Application of PAFAH2 protein in the preparation of products for the prevention and / or treatment of ischemia-reperfusion injury
By inhibiting lipid peroxidation and blocking the spread of ferroptosis through intravenous injection of PAFAH2 protein, the problem of ischemia-reperfusion injury was solved, especially in the kidneys, where effective protection against ferroptosis was achieved.
Patent Information
- Application Number
- CN202311554783.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-21
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2043-11-21
AI Technical Summary
Existing technologies are insufficient to effectively prevent and treat ischemia-reperfusion injury, especially in organs such as the kidneys, where the mechanisms of ferroptosis transmission and damage are not fully understood.
By using PAFAH2 protein or substances that promote its expression, and through intravenous injection, ferroptosis caused by lipid peroxidation is inhibited, and the spread of ferroptosis among cell populations is blocked. Specifically, this is achieved by clearing platelet-activating factor and its phospholipid-like components, thus protecting tissue cells from damage.
It significantly inhibited extensive tissue damage caused by ischemia-reperfusion, protected organs such as the kidneys from ferroptosis, and provided a simple and effective treatment option.
Smart Images

Figure BDA0004560678150000081 
Figure BDA0004560678150000091 
Figure BDA0004560678150000101
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of PAFAH2 protein in the preparation of products for the prevention and / or treatment of ischemia-reperfusion injury, and particularly to a method for the prevention and / or treatment of ischemia-reperfusion injury by intravenous injection of human recombinant PAFAH2 protein. Background Technology
[0002] Ferroprelation is a programmed cell death caused by the accumulation of iron-dependent lipid peroxidation. Initially, Erastin and RSL3 were found to specifically kill tumor cells with RAS oncogenic mutations, and were therefore collectively referred to as RAS-selective lethal compounds (RSLs). In 2012, Brent R. Stockwell named this characteristic cell death caused by RSLs ferroptosis. Ferroprelation differs from previously reported cell deaths such as apoptosis, necrosis, and pyroptosis in morphology, biochemistry, and at the genetic level. Ferroprelation does not involve the formation of apoptotic or autophagic bodies, and it does not exhibit cell contraction, chromatin aggregation, or cytoplasmic or organelle swelling. Instead, it is characterized by mitochondrial fragmentation and increased membrane density, loss of membrane structural integrity, and increased intracellular lipid peroxides. Ferroprelation has been reported to participate in the processes of various diseases, including tumors, ischemia-reperfusion injury, and neurodegenerative diseases. To date, the mechanisms of ferroptosis and the molecular regulatory network for cellular defense against ferroptosis have been largely established. However, many scientific questions related to the spread of ferroptosis and its clinical application remain to be answered. The specific mechanism by which lipid peroxidation leads to ferroptosis is a major unsolved problem in this field.
[0003] Ischemia-reperfusion (I / R) injury is tissue damage caused by the temporary interruption and subsequent restoration of arterial blood supply to an organ. During ischemia, tissues experience hypoxia, and mitochondrial anaerobic metabolism leads to a decrease in ATP production. During reperfusion, a sudden increase in reactive oxygen species (ROS) causes a cascade of reoxidation in the ischemic site and inflammation in multiple organs, ultimately leading to organ failure. Ischemia-reperfusion injury occurs in various diseases, including organ transplantation, sepsis, ischemic stroke, and sleep apnea. Ischemia-reperfusion activates programmed cell death processes such as apoptosis, necroptosis, and autophagic cell death. Inhibiting cell death to alleviate Ischemia-reperfusion injury is a novel therapeutic strategy; in animal models, inhibitors of ferroptosis have been used to alleviate various types of Ischemia-reperfusion injury.
[0004] The kidneys are vital organs responsible for excretion and endocrine function. The outer layer of the kidney is the renal cortex, primarily composed of glomeruli and renal tubules. The renal tubules can be further divided into three parts: the proximal tubule (including the proximal convoluted tubule and the thick descending limb of the loop of Henle), the thinner segment of the loop of Henle, and the distal tubule (including the thick ascending limb of the loop of Henle and the distal convoluted tubule). The interior of the kidney is composed of the renal pyramids, forming the renal medulla. Acute kidney injury, also known as acute renal failure, directly damages the renal tubules and glomeruli, leading to rapid renal insufficiency, a sudden drop in glomerular filtration rate and renal output, and impaired water and electrolyte balance. It is a major cause of high morbidity and mortality in many related diseases. Tamoxifen-induced systemic knockout of the ferroptosis key protein GPX4, excluding the brain, leads to acute kidney injury and individual death, indicating that renal tubular cells are the most vulnerable cells outside the brain region to ferroptosis damage, with the most significant damage occurring in the proximal tubular epithelial cells.
[0005] The most significant cause of acute kidney injury is renal ischemia-reperfusion injury. During renal reperfusion, a large number of reactive oxygen species (ROS) are generated, iron ion levels increase, malondialdehyde (MDA) levels increase, glutathione levels decrease, and lipid peroxidation of the membrane system increases, promoting renal tubular cell death, exhibiting characteristics similar to ferroptosis. Supplementation with the free radical scavenger melatonin can resist kidney damage caused by ischemia-reperfusion injury, indicating that the antioxidant system that scavenges free radicals has a protective effect against ischemia-reperfusion injury. Ferrostatins and Liproxstatins, inhibitors of ferroptosis, are lipophilic antioxidants; pretreatment can alleviate severe renal ischemia-reperfusion injury, suggesting that ferroptosis is involved in renal ischemia-reperfusion injury. Tamoxifen-induced knockout of the key ferroptosis protein GPX4 resulted in enlarged and pale kidneys in mice, exhibiting nonselective proteinuria and proximal tubular epithelial cell death, characteristic of acute kidney failure. Oxidative lipidomics analysis of GPX4-knockout kidneys showed increased oxidative modification of phosphatidylethanolamine, phosphatidylcholine, and cardiolipin. The lipophilic antioxidant Liproxstatin-1 reduced ferroptosis in mouse renal tubular cells induced by GPX4 knockout and prolonged their lifespan, indicating that ferroptosis contributes to acute kidney injury. Furthermore, knockout of the ferroptosis inhibitor FSP1 exacerbated ferroptosis in renal tubular cells induced by ischemia-reperfusion injury, suggesting that a non-glutathione-dependent antioxidant system can also protect the kidneys against ischemia-reperfusion injury. On the seventh day post-organ transplantation, biopsy specimens from patients with acute tubular injury showed a significantly increased expression level of the ferroptosis marker protein ACSL4, accompanied by severe thrombotic microangiopathy, further indicating ferroptosis during ischemia-reperfusion injury.
[0006] Ferroplasm-related diseases often involve large, continuous areas of damage, consistent with the wave-like propagation of ferroptosis induced by Erastin et al. between adjacent cells. Similar to pyroptosis and necroptosis, nanoscale pores formed on the cell membrane mediate the swelling and rupture of ferroptotic cells. Polyethylene glycol at 1450 and 3350 Da, acting as osmotic modulators, can inhibit cell membrane rupture during ferroptosis. Furthermore, ferroptosis signaling occurs before cell rupture, but the propagation factors for ferroptosis remain unknown. Injection of arachidonic acid into the caudal fin of zebrafish larvae induces a lipid peroxide gradient from the edge of the caudal fin wound, leading to wave-like propagation of ferroptosis in the caudal fin cells. Ferroplasmosis also exhibits a wave-like spatiotemporal propagation pattern in isolated renal tubules. Erastin induces the death of primary renal tubular cells, while the more stable and potent third-generation Ferrosatin 16-86 can inhibit renal tubular death. However, Necrostatin-1 (Nec-1), an inhibitor of necroptosis, cannot resist renal tubular death, indicating that ferroptosis, rather than necroptosis, leads to synchronized renal tubular cell death.
[0007] In conclusion, ferroptosis is involved in the occurrence and development of ischemia-reperfusion injury, and this disease can be treated or alleviated by inhibiting ferroptosis. Summary of the Invention
[0008] The technical problem to be solved by the present invention is how to prevent and / or treat and / or inhibit ischemia-reperfusion injury.
[0009] To address the aforementioned technical problems, this invention first provides a novel use for PAFAH2 protein or substances that promote PAFAH2 protein expression.
[0010] This invention provides the use of PAFAH2 protein or substances that promote PAFAH2 protein expression in the preparation of products for the prevention and / or treatment and / or inhibition of ischemia-reperfusion injury.
[0011] In the above applications, the PAFAH2 protein is the protein shown in R1)-R4) below:
[0012] R1) The amino acid sequence is that of the protein shown in SEQ ID No. 1;
[0013] R2) A fusion protein with the same function is obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1).
[0014] R3) A protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in R1) or R2).
[0015] Proteins that have 90% or more identity with the amino acid sequence shown in R4 and R1, R2, or R3 and have the same function.
[0016] In R2 above, the tag refers to a polypeptide or protein that is fused with the target protein and expressed using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0017] In R3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues, or the substitution and / or deletion and / or addition of no more than 9 amino acid residues, or the substitution and / or deletion and / or addition of no more than 8 amino acid residues, or the substitution and / or deletion and / or addition of no more than 7 amino acid residues, or the substitution and / or deletion and / or addition of no more than 6 amino acid residues, or the substitution and / or deletion and / or addition of no more than 5 amino acid residues, or the substitution and / or deletion and / or addition of no more than 4 amino acid residues, or the substitution and / or deletion and / or addition of no more than 3 amino acid residues, or the substitution and / or deletion and / or addition of no more than 2 amino acid residues, or the substitution and / or deletion and / or addition of no more than 1 amino acid residue.
[0018] In the above R4), the identity includes an amino acid sequence having 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher identity with the amino acid sequence shown in SEQ ID No. 1 of the present invention.
[0019] The proteins described in R1)-R4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0020] In one specific embodiment of the present invention, the PAFAH2 protein is obtained through biological expression. The specific preparation method includes the following steps: introducing the PAFAH2 encoding gene into biological cells to obtain recombinant cells; culturing the cells and purifying the PAFAH2 protein from the culture product.
[0021] The PAFAH2 encoding gene is introduced into a biological cell via an expression vector, specifically pcDNA3.1, and the PAFAH2 encoding gene is specifically the DNA molecule shown in SEQ ID No. 2.
[0022] The biological cells mentioned may specifically be HEK 293F cells.
[0023] The specific culture conditions can be cultured at 37℃, 120rpm, and 5%CO2 for 48 hours.
[0024] The culture process further includes the following steps: centrifugation (18,000 rpm, 4°C for 40 min), discarding the supernatant and collecting the cell pellet; resuspending the cell pellet and lysing it to obtain the lysate; centrifuging the lysate and collecting the supernatant; using affinity adsorption on the supernatant and then eluting it to obtain the human recombinant PAFAH2 protein.
[0025] The human recombinant PAFAH2 protein prepared according to the method of the present invention can be used immediately after purification and sterilization, or it can be stored frozen at -80 degrees Celsius. Repeated freeze-thaw cycles should be avoided.
[0026] In the above applications, the PAFAH2 protein can inhibit ischemia-reperfusion injury by suppressing ferroptosis caused by lipid peroxidation. Specifically, it can block the spread of ferroptosis among cell populations by clearing platelet-activating factors and their similar phospholipids caused by ischemia-reperfusion, thereby preventing and / or treating and / or inhibiting ischemia-reperfusion injury.
