides 1-87 of SEQ ID NO:

68.

35. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain a nucleotide sequence having at least 90% sequence identity with nucleotides 1-87 of SEQ ID NO:

68.

36. The pharmaceutical composition of claim 22, wherein the recognition sequence does not contain the nucleotide sequence of nucleotides 1-87 of SEQ ID NO:

68.

37. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO: 13 or 14.

38. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:

13.

39. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:

13.

40. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:

13.

41. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 100 consecutive nucleotides of SEQ ID NO:

13.

42. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 200 consecutive nucleotides of SEQ ID NO:

13.

43. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:

13.

44. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:

13.

45. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:

13.

46. ​​The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 100 consecutive nucleotides of SEQ ID NO:

13.

47. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 200 consecutive nucleotides of SEQ ID NO:

13.

48. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

13.

49. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

13.

50. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:

13.

51. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:

14.

52. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:

14.

53. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:

14.

54. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 100 consecutive nucleotides of SEQ ID NO:

14.

55. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 80% sequence identity to at least 200 consecutive nucleotides of SEQ ID NO:

14.

56. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 10 consecutive nucleotides of SEQ ID NO:

14.

57. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 25 consecutive nucleotides of SEQ ID NO:

14.

58. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:

14.

59. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 100 consecutive nucleotides of SEQ ID NO:

14.

60. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 200 consecutive nucleotides of SEQ ID NO:

14.

61. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

14.

62. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

14.

63. The pharmaceutical composition of claim 37, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:

14.

64. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the recognition sequence comprises (a) a nucleotide sequence having at least 90% sequence identity with at least 60 consecutive nucleotides of SEQ ID NO:33, or (b) a nucleotide sequence having at least 91% sequence identity with at least 50 consecutive nucleotides of SEQ ID NO:

33.

65. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 60 consecutive nucleotides of SEQ ID NO:

33.

66. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 91% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO:

33.

67. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 75 consecutive nucleotides of SEQ ID NO:

33.

68. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 100 consecutive nucleotides of SEQ ID NO:

33.

69. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to at least 200 consecutive nucleotides of SEQ ID NO:

33.

70. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to at least 50 consecutive nucleotides of SEQ ID NO:

33.

71. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

33.

72. The pharmaceutical composition of claim 64, wherein the recognition sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

33.

73. A pharmaceutical composition as described in claim 64, wherein the recognition sequence comprises the nucleotide sequence of SEQ ID NO:

33.

74. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence, wherein the recognition sequence comprises an AluSp, AluSx, AluSg2, ERV2 superfamily or ERV3 superfamily transposable element or a functional fragment thereof, and the transposable element or its functional fragment promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell.

75. A pharmaceutical composition as described in claim 74, wherein the recognition sequence comprises the AluSp transposable element or a functional fragment thereof.

76. The pharmaceutical composition of claim 74, wherein the recognition sequence comprises the AluSx transposable element or a functional fragment thereof.

77. The pharmaceutical composition of claim 74, wherein the recognition sequence comprises the AluSg2 transposable element or a functional fragment thereof.

78. The pharmaceutical composition of claim 74, wherein the recognition sequence comprises the ERV2 superfamily transposable element or a functional fragment thereof.

79. The pharmaceutical composition of claim 78, wherein the ERV2 superfamily transposable element or a functional fragment thereof comprises an HML8 group transposable element or a functional fragment thereof that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

80. A pharmaceutical composition as described in claim 78, wherein the ERV2 superfamily transposable element or its functional fragment comprises a MER family transposable element or its functional fragment that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

81. A pharmaceutical composition as described in claim 78, wherein the ERV2 superfamily transposable element or its functional fragment comprises a MER11C transposable element or its functional fragment that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

82. The pharmaceutical composition of claim 74, wherein the recognition sequence comprises the ERV3 superfamily transposable element or a functional fragment thereof.

83. The pharmaceutical composition of claim 82, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises a MaLR group transposable element or a functional fragment thereof that promotes binding of the synthetic delivery system to the target cell or uptake of the synthetic delivery system or a component thereof by the target cell.

84. The pharmaceutical composition of claim 82, wherein the ERV3 superfamily transposable element or a functional fragment thereof comprises a THE1A transposable element or a functional fragment thereof that facilitates binding of the synthetic delivery system to the target cell or uptake of the synthetic delivery system or a component thereof by the target cell.

85. A pharmaceutical composition as described in claim 82, wherein the ERV3 superfamily transposable element or its functional fragment comprises an MLT1J2 transposable element or its functional fragment that promotes the binding of the synthetic delivery system to the target cell or the uptake of the synthetic delivery system or its components by the target cell.

86. A pharmaceutical composition comprising a synthetic delivery system and a pharmaceutically acceptable excipient, wherein the synthetic delivery system comprises a polynucleotide comprising a recognition sequence that promotes the binding of the synthetic delivery system to a target cell or the uptake of the synthetic delivery system or its components by the target cell, wherein the polynucleotide comprises a nucleotide sequence having at least 86% sequence identity to any one of SEQ ID NOs: 7, 16, 25, 29 and 31.

87. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

7.

88. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

16.

89. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

25.

90. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

29.

91. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

31.

92. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

7.

93. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

16.

94. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

25.

95. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

29.

96. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

31.

97. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:

7.

98. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:

16.

99. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:

25.

100. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:

29.

101. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO:

31.

102. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:

7.

103. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:

16.

104. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:

25.

105. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:

29.

106. The pharmaceutical composition of claim 86, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:

31.

107. The pharmaceutical composition of claim 1, wherein the polynucleotide comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO:

68.

