Synthesis method of three H1FX selective inhibitors and application of H1FX selective inhibitors in preparation of antitumor drugs

Abstract

The invention belongs to the technical field of biological medicines, and relates to a chemical preparation method of a novel compound and application of the novel compound as an H1FX inhibitor in preparation of prostatic cancer prevention and / or treatment medicines. The structure is novel, and the preparation method is simple. Experiments prove that the compounds provided by the invention can be selectively combined with H1FX, and can inhibit prostate cancer cell proliferation by inhibiting the biological function of H1FX combined with rDNA, so that the compounds are expected to become new anti-tumor drugs.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and relates to a synthesis method of three H1FX selective inhibitors and their application in the preparation of anti-tumor drugs. Background Art

[0002] Prostate cancer is a major disease with the second highest incidence of male malignant tumors in the world and the sixth highest incidence of male malignant tumors in China. With the increase of age, the incidence rate shows a rapid upward trend. Although the prognosis of early prostate cancer is good, there are currently no effective targets and therapeutic drugs for advanced prostate cancer in the clinic, and the median survival of patients after diagnosis is less than five years. Therefore, finding ideal therapeutic targets for prostate cancer and preparing effective therapeutic drugs based on the targets are urgent needs for the clinical treatment of prostate cancer. H1FX (H1.10, H1.X) is a variant of the linker histone H1, which is upregulated in a variety of tumors such as prostate cancer, and its high expression is associated with poor prognosis. Therefore, finding small molecule inhibitors targeting H1FX and inhibiting the malignantization of prostate cancer by interfering with the biological function of H1FX binding to DNA is of great significance for the treatment of advanced prostate cancer and the development of new anti-tumor drugs. At present, no inhibitors with sufficiently ideal effects have been reported for H1FX. Summary of the invention

[0003] In view of the technical problem that there is no sufficiently ideal inhibitor for H1FX at present, the present invention proposes three novel methods for synthesizing H1FX selective inhibitors and their application in anti-tumor drugs.

[0004] In order to achieve the above object, the present invention is implemented by adopting the following technical solutions:

[0005] The present invention proposes three anti-tumor compounds used as H1FX selective inhibitors, and their structural formulas are as follows:

[0006] Compound CN25:

[0007] Compound CN27:

[0008] Compound CE7:

[0009] The synthetic route equation of compound CN25 is:

[0010]

[0011] The synthetic route equation of compound CN27 is:

[0012]

[0013] The synthetic route equation of compound CE7 is:

[0014]

[0015] The above three compounds can be used alone or in combination to act as H1FX selective inhibitors to exert anti-tumor function.

[0016] The present invention proposes the use of the above-mentioned compound or its enantiomers, diastereomers, racemates, pharmaceutically acceptable salts, pharmaceutically acceptable carriers and / or excipients, and mixtures thereof in the preparation of drugs for preventing and / or treating anti-tumor diseases, especially in the preparation of drugs for treating prostate cancer; and in the preparation of H1FX inhibitors.

[0017] Preferably, the above pharmaceutical composition contains 1-2000 mg of active ingredient per dose, more preferably, 10-200 mg of active ingredient per dose. The "one dose" is one tablet.

[0018] "Pharmaceutically acceptable salt" refers to a salt formed with any one of the following acids or a combination thereof: hydrochloric acid, sulfuric acid, phosphoric acid, hydrobromic acid, acetic acid, trifluoroacetic acid, pyruvic acid, citric acid, tartaric acid, lactic acid, maleic acid, benzenesulfonic acid or succinic acid, etc.

[0019] "Pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances, suitable for human use, and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the active ingredients of the present invention without significantly reducing the efficacy of the active ingredients. Pharmaceutically acceptable carriers include, for example, cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween) lubricants (such as sodium lauryl sulfate), colorants, flavorings, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0020] There is no particular limitation on the administration of the active ingredient or pharmaceutical composition of the present invention. Representative administration methods include, but are not limited to, oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous) administration, and the like.