[0027] In the above applications, the PAFAH2 protein can be administered intravenously to prevent and / or treat and / or inhibit ischemia-reperfusion injury. The specific dosage for intravenous administration may be 20 mg / kg.
[0028] To address the aforementioned technical problems, the present invention also provides a product for preventing and / or treating and / or inhibiting ischemia-reperfusion injury.
[0029] The active ingredient of the product provided by the present invention for preventing and / or treating and / or inhibiting ischemia-reperfusion injury is any of the PAFAH2 protein described above or a substance that promotes the expression of PAFAH2 protein.
[0030] Furthermore, the product is a PAFAH2 protein solution.
[0031] Furthermore, the concentration of the PAFAH2 protein solution can be 2 mg / mL.
[0032] Furthermore, the solvent for the PAFAH2 protein solution can be a buffer solution containing 300 mM NaCl and 50 mM Tris (pH 8.5).
[0033] Any of the products mentioned above may be drugs or preparations.
[0034] In practical applications, when preparing the drug or formulation, a carrier material may also be added. The carrier material includes, but is not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.).
[0035] These materials can be used to formulate various dosage forms, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, and lyophilized powder injections. These can be conventional formulations, sustained-release formulations, controlled-release formulations, and various microparticle delivery systems. To formulate unit-dose dosage forms into tablets, a wide variety of carriers known in the art can be widely used. Examples of carriers include diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, and aluminum silicate; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, and polyvinylpyrrolidone; and disintegrants. Examples of carriers include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium dodecyl sulfate, methylcellulose, and ethylcellulose; disintegration inhibitors include sucrose, tristearate, cocoa butter, and hydrogenated oil; absorption enhancers include quaternary ammonium salts and sodium dodecyl sulfate; and lubricants include talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into pills. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfonate, methylcellulose, and ethylcellulose. For preparing unit-dose dosage forms into suppositories, a wide variety of carriers known in the art can be used. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, and semi-synthetic glycerides. For preparing unit-dose dosage forms into injectable formulations such as solutions, emulsions, lyophilized powders for injection, and suspensions, all diluents commonly used in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, and polyoxyethylene sorbitan fatty acid esters. In addition, to prepare isotonic injection solutions, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injectable formulation. Furthermore, conventional solubilizers, buffers, pH adjusters, etc., can also be added. Additionally, if necessary, colorants, preservatives, flavorings, tasters, sweeteners, or other materials can be added to the pharmaceutical formulation.
[0036] The above dosage form can be administered by injection, preferably intravenous injection. Administering the above product to subjects via intravenous injection can prevent and / or treat and / or inhibit ischemia-reperfusion injury.
[0037] To address the aforementioned technical problems, the present invention also provides a method for inhibiting ischemia-reperfusion injury.
[0038] The method for inhibiting ischemia-reperfusion injury provided by the present invention includes the step of intravenously injecting PAFAH2 protein into a subject.
[0039] The specific dosage for intravenous injection may be 20 mg / kg.
[0040] The intravenous injection can be administered after ischemia occurs but before tissue reperfusion.
[0041] In any of the above-described applications, products, or methods, the ischemia-reperfusion injury may be myocardial ischemia-reperfusion injury, cerebral ischemia-reperfusion injury, or renal ischemia-reperfusion injury (such as acute kidney injury caused by renal ischemia-reperfusion).
[0042] In any of the above-described applications, products, or methods, the ischemia-reperfusion injury includes not only the injury caused by blood flow reperfusion during clinical treatment due to obstructed blood circulation, but also the injury caused by reperfusion-like treatment in a state of tissue or organ ischemia.
[0043] The diseases that require reperfusion during clinical treatment due to obstructed blood circulation include, but are not limited to, organ transplantation, sepsis, myocardial infarction, and atherosclerosis.
[0044] The situations described for performing reperfusion-like treatments in the state of tissue or organ ischemia include, but are not limited to, clearing microcirculation during shock, relieving coronary artery spasm, and cardiopulmonary resuscitation after cardiac arrest.
[0045] The beneficial effects of this invention are as follows: During ischemia-reperfusion, platelet-activating factor and various types of oxidized cleaved phospholipids are produced. Platelet-activating factor acetylhydrolase PAFAH2 is an intracellular phospholipase specific to these particular phospholipids. By hydrolyzing the short chain at the sn-2 position of phospholipids, it promotes the entry of oxidized phospholipids into the phospholipid cycle for the synthesis of new phospholipids, thereby achieving the removal of harmful phospholipids. Based on this, this invention provides a method for inhibiting ischemia-reperfusion injury by intravenously injecting PAFAH2 protein. This method involves intravenously injecting in vitro purified human recombinant PAFAH2 protein after ischemia occurs and before tissue reperfusion. PAFAH2 removes oxidized cleaved phospholipids generated during reperfusion, thereby protecting tissue cells from ferroptosis caused by lipid peroxidation and its spread, and inhibiting large-area tissue damage caused by ischemia-reperfusion. The method of this invention is applicable to a variety of clinical situations, including various organ transplant surgeries, unblocking blood vessels, and sepsis. It only requires intravenous injection of PAFAH2 protein before the surgery, which is simple, convenient, and effective.
[0046] This invention provides a method for inhibiting ischemia-reperfusion by intravenous injection of PAFAH2 protein. This invention reveals for the first time that platelet-activating factors and their phospholipid-like analogs can induce ferroptosis in cells. On the one hand, they can directly increase cell membrane permeability; on the other hand, they can be secreted extracellularly, acting as propagation factors for ferroptosis and promoting its spread within the cell population. PAFAH2, as an intracellular specific hydrolase against platelet-activating factors and their phospholipid-like analogs, resists ferroptosis by clearing these oxidative substrates. Ischemia-reperfusion leads to ferroptosis in tissue cells. This invention, by injecting human recombinant PAFAH2 protein, clears oxidatively truncated phospholipids generated during reperfusion, thereby protecting tissue cells from the occurrence and spread of ferroptosis caused by lipid peroxidation and inhibiting large-area tissue damage caused by ischemia-reperfusion. Attached Figure Description
[0047] Figure 1 Platelet-activating factor and its phospholipid-like components cause ferroptosis in cells. Figure 1 Changes in cell viability in HK2, HT1080, and HUVEC cell lines after treatment with AC (platelet-activating factor) and its phospholipid analogues were detected using CCK8 assay. Figure 1 D represents the cell viability changes detected by pretreatment with ferroptosis inhibitors Fer-1 or DFO, apoptosis inhibitor Z-VAD-FMK, necrosis inhibitor Nec-1, and autophagy inhibitor 3-MA, respectively. Figure 1After E was used to treat cells with DMSO, platelet activating factor C16, or RSL3, changes in mitochondrial membrane density were detected using electron microscopy. Figure 1 After treatment with platelet-activating factor C16, the changes in fluorescence intensity of BODIPY 581 / 591C11 in cells were detected by flow cytometry using the FL1 channel. Figure 1 H represents the changes in ferroptosis marker genes detected by qRT-PCR after treatment with platelet activating factor C16 over time gradients. Figure 1 I represents the change in cell viability detected by CCK8 assay after pretreatment with Fer-1, an inhibitor of ferroptosis, followed by posttreatment with PGPC, a phospholipid similar to platelet-activating factor. Figure 1 J represents the change in cell viability of POVPC, a phospholipid similar to platelet-activating factor, after pretreatment with the inhibitor of ferroptosis, Fer-1, and posttreatment with CCK8 assay. Figure 1 KL isolated renal tubules from the kidneys of C57 / BL6J mice, pretreated them with inhibitors for different cell death types, and then treated them with platelet-activating factor C16. Calcein (green) indicates live cells, and propidium iodide (red) indicates dead cells.
[0048] Figure 2 Platelet-activating factor and its phospholipid-like components increase liposome membrane permeability. Figure 2 A is a POPC liposome containing 2% NBD-DPPE fluorescence. After the addition of the strong reducing agent sodium dithionite, only the NBD fluorescence on the outer leaflets of the liposome was quenched. Figure 2 B is a POPC liposome containing 2% NBD-DPPE fluorescence and a certain proportion of platelet activating factor C16 or PGPC. After the addition of sodium dithionite, the NBD fluorescence on the inner and outer lobules of the liposome was quenched. Figure 2 C represents POPC liposomes with or without a certain proportion of platelet-activating factor C16. After the addition of sodium dithionite, the changes in fluorescence intensity of the liposomes were detected using a multifunctional ELISA reader. Figure 2 D represents POPC liposomes with or without a certain proportion of PGPC. After the addition of sodium dithionite, the changes in fluorescence intensity of the liposomes were detected using a multi-functional microplate reader.
[0049] Figure 3 Platelet-activating factor is a factor that promotes ferroptosis. Figure 3 A represents the changes in platelet-activating factor (PAF) levels in cell culture medium after treatment with the ferroptosis inducer RSL3 for different durations, detected using a platelet-activating factor ELISA. Figure 3 B represents the change in cell viability after treating the platelet-activating factor C16 concentration gradient with siRNA transfection to knock down the platelet-activating factor receptor, and then using CCK8 assay. Figure 3C represents cells pretreated with the platelet-activating factor receptor antagonist WEB2086 or Ginkgolide B, followed by treatment with platelet-activating factor C16, and cell viability was assessed using CCK8 assay. Figure 3 D represents the cell viability after pretreatment with α-acid sphingomyelinase imipramine followed by treatment with platelet activating factor C16 and detection using CCK8 assay. Figure 3 E represents the cell viability of cells treated with the inhibitor Dynasore for activating protein, followed by treatment with platelet activating factor C16 and detection using CCK8 assay. Figure 3 FG describes the microinjection of platelet-activating factor C16 into cells (black dashed box), followed by confocal microscopy to observe cell death. Propidium iodide staining (red) is used to indicate cell death. The number of newly added propidium iodide-positive cells is counted. Figure 3 HI involves adding IgG or platelet-activating factor antibody to the cell culture medium, observing the cell state using an optical microscope after RSL3 treatment (H), and detecting cell viability using CCK8 (I). Figure 3 JK isolated renal tubules from the kidneys of C57 / BL6J mice. Using microinjection, IgG or platelet-activating factor antibody (accompanied by Dextran-Cascade Blue, blue) was injected into one end of the tubule, while 1% BSA or platelet-activating factor C16 (accompanied by Dextran-488, green) was injected into the other end. After changing the medium and adding propidium iodide-containing culture medium, live-cell imaging was performed to observe renal tubular cell death (red).