108. The pharmaceutical composition of claim 1, wherein the polynucleotide comprises the amino acid sequence of SEQ ID NO:

68.

109. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell.

110. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell by at least 50% compared to a control synthetic delivery system lacking the recognition sequence.

111. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell by at least 50% compared to a control cell of a different cell type.

112. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes uptake of the synthetic delivery system or components thereof by the target cell.

113. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes at least 50% greater uptake of the synthetic delivery system by the target cell compared to a control synthetic delivery system lacking the recognition sequence.

114. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes at least 50% greater uptake of the synthetic delivery system by the target cell compared to a control cell of a different cell type.

115. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes nuclear localization of the synthetic delivery system within the target cell by at least 50% compared to a control synthetic delivery system lacking the recognition sequence.

116. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes nuclear localization of the synthetic delivery system within the target cell by at least 50% compared to a control cell of a different cell type.

117. The pharmaceutical composition of claim 1, wherein the recognition sequence promotes binding of the synthetic delivery system to the target cell and uptake of the synthetic delivery system or components thereof by the target cell.

118. The pharmaceutical composition of claim 1, wherein the recognition sequence comprises a nucleic acid sequence identified in circulating tumor DNA (ctDNA) from a cell type substantially similar to the target cell.

119. The pharmaceutical composition of claim 1, wherein the polynucleotide comprises double-stranded DNA.

120. The pharmaceutical composition of claim 1, wherein the synthetic delivery system further comprises a cargo.

121. The pharmaceutical composition of claim 120, wherein the cargo comprises an anti-cancer therapeutic.

122. The pharmaceutical composition of claim 120, wherein the cargo comprises a cargo nucleic acid.

123. The pharmaceutical composition of claim 122, wherein the nucleic acid cargo encodes a tumor suppressor protein.

124. The pharmaceutical composition of claim 120, wherein the cargo is attached to the 3' end of the polynucleotide.

125. The pharmaceutical composition of claim 120, wherein the cargo is attached to the 5' end of the polynucleotide.

126. The pharmaceutical composition of claim 120, wherein the cargo comprises a cytotoxic cargo.

127. The pharmaceutical composition of claim 120, wherein the cargo comprises a therapeutic cargo.

128. The pharmaceutical composition of claim 120, wherein the cargo comprises a polypeptide.

129. The pharmaceutical composition of claim 120, wherein the cargo comprises a small molecule.

130. The pharmaceutical composition of claim 120, wherein the synthetic delivery system further comprises a promoter.

131. The pharmaceutical composition of claim 1, wherein the synthetic delivery system further comprises an integration sequence that facilitates integration of the polynucleotide, the synthetic delivery system, cargo, or components thereof into the genome of the target cell.

132. The pharmaceutical composition of claim 131, wherein the integration sequence promotes genomic integration of the synthetic delivery system, the polynucleotide, the cargo, or a component thereof in a target cell by at least 50% compared to a control synthetic delivery system lacking the integration sequence.

133. The pharmaceutical composition of claim 131, wherein the integration sequence promotes genomic integration of the synthetic delivery system, the polynucleotide, the cargo, or a component thereof by a target cell by at least 50% compared to a control cell of a different cell type.

134. The pharmaceutical composition of claim 1, wherein the synthetic delivery system does not utilize viral vectors, nanoparticles, lipid nanoparticles, liposomes, exosomes, dendrimers, gene guns, or electroporation for delivery to the target cells.

135. The pharmaceutical composition of claim 1, wherein the target cell is a leukocyte.

136. The pharmaceutical composition of claim 1, wherein the target cell is a plasma cell.

137. The pharmaceutical composition of claim 1, wherein the target cell is a cancer cell.

138. The pharmaceutical composition of claim 1, wherein the target cell is a multiple myeloma cell.

139. The pharmaceutical composition of claim 1, wherein the target cell is a pancreatic cell.

140. The pharmaceutical composition of claim 1, wherein the target cell is a pancreatic cancer cell.

141. The pharmaceutical composition of claim 1, wherein the target cell is a gastrointestinal cell.

142. The pharmaceutical composition of claim 1, wherein the target cell is a colorectal cancer cell.

143. A method of delivering a cargo to a target cell, the method comprising contacting the target cell with the pharmaceutical composition or synthetic delivery system of any one of the preceding claims.

144. The method of claim 143, wherein the cargo is delivered to an intracellular compartment of the target cell.

145. The method of claim 143, wherein the cargo is delivered to the nucleus of the target cell.

146. The method of claim 143, wherein the cargo comprises a cargo nucleic acid, wherein the cargo nucleic acid is integrated into the genome of the target cell.

147. The method of claim 146, wherein the cargo nucleic acid is integrated into the genome of the target cell at the position identified in Table 2, Table 4, Table 7 or Table 8.

148. The method of claim 146, wherein the nucleic acid cargo is integrated into the genome of the target cell at Chr2:32916224-32916626.

149. The method of claim 146, wherein the nucleic acid cargo is integrated into the genome of the target cell at Ch16:32628381-32629000.

150. A method of treating a condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition as claimed in any one of the preceding claims.

151. The method of claim 150, wherein the subject is a mammal.

152. The method of claim 150, wherein the subject is a human.

153. The method of claim 150, wherein the disorder is cancer.

154. The method of claim 153, wherein the cancer is a blood cancer.

155. The method of claim 153, wherein the cancer is multiple myeloma.

156. The method of claim 153, wherein the cancer is a solid tumor.

157. The method of claim 153, wherein the cancer is pancreatic cancer.

158. The method of claim 153, wherein the cancer is colorectal cancer.

Images