[0021] The present invention conducts surface plasmon resonance (SPR) experiments on H1FX and target compounds, and the results show that the three compounds can selectively bind to H1FX. Through gel shift assay (EMSA) experimental analysis, it is found that the three compounds can significantly inhibit the biological function of H1FX binding to DNA. Through the detection of cell proliferation experiments, it is found that the three compounds can significantly inhibit the proliferation of prostate cancer cells. It shows that the three compounds selectively target H1FX and block its binding to DNA, thereby inhibiting the malignantization of prostate cancer.

[0022] Compared with the prior art, the advantages and positive effects of the present invention are:

[0023] The present invention proposes three novel H1FX selective inhibitors, which selectively bind to H1FX and block its binding to DNA, thereby inhibiting the proliferation of prostate cancer cells, providing new ideas and possibilities for the development of drugs for the prevention and / or treatment of prostate cancer. The three target compounds proposed in the present invention can achieve significant inhibition of the biological function of H1FX binding to DNA or tumor cell proliferation at low concentrations. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the hydrogen spectrum of compound CN25.

[0025] Figure 2 This is the hydrogen spectrum of compound CN27.

[0026] Figure 3 is the hydrogen spectrum of compound CE7.

[0027] Figure 4 The selective binding of three compounds (CN25, CN27 and CE7) to H1FX was analyzed for SPR experiments.

[0028] Figure 5 This is the result of EMSA experiment to detect the inhibition of H1FX binding to DNA by three compounds (CN25, CN27 and CE7) and a positive control compound D271-0003.

[0029] Figure 6 The IC values ​​of three compounds (CN25, CN27 and CE7) in 22Rv1, LNCaP and PC-3 cell lines are shown in Table 1. 50 Test result graph. DETAILED DESCRIPTION

[0030] In order to more clearly understand the above-mentioned purpose, features and advantages of the present invention, the present invention is further described below in conjunction with specific embodiments. It should be noted that the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

[0031] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways than those described herein. Therefore, the present invention is not limited to the specific embodiments of the following disclosure.

[0032] Example 1

[0033] This example provides a specific process for synthesizing compound CN25.

[0034] 1.00g of compound A1 (4-chloro-7H-pyrrolo[2,3-d]pyrimidine, CAS: 3680-69-1, purchased from Bidex Pharmaceuticals, item number: BD20480-10g) was weighed and dissolved in 40mL of dichloromethane, and 1.30g of triethylamine, 24mg of 4-dimethylaminopyridine and 1.36g of p-toluenesulfonyl chloride were added in sequence, and then stirred at room temperature for 0.5h at a stirring rate of 200rpm. After the reaction was completed, the reaction solution was diluted with 20mL of dichloromethane, washed with 150mL of deionized water and 150mL of 5% (v / v) citric acid aqueous solution in sequence, the organic phase was dried with 5g of anhydrous magnesium sulfate, filtered, and the filtrate was concentrated to about 20mL under reduced pressure, 5g of silica gel was added and mixed, and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 8) to obtain a white solid A2 (1.90g, yield 95%). The NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ8.82(s,1H),8.12(d,J=4.0Hz,1H),8.04(d,J=8.4Hz,2H),7.47(d,J=8.3Hz,2H),6.96(d,J=4.0Hz,1H),2.36(s,3H). ESI-MS,m / z=308.21[M+H] + .