[0050] Figure 4 To inhibit platelet-activating factor acetylhydrolase 2, which promotes ferroptosis. Figure 4 A represents the change in cell viability detected by transfecting siRNA to knock down platelet activating factor acetylhydrolase 2, followed by treatment with an RSL3 concentration gradient. Figure 4 B represents Cas9 knockout control or PAFAH2 knockout cells treated with DMSO or RSL3, and the proportion of propidium iodide-positive cells was detected by flow cytometry. Figure 4 C represents Cas9 knockout control or PAFAH2 knockout cells treated with DMSO or RSL3. Cell death was observed using confocal microscopy. Propidium iodide staining (red) was used to indicate cell death. Figure 4 D represents the Cas9 knockout control or PAFAH2 knockout cells treated with DMSO or RSL3 concentration gradients, and changes in cell viability were detected using CCK8 assay. Figure 4 E represents the concentration gradient of DMSO or Erastin used to treat Cas9 knockout control or PAFAH2 knockout cells, and changes in cell viability were detected using CCK8 assay. Figure 4 F represents Cas9 knockout control or PAFAH2 knockout cells treated with DMSO or sorafenib concentration gradients, and changes in cell viability were detected using CCK8 assay. Figure 4 G represents the Cas9 knockout control or PAFAH2 knockout cells treated with a gradient of DMSO or cruciferine concentrations, and changes in cell viability were detected using a CCK8 assay. Figure 4 H represents PAFAH2 knockout monoclonal cells that were pretreated with ferroptosis inhibitors Fer-1 or DFO, apoptosis inhibitor Z-VAD-FMK, necrosis inhibitor Nec-1, and autophagy inhibitor 3-MA, respectively, and then treated with an RSL3 concentration gradient. Changes in cell viability were detected using CCK8 assay. Figure 4 I represents Cas9 knockout control or PAFAH2 knockout cells treated with DMSO or RSL3. Changes in the fluorescence intensity of BODIPY 581 / 591C11 in the cells were detected by flow cytometry via the FL1 channel. Figure 4 J represents HT1080 cells pretreated with Fer-1 and PAFAH2 inhibitor ML225, followed by RSL3 cells. Cell death was observed using confocal microscopy. Propidium iodide staining (red) was used to indicate cell death. Figure 4 K represents HT1080 cells pretreated with ML225, an inhibitor of Fer-1 and PAFAH2, followed by RSL3 cells. Changes in cell viability were detected using CCK8 assay. Figure 4 L represents the concentration gradient of RSL3 after pretreatment of HUVEC cells with DMSO or ML225, and changes in cell viability were detected using a CCK8 assay. Figure 4 M consists of HUVEC cells pretreated with Fer-1 and ML225, then treated with RSL3. Changes in the fluorescence intensity of BODIPY 581 / 591C11 in the cells were detected by flow cytometry using the FL1 channel.
[0051] Figure 5 Renal ischemia-reperfusion can lead to ferroptosis in renal tubular cells. Figure 5 Mice with AB C57 / BL6J kidneys were subjected to 30 minutes of renal ischemia, followed by reperfusion at the above time gradient. The renal cortex of the mice was then collected for qRT-PCR to detect changes in the ferroptosis marker genes PTGST2 and CHAC1. Figure 5 Mice with C57 / BL6J kidneys were subjected to 30 minutes of renal ischemia, followed by reperfusion at the aforementioned time gradient. The renal cortex of the mice was then collected for polyacrylamide gel electrophoresis to detect changes in the levels of ferroptosis-related proteins. Figure 5 Mice with DE C57 / BL6J underwent intraperitoneal injection of Vehicle or Fer-1, followed by 30 minutes of renal ischemia and 24 hours of reperfusion. Serum samples were collected to detect blood urea nitrogen levels, and kidney samples were taken to detect the degree of renal injury and changes in ferroptosis markers. Figure 5 In mice with FH (C57 / BL6J), the kidneys were ischemic for 30 minutes and then reperfused with the above time gradient. Changes in PAFAH2 protein levels in the kidneys were detected by immunohistochemistry (F, G) and changes in PAFAH2 protein levels in the renal cortex were detected by polyacrylamide gel electrophoresis (H).
[0052] Figure 6 Inhibition of PAFAH2 can significantly promote ischemia-reperfusion injury and ferroptosis of renal tubular cells. Figure 6 Mice with an AG of C57 / BL6J underwent ischemia-reperfusion surgery after pretreatment with Fer-1 and ML225. The degree of renal tubular damage was assessed by hematoxylin and eosin staining (A, first row). Changes in ferroptosis markers were analyzed by immunohistochemistry (A, second to fourth rows). Changes in mitochondrial morphology in the proximal tubules were examined by electron microscopy (A, sixth row). The degree of renal tubular damage was statistically analyzed (B). Statistical analysis was performed on renal tubules positive for 4-hydroxyrenenoic acid, transferrin receptor, and lipoxygenase staining (CE). Mitochondrial length was statistically analyzed (G). Figure 6 Mice with a HI of C57 / BL6J were pretreated with Fer-1 and ML225, followed by ischemia-reperfusion surgery. Renal tubular cell death was assessed in vivo using two-photon microscopy (H). The proportion of renal tubules positive for propidium iodide staining was statistically analyzed (I).
[0053] Figure 7 PAFAH2 knockout mice are more susceptible to tubular cell ferroptosis and kidney injury induced by ischemia-reperfusion. Figures 7A-E show the extent of tubular damage in wild-type C57 / BL6J mice and PAFAH2 knockout mice after bilateral renal ischemia-reperfusion (A, first row) by hematoxylin and eosin staining, and changes in platelet-activating factor (PAF) levels by immunohistochemistry (A, second row). The extent of tubular damage was statistically analyzed (B). Serum urea nitrogen levels were measured 24 hours after reperfusion (C, D). Statistical analysis was performed on PAF-positive tubules (E). Figure 7 FH represents the in vivo detection of renal tubular cell death in wild-type C57 / BL6J mice and PAFAH2 knockout mice after left kidney ischemia-reperfusion, using two-photon microscopy (F). A schematic diagram of in vivo mouse kidney imaging is shown (G). Statistical analysis of the proportion of propidium iodide-positive renal tubules is presented (H). Figure 7Following ischemia-reperfusion, changes in the levels of ferroptosis markers 4-hydroxyrenenoic acid (4-hydroxyrenenoic acid), transferrin receptor, and lipoxygenase were analyzed by immunohistochemistry in wild-type mice (IM: C57 / BL6J) and PAFAH2 knockout mice (I). Statistical analysis was performed on renal tubules that were positive for 4-hydroxyrenenoic acid, transferrin receptor, and lipoxygenase staining (JL). Changes in PTGS2 transcription levels in the renal cortex were detected using real-time quantitative PCR (M).
[0054] Figure 8 Intravenous injection of recombinant human PAFAH2 protein can significantly alleviate ischemia-reperfusion-induced tubular cell ferroptosis and kidney injury. Figure 8 AB consisted of BSA, purified PAFAH2 protein (0.08 mg / mL) or its enzyme activity site mutant (0.08 mg / mL) mixed into the cell culture medium, and treated with DMSO or RSL3 for 12 hours. The cells were then photographed using a microscope (A) and the changes in cell viability were detected using CCK8 (B). Figure 8 Left kidney ischemia was induced in C57 / BL6J mice for 30 minutes. Fifteen minutes before reperfusion, BSA, purified PAFAH2 protein (20 mg / kg), or its enzyme active site mutant (20 mg / kg) were administered intravenously. Renal tubular cell death was assessed in vivo using two-photon microscopy (C). The proportion of promethazine iodide-positive tubules was statistically analyzed (D). Figure 8 In C57 / BL6J mice, bilateral renal ischemia was performed for 30 minutes. Fifteen minutes before reperfusion, BSA, purified PAFAH2 protein (20 mg / kg), or its enzyme activity site mutant (20 mg / kg) were administered intravenously. Serum urea nitrogen levels were measured 24 hours after reperfusion (E, F). Hematoxylin and eosin staining was used to analyze the degree of renal tubular damage, and immunohistochemistry was used to detect changes in the levels of ferroptosis markers 4-HNE, COX2, and TfR1 (G). Statistical analysis was performed on the degree of renal tubular damage and on renal tubules positive for 4-HNE, TfR1, and COX2 staining (HK). Detailed Implementation
[0055] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0057] The specific preparation methods for the PAFAH2 knockdown cells and control cells used in this invention are as follows:
[0058] 1. Seed cells in six-well plates and allow them to adhere for 24 hours until cell confluence reaches 50%. Then, perform siRNA transfection. Because RNA is easily degraded, nuclease-free pipette tips and Eppendorf tubes were used for transfection. The siRNA transfection system, using a six-well plate as an example, is shown in Table 1. The siRNA sequences are shown in Table 2, with a negative control (AATTCTCCGCGTGTCCGT) used as a reference.
[0059] Table 1. siRNA transfection system
[0060]
[0061] Table 2. siRNA Sequences
[0062] name Target - #1 Target - #2 Target - #3 PAFAH2 CTGGCAACTTGATTGGTAA GAACAGTCTAGGATCATAA GGAGCTTCTTTCGACTCTT
[0063] 2. Replace with fresh complete culture medium 8 hours after transfection. Cells can be passaged 24 hours after transfection by seeding them into the required wells of a plate. Subsequent experiments such as drug addition or staining can be performed 48-72 hours after transfection. The knockdown efficiency of the target gene can be detected by methods such as real-time quantitative PCR or Western blotting.
[0064] The specific preparation methods for the PAFAH2 knockout cell line and its control cells used in this invention are as follows:
[0065] 1. Construction of gene knockout plasmids
[0066] 1.1) Design of sgRNA target sequence and PCR primers: For gene knockout plasmids, a specific 20bp target sequence preceding the NGG sequence of the target gene is selected, and the bases required for enzyme digestion are added to the 5' end of the plasmid. The sgRNA target sequences are shown in Table 3.
[0067] Table 3. sgRNA target sequences
[0068] name Target - #1 Target - #2 Target - #3 PAFAH2 GCTGGCCTCACGTGGCTTTG GTCATCAGATCCAAGCCACC GCCCAGCAGTGACCTCTTGC
[0069] The PCR primer sequences designed for each target are as follows:
[0070] Target-#1: FP: CACCGGCTGGCCTCACGTGGCTTTG; RP: AAACCAAAGCCACGTGAGGCCAGC.
[0071] Target-#2: FP: CACCGGTCATCAGATCCAAGCCACC; RP: AAACGGTGGCTTGGATCTGATGAC.
[0072] Target-#3: FP: CACCGGCCCAGCAGTGACCTCTTGC; RP: AAACGCAAGAGGTCACTGCTGGGC.
[0073] 1.2) Primer annealing: The synthesized oligonucleotides were annealed to obtain annealed products. The targeted primer annealing system is shown in Table 4, and the targeted primer annealing procedure is shown in Table 5.
[0074] Table 4. Targeted Primer Annealing System
[0075] reagents Volume (10 μL) Primer FP (100μM) for targeting the target gene. 1μL Primer RP (100 μM) for targeting the target gene. 1μL 10×T4 Buffer 1μL <![CDATA[ddH2O]]> 7μL
[0076] Table 5. Targeted Primer Annealing Procedure
[0077] temperature time 37℃ 30min 95℃ 5min ↓ The temperature continues to drop at a rate of 5°C per minute. 25℃ hold
[0078] 1.3) Vector digestion: The empty lentiCRISPR vector was digested with a single enzyme to obtain sticky ends that are complementary to the annealing product described above. The digestion system is shown in Table 6. After overnight digestion at 37°C, agarose gel electrophoresis and gel recovery were performed to obtain the successfully digested linear lentiCRISPR empty vector fragment.
[0079] Table 6. LentiCRISPR vector digestion system
[0080] reagents Volume (40 μL system) lentiCRISPR unloaded 2μg Restriction endonuclease BbsI 2μL 10×NEB cut Buffer 4μL <![CDATA[ddH2O]]> Add volume to 40 μL
[0081] 1.4) Ligation: The annealed product was ligated with the linear lentiCRISPR unloaded fragment. The ligation system is shown in Table 7.
[0082] Table 7. Gene Knockout Plasmid Ligation System
[0083] reagents Volume (10 μL system) lentiCRISPR unloaded linear fragment 50ng Oligonucleotide annealing product (1 μM) 1μL 10×T4 ligase Buffer 1μL T4 ligase 1μL <![CDATA[ddH2O]]> Add volume to 10 μL
[0084] 1.5) The transformation and identification are the same as the steps above.
[0085] 2. Lentiviral packaging
[0086] 2.1) Knockout of target gene using lentiCRISPR (Addgene, 52961): In 293T cells, the target gene and the viral packaging plasmid were co-transfected. The transfection system was set up in a 6 cm dish, as shown in Table 8.
[0087] Table 8. Lentiviral Packaging Systems
[0088]
[0089]
[0090] 2.2) Obtaining the virus solution: Gently add the above transfection system to 293T cells, and replace it with fresh complete culture medium after 8 hours. Starting from this point, collect the cell culture medium once after 24 hours and replace it with fresh complete culture medium. Collect the cell culture medium a second time after 48 hours. The cell supernatant collected in these two steps is the virus solution. It must be filtered through a 0.22-micron pore size filter membrane before use.
[0091] 3. Lentiviral infection of cells
[0092] 3.1) Cell Infection: HT1080 cells requiring PAFAH2 knockout were seeded in appropriate well plates and cultured adherently for 24 hours until cell confluence reached 40%. Then, the cells were infected with the virus solution. The ratio of virus solution to complete culture medium was 1:1, and polybrene (10 μg / mL) was added to improve infection efficiency. Twelve hours after virus infection, the cells were replaced with fresh complete culture medium.
[0093] 3.2) Screening: 48 hours after infection, the culture medium was replaced with complete medium containing 1 μg / mL puromycin for continuous culture. After two passages, the surviving cells were polyclonal cells expressing the puromycin resistance gene.
[0094] 4. Construction of monoclonal cell lines
[0095] After screening in the above steps, the cell lines that exhibit puromycin resistance were digested and counted. Fifty cells were evenly seeded into 96 wells of a 96-well plate. On average, each pair of wells contained one puromycin-resistant cell. After one week, when cell clones appeared, wells with more than one clone were discarded; wells with only one cell clone were considered monoclonal cell lines. Once the clones reached a certain size, they were expanded into 24-well plates, 6-well plates, and 10 cm dishes. The expansion process required puromycin to maintain the culture. Western blotting was performed on the expanded monoclonal cells to determine the efficiency of cell overexpression or knockout.
[0096] The specific method for preparing PAFAH2 knockout mice used in this invention is as follows:
[0097] 1. The sequence information of the mouse PAFAH2 gene was obtained according to NCBI Gene ID: 100163, and the target sites of sgRNA were designed based on NM_133880.3. This experiment selected the complete sequence of exon 3, and the two designed sgRNA target sequences were: CCTAGGCTCCGTGCGAACGA and TGCCAGCGTTTGTAGAACTG. In vitro transcription was performed, and the activity of the transcription products was detected to prepare Cas9 mRNA.
[0098] 2. Prepare 4-week-old C57BL / 6J female mice and 8-12-week-old C57BL / 6J male mice. Female mice were intraperitoneally injected with 0.1 mL (5 U) PMSG per mouse, followed by an intraperitoneal injection of 0.1 mL (5 U) hCG per mouse 48 hours later. Oocytes were collected 18 hours later. The epididymis of male mice was removed, and sperm was extracted from the epididymis. Highly motile sperm were selected and fertilized with oocytes in vitro for 3-4 hours to obtain zygotes. A mixture of sgRNA and Cas9 mRNA (sgRNA 25 ng / μL, Cas9 mRNA 50 ng / μL) was prepared with RNA-free water and injected into the zygotes using a microinjection system. The injected zygotes were transferred into the oviducts of pseudopregnant female mice anesthetized with 12.5 mg / mL tribromoethanol via intraperitoneal injection and housed in individually ventilated cages. Genotyping was performed on the mice after birth.
[0099] 3. Pups born to surrogate female mice were designated as Founders and named F0 generation. One week after birth, F0 generation mice were numbered by clipping their toes and their genomes were extracted using the alkaline cleavage method. PCR amplification was performed using forward primer F: CCTGATGTAGGGGGACAGGA and reverse primer R: AGACTCTCTGGCTGCCCATA. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 35 s, 72℃ extension for 1 min 30 s, for a total of 35 cycles; 72℃ extension for 5 min; 4℃ hold. 5 μL of PCR product was subjected to agarose gel electrophoresis. The wild-type amplified fragment length was 1596 bp. PCR products significantly shorter than this length were sequenced for verification.
[0100] 4. F0 generation mice, which were verified as positive heterozygotes by genome sequencing, were mated with C57BL / 6J WT mice to obtain F1 generation mice. After further genome identification and sequencing of the F1 generation mice, PAFAH2 mice were selected. + / - The F2 generation of mice was produced through self-pollination, and PAFAH2 was ultimately obtained after identification and sequencing. - / -The gene and protein expression of PAFAH2 in PAFAH2 KO mice were detected by combining RT-PCR and Western blotting.
[0101] The C57BL / 6J mice used in this invention are products of Vital Rivers.
[0102] The cell lines and main reagents used in this invention are as follows: human renal cortical proximal tubular epithelial cells HK2 (CRL-2190), human fibrosarcoma cell line HT1080 (CCL-121), human umbilical vein endothelial cells HUVEC (CRL-1730), and human osteosarcoma cell line U-2OS (HTB-96) are all products of ATCC. All cell lines were cultured in DMEM (Gibco) medium supplemented with 10% fetal bovine serum (SORFA, SX5112) at 37°C with 5% CO2.
[0103] The main reagents used in this invention and their sources are as follows: RSL3 (B6095) and Deferoxamine mesylate (B6068) are both products of APExBIO. Bovine serum albumin (pH 7.0, A602448-0050) is a product of BBI lifesciences. BODIPY 581 / 591C11 (D3861), dextran-488 (10,000MW) (D22910), dextran-Cascade-Blue (10,000MW) (D1976), and the antibody against transferrin receptor TfR1 (Invitrogen, 13-6800) are all products of Invitrogen. Erastin (HY-15763), Platelet-Activating Factor (HY108635), Ginkgolide B (HY-N0784), 3-Methyladenine (3-MA) (HY-19312), Necrostatin-1 (Nec-1) (HY-15760), Ferrostatin-1 (HY-100579), and Z-VAD-FMK (HY-16658B) are all products of MCE. WEB2086 (SML0233-5 mg), Imipramine (I0899-5 g), Propidium Iodide (PI) (P4170-10 mg), and Sodium Dithionite (71699-50 g) are all products of Sigma. Calcein (C8950) and Corn Oil (C7030-500 ml) are both products of Solarbio LifeScience. DDD85646 (13839), IMP-1088 (25336), Erastin2 (27087), Azelaoyl platelet activating factor (60924), Butanoyl platelet activating factor (60928), Butenoyl platelet activating factor (60929), Arachidonoyl platelet activating factor C-16 (60904), platelet activating factor C-18 (60910), 2-thio-platelet activating factor (60945), 2-O-methyl platelet activating factor C-16 (60902), 2-O-ethyl platelet-activating factor C-16 (60925), Pyrrolidino platelet-activating factor C-16 (60909), Docosahexaenoyl platelet-activating factor C-16 (60903), Hexanolamino platelet-activating factor C-16 (60905), Methylcarbamyl platelet-activating factor C16 (60908), and Methylcarbamyl platelet-activating factor C8 (9000332) are all products of Cayman Chemicals.PGPC (870602P-5mg), POVPC (870606P-1mg), lysoPC (855675), POPC (850457), POPE (850757), DOPS (840035), and NBD-DPPE (810144) are all products of Avanti Polar Lipids. Antibodies against actin β-actin (ab8226), glutathione peroxidase 4 (GPX4) (ab16739), and SLC7A11 (ab37185) are all products of Abcam. PAFAH2 antibody (abx128175) is a product of Abbexa. Unless otherwise specified, all other reagents are domestically produced analytical grade.
[0104] The main experimental methods and specific steps used in this invention are as follows:
[0105] 1. Detection of mRNA abundance
[0106] Total RNA was extracted from cells and used as a template to reverse transcribe it into a cDNA library. The library was then amplified using primers corresponding to the target gene. The abundance of the target gene relative to the internal reference gene Actin was calculated based on the number of amplifications when the SYBR Green fluorescence intensity increased to a set threshold.
[0107] 2. Flow cytometry
[0108] Cells were seeded in 12-well plates and induced to ferroptosis after reaching the logarithmic growth phase and a density of 80%. Ferroptosis was induced using RSL3, Erastin, or Sorafenib. Cells were collected for flow cytometry analysis after treatment until significant changes in cell morphology occurred but before cell lysis. Cells were first collected into Eppendorf tubes through washing, mild digestion, termination, resuspending, and centrifugation. Then, cells were washed with 1×PBS and centrifuged. After resuspending the cells in 1×PBS containing propidium iodide (PI, 1 μg / mL), the cells were filtered into single cells and transferred to flow cytometry tubes for loading.
[0109] Propidium iodide can only penetrate the cell membrane of dead cells, and its fluorescence signal increases sharply after binding to DNA. When detecting propidium iodide fluorescence using FACS Calibur (BD) flow cytometry, a 488 nm laser was used for excitation, and the fluorescence signal from the FL2 channel (the FL2 channel accepts emission light in the range of 564–606 nm) was collected. Cell samples without propidium iodide dye were used as negative controls to eliminate the influence of autofluorescence. 12,000 cells were collected from each sample to calculate the total fluorescence intensity.
[0110] 3. Microscopic imaging
[0111] Cells were seeded in small glass dishes and treated with a drug to induce significant morphological changes. Cell death rates were analyzed using propidium iodide staining. First, cells were washed with 1×PBS. Then, PBS containing propidium iodide (1 μg / mL) was used for staining for ten minutes. Finally, imaging was performed using a microscope (Zeiss LSM 900). Propidium iodide fluorescence was detected using a 555 nm laser to excite and collect red fluorescence signals, while bright-field imaging was performed using ESID.
[0112] 4. Detection of cell viability
[0113] When cells grown in 96-well plates reach 80% confluence, ferroptosis is induced. Pretreatment with any necessary drugs should be performed before the cell death inducer treatment, according to the required timeframe. The prepared drug is added (100 μL / well) by changing the cell culture medium. For detection, 10 μL / well of CCK8 stock solution is added, vortexed, and incubated at 37°C for approximately 1.5 hours in a 5% CO2 incubator until the culture medium reaches an appropriate depth of orange-yellow. Autoluminescent detection is then performed using a Multiskan Sky microplate reader. The relative cell viability is calculated based on the absorbance value (OD = 450 nm). Each sample has at least three replicates.
[0114] 5. BODIPY 581 / 591C11 testing
[0115] Increased lipid peroxidation is the most important characteristic of ferroptosis. BODIPY 581 / 591C11 fluorescent dye is the most widely used and reliable indicator for ferroptosis detection. After BODIPY 581 / 591C11 is oxidized in living cells, its emission peak changes from approximately 590 nm to approximately 510 nm, and the fluorescence signal changes from red to green. Therefore, the green fluorescence signal is used to indicate lipid peroxidation. The specific detection steps are as follows: 1) Treat cells seeded in 12-well plates with RSL3 for 30 minutes, followed by BODIPY 581 / 591C11 staining analysis. 2) Add BODIPY 581 / 591C11 (working concentration 5 μM) to the original culture medium and continue culturing for 25 minutes. Then, wash the cells with pre-cooled 1×PBS before loading. 3) Using a flow cytometer with a 488nm laser on a FACS Calibur (BD) instrument, fluorescence signals from the FL1 channel (FL1 channel accepts emission light in the range of 515–545nm) were collected. Cell samples without BODIPY 581 / 591C11 were used as negative controls. 12,000 cells were collected from each sample to calculate the total fluorescence intensity. Peak diagrams show the green fluorescence intensity of all cells, and statistical graphs show the average total fluorescence intensity. Alternatively, cells can be seeded in small glass dishes, and fluorescence changes of BODIPY 581 / 591C11 can be detected using a fluorescence confocal microscope (Zeiss LSM 900). After staining for 25 minutes and washing with 1×PBS, imaging can be performed.
[0116] 6. Liposome-related experiments
[0117] Based on the composition of phospholipids in biological membranes and experimental requirements, 500 μL of liposomes with a final concentration of 2 mM were constructed in vitro. According to the proportions of various phospholipid components in Table 9, liposomes containing different proportions of platelet-activating factor were constructed. The steps are as follows: 1) Mixing components: Since the stock solution concentrations of various phospholipids are not entirely the same, the required volume of each phospholipid needs to be calculated based on molar amounts, and then mixed together in proportion. 2) Nitrogen blowing: Nitrogen gas was used to accelerate the evaporation of the organic solvent used to dissolve the phospholipids, and the mixture was dried as much as possible. 3) Vacuum centrifugation: To ensure complete evaporation of the organic solvent, the mixture was vacuum centrifuged for 60 minutes. 4) Repeated freeze-thaw cycles: 500 μL of PBS was added to the sample after the organic solvent had evaporated. The sample was placed on a float and rapidly frozen with liquid nitrogen, then transferred to a room temperature water bath to thaw completely. This process was repeated ten times. After the first three thawing cycles, shaking was used to promote dissolution. With each freeze-thaw cycle, the liposomes became increasingly clear. 5) Filtration Membrane: The liposomes obtained above were repeatedly squeezed through a 50nm pore size filter membrane. The purpose was to squeeze the liposomes into similar sizes to eliminate the influence of size on their performance. 6) Electron Microscopy Observation: The morphology and structure of the liposomes were observed using a negative staining electron microscope or cryo-electron microscope. 7) Functional Assay: The liposomes obtained above were diluted to a concentration of 1mM using PBS. 100μL of liposomes was added to a black ELISA plate, and the fluorescence intensity of NBD was monitored dynamically in real time using a multi-mode microplate reader (Ex=460nm, Em=538nm). Detection was performed every 30 seconds for a total of 10 minutes. 2μL of sodium dithionite (100mM) was added to each well using a multi-channel pipette, and NBD fluorescence detection was started immediately. Detection was performed every 30 seconds for a total of 10 minutes. The addition of 2μL of sodium dithionite and detection were repeated until the NBD fluorescence signal remained essentially unchanged. The disruptive effect of liposomes containing different concentrations of platelet-activating factor on the integrity of biological membranes was compared.
[0118] Table 9. Composition of liposomes used in the experiment
[0119]
[0120] 7. Detection of platelet-activating factor levels
[0121] (1) Platelet Activating Factor ELISA: Cell samples seeded in 24-well plates were treated, and the supernatant of the cultured cells was aspirated to detect the extracellular platelet activating factor content. Specific experimental procedures were performed according to the instructions for the Platelet Activating Factor ELISA Kit provided by BioVision.
[0122] (2) Immunofluorescence: 1) Cell climbing: Place a clean and sterilized coverslip in a 24-well plate, seed cells on the coverslip, and after they adhere and grow to a certain degree of confluence, perform transfection or drug treatment. 2) Fixation: After washing with PBS, fix with 4% formaldehyde solution for 20 minutes. 3) Punching: After washing with PBS, add 0.2% Triton X-100 solution and punch wells at room temperature for 1 minute. If the punching time is too long, it will cause mitochondrial damage. 4) Blocking: After washing with PBS, add 4% BSA solution and block for 30 minutes. 0.1% Triton X-100 can be added to the blocking solution to promote the entry of BSA or antibody. Transfer the coverslip to a humidified chamber with the cell side facing up. 5) Incubation with primary antibody: Dilute the primary antibody with 4% BSA solution, and take 80 μL to cover the cell side of the coverslip. Incubate overnight at 4℃. 6) Washing with primary antibody: Wash the cells 6 times with 4% BSA solution, 2 minutes each time. 7) Incubation with secondary antibody: Dilute the fluorescent secondary antibody, which matches the primary antibody, with 4% BSA solution. Take 80 μL and cover the cell side of the coverslip. Incubate at room temperature in the dark for 30 minutes. 8) Washing with secondary antibody: Wash 6 times with PBS in the dark. 9) Nuclear staining: Dilute DAPI with PBS and take 80 μL to cover the cells. Incubate in the dark for 10 minutes. 10) Washing with nuclear dye: Wash the cells 3 times with PBS solution in the dark, 2 minutes each time. 11) Mounting: Take 3 μL of mounting medium and seal the cell side between the coverslip and the slide. The slide is then ready for storage and imaging.
[0123] 8. Transmission electron microscopy
[0124] 1) Cells: Cells were aggregated at the bottom of centrifuge tubes and fixed with 2.5% glutaraldehyde (4°C). After fixation with osmium tetroxide and graded dehydration with alcohol, the samples were embedded, polymerized, and trimmed. Ultrathin sections were prepared using a Leica EMUC6 microscope, placed on a copper grid, and imaged using a Spirit 120kV ultrathin section transmission electron microscope.
[0125] 2) Mouse kidneys: After euthanizing the mice and opening their abdomens, physiological saline was injected into the left ventricle using a syringe. The blood was rapidly drained through perfusion, followed by perfusion with a solution of 4% formaldehyde and 0.5% glutaraldehyde. Finally, the mouse kidneys were removed, and a 1 cubic millimeter section of the renal cortex was cut and fixed overnight at 4°C with 2.5% glutaraldehyde. Subsequent steps were the same as the cell preparation method.
[0126] 9. HE staining
[0127] 1) Fixation: Mouse kidneys after ischemia-reperfusion were collected and fixed overnight at 4°C with 15 mL of 4% paraformaldehyde tissue fixative, using shaking. 2) Dehydration: The mouse kidneys were removed and washed five times with distilled water. After wrapping with gauze, they were placed in an embedding cassette and dehydrated stepwise with a gradient of ethanol, maintaining each concentration for 1 hour. 3) Clearing: Xylene was used to replace the alcohol three times. 4) Paraffin Infiltration: The tissue blocks were immersed in melted paraffin for 1 hour, repeated three times. 5) Embedding: The tissue blocks were placed in liquid paraffin and hardened before trimming. 6) Sectioning and Baking: Using a Leica RM2245 microtome, continuous 5μm thick paraffin sections were cut from the embedded low-temperature paraffin blocks. After spreading in a 40°C water bath, the sections were transferred to glass slides. The slides were then dried in a 60°C oven for 1 hour and then baked in a 60°C oven for 2 hours to prevent sample detachment. 7) Dewaxing and Hydration: After baking, dewax the slides three times with xylene, then rehydrate with graded ethanol to replace the xylene in the tissue. Rinse with distilled water. 8) HE Staining: Stain with hematoxylin for 1 minute, then rinse with distilled water. Immerse in hydrochloric acid ethanol for 30 seconds, then rinse with distilled water. Stain with eosin for 1 minute, then rinse with distilled water. The staining time can be adjusted according to the staining depth. 9) Dehydration and Clearing: Dehydrate using graded ethanol and clear with xylene three times. 10) Mounting and Imaging: After mounting with neutral resin, the slides can be used to assess the degree of renal tubular damage. Imaging is performed using a Leica DM4000 B advanced upright microscope.
[0128] 10. Immunohistochemistry
[0129] The preparation of paraffin slides in immunohistochemistry is the same as steps (1-7) in HE staining, and will not be repeated here. The remaining steps are as follows: 1) Antigen retrieval: Transfer the sample from step 7 above into heated citrate buffer, boil it in an autoclave, and expose the antigen sites through high pressure. 2) Inactivation: After defining the boundary with an immunohistochemical pen, incubate with 3% H2O2 at room temperature for 10 minutes to consume the peroxidase in the tissue. 3) Blocking: After rinsing with PBS, block with sheep serum. 4) Incubation with primary antibody: Add primary antibody prepared with sheep serum and incubate overnight at 4°C. 5) Incubation with secondary antibody: After washing with PBS, add secondary antibody and incubate in the dark for 1 hour. 6) DAB staining: After washing with PBS, add diluted DAB staining solution. When the target tissue turns brown and the background shows no staining, immediately wash with PBS to stop the staining process. 7) Counterstaining: Soak in hematoxylin for 30 seconds, rinse with distilled water. Soak in 10% hydrochloric acid ethanol, rinse with distilled water to return to blue. 8) Dehydration: Dehydrate using gradient alcohol and clear with xylene three times. 9) Mounting: Mount with neutral resin before imaging.
[0130] 11. Separation of primary renal tubules
[0131] 1) An eight-week-old C57BL / 6J mouse was euthanized by cervical dislocation. The abdomen was opened, and both kidneys were removed. After cleaning with HBSS, the kidneys were placed on autoclaved gauze. The transparent capsule on the outer surface of the kidney was peeled off using pointed forceps, and the kidney pedicle was removed. The kidney was cut in half along the largest section. The renal medulla, which was a different color from the renal cortex, was removed using curved scissors. The renal cortex was transferred into an Eppendorf tube, and pre-cooled tissue separation buffer (10 mM glucose, 5 mM glycine, 1 mM alanine, 15 mM Hepes buffer (pH=7.4), and HBSS to a final volume) was added. The mixture was then cut into small pieces of about 1 cubic millimeter and transferred to a 15 mL centrifuge tube. 2) Centrifuge at 800 rpm and 4°C for 1 minute, and carefully discard the supernatant. 3) Add 5 mL of collagenase (1 mg / mL) and digest at 37°C for 15 minutes, mixing gently during digestion. Vigorous agitation and over-digestion can lead to the fragmentation and breakage of renal tubules, making it difficult to obtain high-quality tubules. 4) Add 5 mL of F12 medium (10% FBS) to finish digestion. 5) Centrifuge at 800 rpm and 4°C for 1 minute, and gently aspirate the supernatant. 6) Resuspend in 5 mL of HBSS, transfer to an 80-mesh sieve (pre-washed), and collect the filtrate (containing renal tubules). 7) Lightly grind the tissue fragments on the sieve, rinse the sieve with HBSS, and collect the filtrate (containing renal tubules). 8) Gently drop the filtrate collected in steps 9 and 10 onto a 150-mesh sieve (pre-washed). At this point, the renal tubules are trapped above the sieve. Collecting the filtrate and passing it through the sieve again can improve the yield. 9) Invert the 150-mesh sieve onto a 50 mL centrifuge tube, and rinse the renal tubules from the bottom of the sieve into the 50 mL centrifuge tube with preheated HBSS. 10) Centrifuge at 800 rpm, 4°C for 2 minutes. Wash once with HBSS. 11) Resuspend in F12 medium containing 1% serum, then inoculate into small dishes with a glass bottom for microinjection and imaging.
[0132] 12. Microinjection
[0133] 1) Seed tumor cells or renal tubules in a small dish with a glass bottom. Once they adhere to the dish, microinjection can be performed using a Leica AM6000 microscope and the right arm of an Eppendorf FemtoJet 4i micromanipulator. 2) Locate the tumor cells or renal tubules to be injected under a 10× microscope and center them in the field of view. Lower a freshly prepared glass needle tip (approximately 2 μm in diameter) below the liquid surface using the micromanipulator, approaching but not touching the target. 3) Raise the objective lens to 20×, adjust the focal plane, and center the target in the field of view. Continue lowering the glass needle tip, again approaching but not touching the target. 4) Raise the objective lens to 40×, adjust the focal plane, and move the needle tip directly above the target injection site. Quickly lower the needle tip to pierce the target injection site and inject immediately. pi = 100 hPa, ti = 0.5 s, pc = 10 hPa. During microinjection, the needle tip should land in the cytoplasm. When microinjecting renal tubules, the needle tip should be inserted into the renal epithelial cells or the lumen. Avoid letting the needle tip touch the bottom of the glass dish. After injection, remove the glass needle from the liquid surface, and then microscopic imaging can be performed.
[0134] 13. Renal ischemia-reperfusion
[0135] 1) Eight-week-old C57BL / 6J mice were intraperitoneally injected with ML225 (10 mg / kg) or its control, once daily for one week. Surgery was performed 24 hours after the injection. Ferrostatin-1 (5 mg / kg) was administered 2 hours before ischemia-reperfusion. 2) After anesthetizing the mice with tribromoethanol (200 mg / kg) intraperitoneally, surgery was performed. 3) After fixing the limbs of the mice, the skin on the lateral side of the right kidney on the abdomen was shaved and disinfected. 4) A 1 cm incision was made at this site, and the right kidney, renal artery, and renal vein were located and clamped with a large microscopic hemostatic clamp. After clamping, the kidney could be seen to change from pink to dark red immediately. 5) After 30 minutes of ischemia, the hemostatic clamp was removed, and the kidney color was seen to quickly return to pink, indicating successful blood reperfusion. The wound was sutured with 6-0 silk suture and the mouse was transferred to a heating pad to restore its body temperature. 6) 24 hours after ischemia-reperfusion, the mice were euthanized by cervical dislocation, and the right renal cortex was dissected for testing.
[0136] 14. In vivo imaging of mouse kidneys
[0137] 1) Anesthetize and immobilize the mouse, and remove hair and disinfect the skin on the lateral side of the left kidney on its back. 2) Make a 1cm incision on the skin on the lateral side of the left kidney on its back, and clamp the left renal artery and vein with a hemostatic clip, inducing ischemia for 30 minutes. Remove the hemostatic clip to restore renal blood flow reperfusion. 3) Suture the inner and outer layers of skin at the edge of the incision together with 3-0 silk suture to form a wound ring. Insert a peptide ring into the wound ring and secure it to the skin by tightening the suture. 4) Attach a circular coverslip to the outside of the peptide ring with neutral resin. Place the mouse on a heating pad to restore body temperature. 5) In vivo imaging of the mouse kidney can be performed 24 hours after reperfusion. 6) Before in vivo imaging, anesthetize the mouse by intraperitoneal injection of tribromoethanol. Fix the peptide ring on the mouse's back to the mouse adapter. Adjust the height of the adapter so that the coverslip is horizontal. 7) Calcein (2 mg / kg) and propidium iodide (0.5 mg / kg) were administered via intravenous injection around the eyes of mice to indicate live and dead cells, respectively. 8) The proportion of cell death in mouse renal tubules was observed using an Olympus FV1200MPE two-photon microscope at 25× magnification. The excitation wavelength was 835 nm (10% laser transmittance), the receiving wavelength for calcein was 495–540 nm, and the receiving wavelength for propidium iodide was 575–630 nm.
[0138] 15. Preparation and purification of wild-type human recombinant PAFAH2 protein, human recombinant PAFAH2 protein with single-point mutation at enzyme active site, and human recombinant PAFAH2 protein with triple-point mutation at enzyme active site.
[0139] 1) The sequence information of the human PAFAH2 gene was obtained according to NCBI Gene ID: 5051. It was amplified by PCR and cloned into the His-tagged eukaryotic plasmid vector pcDNA3.1 (honorgene, HG-VPI0282) to obtain the wild-type plasmid PAFAH2-WT (the wild-type plasmid PAFAH2-WT is obtained by ligating the DNA molecule shown in SEQ ID No. 2 into the eukaryotic plasmid vector pcDNA3.1; this plasmid can express the wild-type human recombinant PAFAH2 protein shown in SEQ ID No. 1). Based on this wild-type plasmid, a single-point mutant plasmid PAFAH2-S236A and a three-point mutant plasmid PAFAH2-3 (PAFAH2-S236A / D259A / H314A) were constructed. 2) These plasmids were transfected into HEK 293F cells (density 1×10⁻⁶). 6The cells were cultured at 37℃, 120 rpm, and 5% CO2 for 48 h, then centrifuged at 1500 rpm for 15 min. The supernatant was discarded, and the cell pellet was collected. 3) The cell pellet was resuspended in buffer I (300 mM NaCl, 50 mM Tris, pH 8.5) with a protease inhibitor, and then the cells were lysed in a high-pressure cell disruptor (4℃) to obtain the lysate. 4) The lysate was centrifuged at 18,000 rpm and 4℃ for 40 min to obtain a supernatant containing the target protein after removing cell debris. This supernatant was first subjected to affinity adsorption with Ni-NTA silicone resin, and then eluted with buffer II (300 mM NaCl, 300 mM imidazole, 50 mM Tris, pH 8.5) to obtain the human recombinant PAFAH2 protein. 5) The human recombinant PAFAH2 protein was filtered through a 0.22 μm filter membrane for sterilization and stored at -80℃.
[0140] Example 1: Platelet-activating factor and its phospholipid analogues induce ferroptosis in cells.
[0141] Ferroptosis is a cell death caused by the accumulation of iron-dependent lipid peroxidation. Lipid peroxidation refers to the oxidation reaction of lipids with free radicals, but not all lipids are easily oxidized. Polyunsaturated fatty acids (PUFAs) containing diallyl C-H bonds have lower bond dissociation energies and are therefore more susceptible to hydrogen loss and lipid peroxidation. The esterification of PUFAs to form phospholipids requires the acylation of fatty acids catalyzed by acyl-CoA synthetase long-chain member 4 (ACSL4) and the transfer of the acylated fatty acids to lysophosphatidylcholine acyltransferase (LPCAT3) catalyzed by acylation. Studies have shown that arachidonic acid (AA) and adrenaline (AdA) esterified at the sn-2 position of phosphatidylethanolamine are the most important substrates for lipid peroxidation during feroptosis. They are oxidized and catalyzed by lipoxygenases (LOXs) and oxidoreductases (POR, CYB5R1) to become lipid peroxides. Oxidoreductase-catalyzed lipid peroxidation can promote the rupture of liposome membranes containing polyunsaturated fatty acids.
[0142] When phospholipid peroxides are further attacked by secondary free radicals, they produce oxidized truncated phospholipids. Phospholipid peroxides tend to break near the first and last olefinic bonds of esterified polyunsaturated fatty acids, producing sn-2 truncated phospholipids. These oxidized truncated phospholipids are structurally similar to platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine, PAF) and possess similar platelet-activating factor activity; therefore, they are also called platelet-activating factor-like phospholipids (platelet-activating factor-LPLs).
[0143] The inventors of this application treated cells (HK2, HT1080, or HUVEC cell lines) with various types of platelet activating factors, and found that cell viability was significantly affected. Figure 1 AC). Only the inhibitors of ferroptosis, Fer-1 and DFO, can inhibit cell death induced by platelet-activating factor (AC). Figure 1 D). In addition, platelet activating factor also leads to mitochondrial membrane shrinkage, increased lipid peroxidation, and upregulation of ferroptosis marker genes PTGS2 and CHAC1, which are hallmark features of ferroptosis. Figure 1 EH). The inventors of this application further verified whether the most representative oxidatively truncated phospholipids possess similar characteristics. The results also showed that the cell viability decrease caused by oxidatively truncated phospholipids PGPC and POVPC could also be inhibited by Fer-1 ( Figure 1 I,J). In addition, the inventors of this application isolated renal tubules from mouse kidneys and treated the freshly isolated primary renal tubules with platelet-activating factor. The results showed that platelet-activating factor-induced renal tubular cell death could also be inhibited by Fer-1 and DFO (…). Figure 1 Therefore, the inventors of this application have demonstrated that platelet-activating factor and its phospholipid-like components can induce ferroptosis in cells.
[0144] Example 2: Platelet-activating factor directly leads to increased membrane permeability
[0145] Platelet-activating factor (PAF), a special type of phosphatidylcholine, contains a short-chain acetyl group at its sn-2 position, rather than a long-chain fatty acid chain. Therefore, PAF's spatial conformation and properties differ from traditional phosphatidylcholine. PAF's head-to-body ratio is greater than that of phosphatidylcholine, which may promote an increase in the curvature of the phospholipid bilayer membrane, altering the structure and properties of the biological membrane. The inventors of this application hypothesize that during ferroptosis, the peroxidation of PE-PUFA on the biological membrane produces oxidized truncated phospholipids that can cause localized damage to the membrane phospholipid structure within a small area.
[0146] To further explore the specific mechanism by which platelet-activating factor (PAF) and its phospholipid-like molecules induce ferroptosis, the inventors of this application constructed liposomes containing different ratios of PAF or PGPC. Each liposome contained uniformly dispersed NBD-PE in both its inner and outer membranes. Upon addition of the reducing agent sodium dithionite, the NBD fluorescence in the outer phospholipid molecules of the structurally intact liposomes was quenched by sodium dithionite. Figure 2 A). However, after adding platelet-activating factor to liposomes, the permeability-damaged phospholipid bilayer cannot prevent sodium dithionite from entering the liposome interior, and the NBD fluorescence in the inner lobules is also quenched. Figure 2B). This in vitro simulation experiment showed that platelet activating factor and PGPC promote increased liposome membrane permeability (B). Figure 2 (C,D) The increased platelet-activating factor and LPLs during ferroptosis may be the cause of cell membrane rupture.
[0147] Example 3: Platelet-activating factor propagates ferroptosis in cell populations
[0148] Unlike cell death caused by apoptosis, necroptosis, and autophagy, ferroptosis exhibits a unique wave-like spatiotemporal propagation pattern within a cell population, rather than a random death pattern. Ferropeptidating cells can induce ferroptosis in neighboring cells, and this process occurs before cell membrane rupture. This means that feropeptidating cells secrete propagation factors, leading to ferroptosis in neighboring cells.
[0149] The inventors of this application used ELISA to detect changes in platelet activating factor in HT1080 cells. The results showed that RSL3 treatment promoted an increase in platelet activating factor in the cell culture medium. Figure 3 A). This indicates that during ferroptosis, intracellular platelet-activating factor (PAF) is secreted extracellularly. PAF is a potent lipid mediator that is secreted extracellularly and exerts its lipid mediator function by binding to PAF receptors on adjacent cell membranes. However, knockdown of PAF R does not block PAF-induced cell death. Figure 3 B). This indicates that during ferroptosis, cell death caused by the burst of platelet-activating factors (LPFs) or LPLs does not occur through the activation of platelet-activating factor R (PFR). This may be because oxidized truncated phospholipids are not effective substrates for PFR. The inventors of this application hypothesize that after oxidized phospholipids are attacked by free radicals, LPLs rapidly accumulate in a small area on the membrane, causing damage to the membrane structure and thus leading to ferroptosis. Furthermore, the inventors of this application further verified this using antagonists of PFR. The results showed that the antagonists of PFR, WEB2086 or Ginkgolide B, also failed to inhibit PFR-induced ferroptosis. Figure 3 C). This indicates that platelet-activating factor R (LPFR) does not participate in the regulation of ferroptosis, and LPF-induced ferroptosis occurs through a LPFR-independent mechanism. After synthesis, LPFRs are secreted extracellularly by cells, a process that relies on acid sphingomyelinase. Once mobilized, the acid sphingomyelinase translocates from lysosomes to the extracellular lobules, promoting changes in plasma membrane structure and fluidity, and facilitating budding and the release of microvesicle granules. Imipramine, an inhibitor of acid sphingomyelinase, significantly inhibits LPFC16-induced ferroptosis. Figure 3D). Activator proteins are crucial for the formation of clathrin-coated vesicles during endocytosis. The inhibitor Dynasore, a activator protein, also significantly inhibits platelet-activating factor C16-induced ferroptosis. Figure 3 (E) This indicates that the increased intracellular platelet-activating factor during ferroptosis is secreted via paracrine signaling. This exosome is then endocytosed by the receptor cell, promoting the spread of ferroptosis within the cell population. In summary, intracellular platelet-activating factors and LPLs produced during ferroptosis promote the propagation of ferroptosis within the cell population through exocytosis and endocytosis, rather than through downstream signaling mediated by the platelet-activating factor receptor.
[0150] To verify that platelet-activating factor (PAF) is a propagating factor of ferroptosis, the inventors of this application injected exogenous PPF C16 into the cytoplasm of several cells using micromanipulation techniques, thereby controlling the stimulation of PPF within a small area of these cells. Fluorescence microscopy imaging showed that the microinjected cells died rapidly. After a period of time, cells near these dead cells began to die gradually, exhibiting a spatiotemporal pattern of propagation. Figure 3 F, G). This indicates that ferroptosis induced by platelet-activating factor (PAF) can induce ferroptosis in surrounding cells, and PAF may act as a lethal factor in this cell death, spreading ferroptosis between cells. Furthermore, the inventors of this application verified the ability of PAF to spread ferroptosis using a commercially available PAF neutralizing antibody (PAF Ab). The results showed that PAF Ab significantly inhibited RSL3-induced cell death (F, G). Figure 3 (H, I). This indicates that RSL3 treatment increases intracellular platelet-activating factor (PAF) and its secretion into the extracellular environment. However, PAF Ab added to the culture medium cannot effectively enter the cell; instead, it binds to PAF in the culture medium, inhibiting cell damage caused by PAF propagation. This also demonstrates PAF's function as a ferroptosis propagation factor.
[0151] Renal tubules are tissues sensitive to ferroptosis. The inventors of this application isolated mouse renal tubules to verify the viewpoint that platelet-activating factor (PAF) acts as a ferroptosis propagation factor. The specific method is as follows: PAF C16 or its control (green) was injected into one end of a primary renal tubule, and PAF Ab or IgG (blue) was injected into the other end. The results showed that PAF promoted primary renal tubular cell death, and this cell death exhibited a synchronized death pattern. PAF-induced primary renal tubular cell death could be inhibited by the injected PAF Ab, but not by IgG. Figure 3(J,K). In summary, during ferroptosis, platelet-activating factor (LPF) and LPLs significantly increase in cells. Cells can secrete LPLs extracellularly, promoting ferroptosis in a LPF-independent manner. Inhibition of exocytosis and endocytosis effectively suppresses ferroptosis. LPL neutralizing antibodies added intracellularly or in the extracellular environment also effectively inhibit ferroptosis. This indicates that LPLs possess the characteristics and functions of ferroptosis propagation factors.
[0152] Example 4: Platelet-activating factor acetylhydrolase 2 (PAFAH2) has the function of resisting ferroptosis.
[0153] PAFAH2 is a highly conserved protein, primarily expressed in the proximal and distal tubules of the kidney, small intestinal epithelial cells, hepatocytes, and skin cells. PAFAH2 specifically hydrolyzes platelet-activating factor and oxidized truncated phospholipids, but not the long-chain fatty acyl groups on phospholipids. The inventors of this application treated PAFAH2-knockdown HT1080 cells and control cells with a concentration gradient of RSL3, and found that PAFAH2 knockdown significantly increased the sensitivity of cells to RSL3. Figure 4 A). This indicates that PAFAH2 can protect cells against ferroptosis. To further confirm the ferroptosis-resistant function of PAFAH2, the inventors constructed a PAFAH2 knockout HT1080 monoclonal cell line. First, the inventors verified the efficiency of gene knockout and the response of the PAFAH2 knockout HT1080 cell line to ferroptosis inducers at the protein level. The inventors used propidium iodide (PI) staining to indicate dead cells and analyzed the proportion of cell death using flow cytometry and microscopic imaging techniques. Figure 4 B and Figure 4 As shown in Figure C, the PAFAH2 knockout cell line showed a significantly increased sensitivity to RSL3 compared to its control cell line. Furthermore, the inventors of this application treated PAFAH2 knockout cells and their control cells with a concentration gradient of RSL3, and the cell survival rate was detected using CCK8 assay. Figure 4 D). Further verification confirmed that PAFAH2 knockout significantly increased the sensitivity of cells to ferroptosis. In addition to targeting and inactivating GPX4 with RSL3, the inventors of this application also used the Class I ferroptosis inducers Erastin and Sorafenib to inhibit the activity of SLC7A11, thereby blocking cystine supply and glutathione synthesis. The results showed that the PAFAH2 knockout cell line was significantly more sensitive to Erastin and Sorafenib than its control cell line ( Figure 4E, F). Furthermore, the inventors of this application also used the apoptosis inducer staurosporine to detect whether PAFAH2 knockout HT1080 cells participated in the regulation of apoptosis. The results showed that PAFAH2 knockout cells did not exhibit a significant difference in response to the apoptosis inducer compared to their control cells. Figure 4 G). In summary, PAFAH2 knockout cells showed a significant decrease in their ability to resist ferroptosis, further validating the role of PAFAH2 in protecting cells against ferroptosis.
[0154] A key characteristic distinguishing ferroptosis from other forms of cell death is the significant accumulation of lipid peroxidation. Lipophilic antioxidants, free radical scavengers, and iron chelators effectively inhibit ferroptosis but not other forms of cell death. To further verify that PAFAH2 knockout-promoted cell death is ferroptosis, the inventors employed various cell death inhibitors. The results showed that PAFAH2 knockout-promoted cell death could be blocked by ferroptosis inhibitors such as Fer-1 or DFO, but not by inhibitors of other cell death forms such as Z-VAD-FMK or Nec-1. Figure 4 H). This indicates that PAFAH2 knockout promotes ferroptosis. The lipid peroxidation dye BODIPY 581 / 591C11 is a reliable indicator for identifying ferroptosis. This dye renders non-oxidized lipids red (emission peak at 590 nm) and oxidized lipids green (emission peak at 510 nm). The intensity of the green fluorescence signal indicates the abundance of intracellular lipid peroxidation. The results show that the PAFAH2 knockout cell line itself does not exhibit significant changes in lipid peroxidation, but upon stimulation with ferroptosis, the level of intracellular lipid peroxidation increases dramatically. Figure 4 I). Under the same treatment conditions, only a small number of cells in the control group showed weak lipid peroxidation signals.
[0155] Studies have shown that ML225 specifically inhibits PAFAH2 by carbamylation of serine (S236) at the active site of PAFAH2. Therefore, the inventors of this application further verified PAFAH2's function in ferroptosis by inhibiting it at the pharmacological level. The results showed that pretreatment with ML225 to selectively inhibit PAFAH2 led to a sharp increase in cell sensitivity to ferroptosis. Figure 4 JL). In addition, the inventors of this application also examined the effect of ML225 on lipid peroxidation. The results showed that ML225 treatment alone did not affect the level of intracellular lipid peroxidation. However, ML225 pretreatment significantly increased RSL3-induced lipid peroxidation, and ML225-promoted lipid peroxidation could be completely inhibited by inhibitors of ferroptosis. Figure 4In summary, through the regulation of PAFAH2 at both the gene and drug levels, the inventors of this application have discovered that, as phospholipase A2, PAFAH2 can resist oxidative damage caused by various ferroptosis inducers and protect various cell lines against lipid peroxidation and ferroptosis.
[0156] Example 5: Renal ischemia-reperfusion leads to ferroptosis in renal tubular epithelial cells.
[0157] During renal ischemia-reperfusion (I / R), lipid peroxidation accumulates, leading to elevated levels of the secondary product malondialdehyde (MDA). Ferrostatins and Liproxstatins, inhibitors of ferroptosis, can alleviate severe renal I / R injury. Furthermore, knockout of the core ferroptosis-resistant protein GPX4 leads to ferroptosis in renal tubular cells and acute kidney injury. This indicates that ferroptosis is activated during ischemia-reperfusion injury.
[0158] The inventors of this application used C57BL / 6J mice to induce ischemia-reperfusion injury in the right kidney. Mice whose abdominal cavities were opened to expose the kidneys but not subjected to ischemia were used as a sham-operated group. First, the inventors measured the transcriptional levels of the ferroptosis marker genes PTGS2 and CHAC1 at different time points after ischemia-reperfusion. The results showed that within 48 hours after ischemia-reperfusion, the transcriptional levels of the ferroptosis marker genes PTGS2 and CHAC1 significantly increased, reaching a peak at 24 hours. Figure 5 (A, B). In addition, the inventors of this application examined changes in key proteins of ferroptosis in the renal cortex. The results showed that the protein levels of transferrin TFR1 and SLC7A11 were also significantly increased ( Figure 5 (C) This may be a stress response of cells to ferroptosis stimuli. However, the protein level of GPX4 was slightly decreased. This indicates that ferroptosis occurs in renal tubular cells during renal ischemia-reperfusion injury.
[0159] In addition, the inventors of this application also used hematoxylin and eosin staining and blood urea nitrogen detection to analyze the damage after renal tubular ischemia-reperfusion, and detected the changes in serum urea nitrogen levels in mice after renal ischemia-reperfusion. The results showed that renal ischemia-reperfusion leads to characteristic features of renal injury, such as increased tubular lumen, disappearance of brush borders, nucleus detachment into the lumen, and increased serum urea nitrogen levels. Pretreatment with the ferroptosis inhibitor Fer-1 significantly alleviated these phenotypes. Figure 5D, E). 4-Hydroxyrenic acid (4-HNO3) is a secondary product of lipid peroxidation, and its increase is considered an important characteristic of ferroptosis at the tissue level. Increased protein levels of transferrin TFR1 and lipoxygenase COX2 also indicate increased ferroptosis. Immunohistochemical analysis of 4-HNO3, transferrin receptor, and lipoxygenase levels revealed that ischemia-reperfusion leads to increased levels of these ferroptosis markers, and pretreatment with the ferroptosis inhibitor Fer-1 significantly alleviated these phenotypes. Figure 5 E). This indicates that ischemia-reperfusion leads to ferroptosis in renal tubular cells.
[0160] The inventors of this application used immunohistochemistry and Western blotting to detect changes in PAFAH2 protein levels within 48 hours of ischemia-reperfusion injury. The results showed that PAFAH2 protein levels increased sharply after 6 hours of ischemia-reperfusion. High PAFAH2 levels were maintained until 24 hours post-reperfusion. However, they significantly decreased again at 48 hours post-reperfusion. Figure 5 (FH). The inventors of this application believe that the increase in PAFAH2 protein levels after renal ischemia-reperfusion is due to damage to renal tubular cells, and PAFAH2 upregulates its protein levels through an adaptive response mechanism to resist oxidative stress. This suggests that PAFAH2 may participate in regulating renal ischemia-reperfusion injury by inhibiting ferroptosis.
[0161] Example 6: Inhibition of PAFAH2 with ML225 exacerbates acute kidney injury caused by renal ischemia-reperfusion.
[0162] The inventors of this application demonstrated the role of PAFAH2 in renal ischemia-reperfusion injury by intraperitoneally injecting C57BL / 6J mice with ML225 for three consecutive days to inhibit PAFAH2. Hematoxylin-eosin staining showed that during ischemia-reperfusion injury, renal tubules exhibited luminal dilation, loss of the brush border, and flattening or sloughing of epithelial cells. After PAFAH2 inhibition, subsequent ischemia-reperfusion injury significantly increased renal tubular damage. Figure 6 (A, B). ML225-induced renal tubular injury could be effectively alleviated by the ferroptosis inhibitor Fer-1. This indicates that PAFAH2 inhibits renal ischemia-reperfusion injury in a ferroptosis-dependent manner. In addition, the inventors of this application also detected changes in key ferroptosis markers using immunohistochemical staining. MLL25 treatment significantly promoted the staining of 4-hydroxyrenenoic acid, transferrin receptor, and lipoxygenase induced by ischemia-reperfusion (…). Figure 6(A, CE). This indicates that ML225 significantly promotes ferroptosis in renal tubular cells during renal ischemia-reperfusion, exacerbating ischemia-reperfusion injury. Mitochondrial morphological changes are also a key characteristic of ferroptosis. Electron microscopy imaging shows that ischemia-reperfusion leads to mitochondrial fragmentation in renal tubular cells. Inhibition of PAFAH2 further aggravates the degree of mitochondrial fragmentation and membrane density (A, CE). Figure 6 A,G).
[0163] To further verify the resistance of PAFAH2 to renal ischemia-reperfusion injury, the inventors of this application used two-photon in vivo imaging technology to detect the death of renal tubular cells after ischemia-reperfusion. An incision was made externally to the left kidney of a mouse, supported by a peptide ring, and a coverslip was placed on the skin to perform in vivo imaging of the mouse kidney 24 hours after ischemia-reperfusion. Prior to in vivo imaging, calcein and propidium iodide were injected intravenously, and imaging was completed within 30 minutes. Two-photon microscopy in vivo imaging results showed that, 24 hours after 30 minutes of ischemia and reperfusion, a small number of renal tubular cells showed strong propidium iodide staining, while other renal tubules only showed strong calcein staining. Figure 6 H,I). On the one hand, this indicates that calcein and propidium iodide can distinguish between living and dead renal tubular cells in vivo. On the other hand, it demonstrates that renal tubular cell death has a synchronized characteristic. The death of renal tubular cells exhibits a non-random distribution pattern, but rather aggregates in damaged renal tubules. Often, all cells in damaged renal tubules show strong propidium iodide staining. ML225 leads to a significant increase in propidium iodide-stained renal tubules, but a small portion of renal tubules remain unaffected ( Figure 6 (H,I). Fer-1 effectively inhibited ML225-induced renal tubular cell death. This indicates that PAFAH2 can effectively resist synchronized renal tubular cell death during ischemia-reperfusion injury.
[0164] In summary, PAFAH2 protein levels in the mouse renal cortex exhibit a stress-response pattern during ischemia-reperfusion injury. Drug inhibition of PAFAH2 exacerbated renal tubular ischemia-reperfusion injury, significantly increasing renal tubular ferroptosis markers and synchronized cell death. This demonstrates that PAFAH2 counteracts renal ischemia-reperfusion injury by inhibiting ferroptosis, providing a novel therapeutic approach for acute kidney injury.
[0165] Example 7: Knockout of PAFAH2 exacerbates renal tubular cell ferroptosis and acute kidney injury caused by renal ischemia-reperfusion.
[0166] To further verify the role of PAFAH2 in ischemia-reperfusion, the inventors of this application constructed PAFAH2 knockout mice. Wild-type and PAFAH2 knockout mice underwent ischemia-reperfusion surgery, and renal tubular damage was analyzed using hematoxylin and eosin staining and serum urea nitrogen detection. The results showed that, compared to wild-type mice, PAFAH2 knockout mice exhibited more severe kidney damage after ischemia-reperfusion treatment. Figure 7 Immunohistochemical analysis of platelet-activating factor (PAF) levels revealed that PAFAH2 knockout mice exhibited higher levels of PPF after ischemia-reperfusion (Figures A and E). Since PPF can induce ferroptosis in cells and in vitro purified renal tubules, the inventors used two-photon microscopy to in situ detect renal tubular cell death in PAFAH2 knockout mice after ischemia-reperfusion. The results showed that, compared to wild-type mice, PAFAH2 knockout mice exhibited more cell death after ischemia-reperfusion (AD). Figure 7 FH).
[0167] In addition, the inventors of this application also used immunohistochemical staining to analyze changes in key markers of ferroptosis. Compared to wild-type mice, PAFAH2 knockout mice showed higher levels of 4-hydroxyrenenoic acid, transferrin receptor, and lipoxygenase signaling in the renal tubules after renal ischemia-reperfusion. Figure 7 I,L). This indicates that PAFAH2 deficiency can significantly promote ferroptosis of renal tubular cells during renal ischemia-reperfusion, exacerbating ischemia-reperfusion injury.
[0168] In conclusion, PAFAH2 knockout mice exhibit more severe acute kidney injury and renal tubular cell ferroptosis when subjected to ischemia-reperfusion stimulation, indicating that PAFAH2 has the ability to resist ischemia-reperfusion injury.
[0169] Example 8: Intravenous injection of recombinant PAFAH2 protein helps mice resist ischemia-reperfusion-induced ferroptosis and kidney injury. I. Verification of the ability of in vitro purified human recombinant PAFAH2 protein to resist ferroptosis at the in vitro cellular level.
[0170] The inventors of this application added bovine serum albumin solution, wild-type human recombinant PAFAH2 protein (PAFAH2-WT) solution, and single-point mutation of enzyme active site human recombinant PAFAH2 protein (PAFAH2-S236A) solution to HT1080 cell culture medium. The solvent for each protein solution was a buffer containing 300 mM NaCl and 50 mM Tris (pH 8.5). The final concentration of each protein in the cell culture medium was 0.08 mg / mL. HT1080 cells were then treated with RSL3 to induce ferroptosis, with the RSL3 concentration in the cell culture medium being 0.2 μM. The results showed that the addition of wild-type human recombinant PAFAH2 protein significantly inhibited RSL3-induced ferroptosis. Figure 8 A, B) This means that when cells undergo ferroptosis, platelet-activating factor and its phospholipid-like substances are secreted into the extracellular culture medium, and PAFAH2 inhibits their spread in the cell population by hydrolyzing platelet-activating factor and its phospholipid-like substances in the culture medium.
[0171] II. Verifying the ability of in vitro purified human recombinant PAFAH2 protein to resist ischemia-reperfusion-induced kidney injury in in vivo animal models.
[0172] The inventors of this application used microsurgical hemostatic clips to induce 30 minutes of ischemia in the left kidney of C57BL / 6J mice. During the ischemia period, 15 minutes before reperfusion, wild-type human recombinant PAFAH2 protein solution (PAFAH2-WT), single-point mutation human recombinant PAFAH2 protein solution (PAFAH2-S236A), and triple-point mutation human recombinant PAFAH2 protein solution (PAFAH2-S236A / D259A / H314A, abbreviated as PAFAH2-3A) were injected intravenously. The concentration of each protein solution was 2 mg / mL, and the injection dose was 20 mg / kg. After 30 minutes of ischemia, the hemostatic clips were removed to restore blood reperfusion. 24 hours after reperfusion, two-photon microscopy was used to detect the renal tubular cell death in each experimental group of mice after ischemia-reperfusion. The results showed that pre-reperfusion injection of wild-type human recombinant PAFAH2 protein significantly inhibited ferroptosis of renal tubular epithelial cells induced by renal ischemia-reperfusion. Figure 8 (C,D). This indicates that injecting PAFAH2 protein prior to reperfusion can block the damage to renal tubular epithelial cells caused by platelet-activating factor and its phospholipid-like components.
[0173] Furthermore, the inventors of this application used hematoxylin and eosin staining and serum urea nitrogen detection to analyze the damage to the renal tubules. The results showed that pre-reperfusion injection of wild-type human recombinant PAFAH2 protein significantly inhibited acute kidney injury caused by renal ischemia-reperfusion and the increase in serum urea nitrogen levels, while PAFAH2 protein with enzyme active site mutations did not have this effect. Figure 8 In addition, the inventors of this application also used immunohistochemical staining to analyze changes in key markers of ferroptosis. The results also showed that pre-reperfusion injection of wild-type human recombinant PAFAH2 protein significantly inhibited the increase in 4-hydroxyrenenoic acid, transferrin receptor, and lipoxygenase staining induced by renal ischemia-reperfusion. Figure 8 IK).
[0174] In summary, the in vitro purified human recombinant PAFAH2 protein resists ischemia-reperfusion injury by clearing platelet-activating factor and its phospholipid-like components induced by renal ischemia-reperfusion, thereby blocking the spread of ferroptosis among cell populations.
Claims
1. The use of PAFAH2 protein in the preparation of products for the prevention and / or treatment and / or inhibition of acute kidney injury caused by renal ischemia-reperfusion. The PAFAH2 protein is the protein shown in R1)-R2) below: R1) The amino acid sequence is that of the protein shown in SEQ ID No. 1; R2) A fusion protein with the same function is obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1).
2. The application according to claim 1, characterized in that: The PAFAH2 protein inhibits acute kidney injury caused by renal ischemia-reperfusion by suppressing ferroptosis induced by lipid peroxidation.
Citation Information
Patent Citations
Platelet-activating factor acetylhydrolase (PAF-AH) therapeutic uses
US6099836A