[0035] 0.50g of compound A2 and 0.49g of methyl 4-aminomethylbenzoate hydrochloride were dissolved in 15mL of N,N-dimethylformamide, and then 0.63g of N,N-diisopropylethylamine was added, and the reaction was stirred at 85°C and 200rpm for 6h. After the reaction, the reaction solution was cooled to room temperature, poured into 150mL of deionized water, extracted with 50mL of ethyl acetate, the organic phase was dried with 5g of anhydrous magnesium sulfate, filtered, the filtrate was spin-dried, the residue was slurried with 7mL of ethyl acetate, the suspension was filtered, and the filter cake was vacuum dried to obtain a white solid A3 (0.69g, yield 98%). The NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6)δ8.51(t,J=6.0Hz,1H),8.22(s,1H),7.97(d,J=8.5Hz,2H),7.89(d,J=8.3Hz,2H),7.59(d,J=4.0Hz ,1H),7.43(d,J=8.0Hz,4H),6.91(d,J=4.0Hz,1H),4.75(d,J=6.0Hz,2H),3.82(s,3H),2.35(s,3H). ESI-MS, m / z=437.28[M+H] + .

[0036] 0.40g of compound A3 was dissolved in 12mL of a mixture of tetrahydrofuran, methanol and water in a volume ratio of 1:1:1, and 0.39g of lithium hydroxide monohydrate was added. The mixture was stirred at 60°C and 200rpm for 5h. After the reaction, the solvent was dried by spin drying, 2mL of deionized water was added, and the pH was adjusted to 5-6 with a 1M hydrochloric acid aqueous solution. A large amount of solid precipitated, which was filtered and the filter cake was vacuum dried to obtain a white solid A4 (0.25g, yield 100%), which was directly used in the next step. The NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ11.58(s,1H),8.08(s,1H),7.98(t,J=6.1Hz,1H),7.85(d,J=8.1Hz,2H),7.3 1(d,J=7.8Hz,2H),7.09–7.00(m,1H),6.64–6.55(m,1H),4.74(d,J=6.0Hz,2H). ESI-MS,m / z=269.31[M+H] + .

[0037] At 0°C, add 0.10g of compound A4 to 6mL of N,N-dimethylformamide, add 0.21g of 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate and 0.14g of N,N-diisopropylethylamine in turn, and stir at 0°C and 250rpm for 30min, then add 71mg of 4-fluoro-1,2-phenylenediamine, and stir at room temperature at 200rpm for 5h. After the reaction is complete, pour the reaction solution into 150mL of deionized water, extract with 20mL of ethyl acetate three times, combine the organic phases, wash with 100mL of saturated sodium chloride aqueous solution, dry with 5g of anhydrous magnesium sulfate, filter, and concentrate the filtrate under reduced pressure to about 15mL, and purify with silica gel column chromatography (dichloromethane / methanol=100 / 5) to obtain a white solid CN25 (0.10g, yield 72%). Figure 1 , the NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6)δ11.59(s,1H),9.54(s,1H),8.18–8.00(m,2H),7.92(d,J=7.9Hz,2H),7.45(d,J=7.9Hz,2H),7.17–7.02(m,2 H), 6.60 (s, 1H), 6.53 (dd, J = 11.2, 2.9Hz, 1H), 6.35 (td, J = 8.5, 2.9Hz, 1H), 5.22 (s, 2H), 4.78 (d, J = 6.1Hz, 2H). ESI-MS,m / z=377.43[M+H] + .

[0038] Example 2

[0039] This example provides a specific process for synthesizing compound CN27.

[0040] 1.50g of compound B1 (4-chloro-7H-pyrrolo[2,3-d]pyrimidine, CAS: 3680-69-1, purchased from Bid Pharmaceuticals, item number: BD20480-10g) was dissolved in 20mL of N,N-dimethylformamide, and 4.78g of cesium carbonate and 2.10g of iodomethane were added in sequence. The reaction was stirred at room temperature and 200rpm for 1h. After the reaction was completed, the reaction solution was poured into 200mL of deionized water, 50mL of ethyl acetate was added for extraction, 5g of anhydrous magnesium sulfate was added to the organic layer for drying, and the filtrate was spun dry. The residue was slurried with a mixture of 20mL of petroleum ether and ethyl acetate in a volume ratio of 10:1, and then filtered. The filter cake was vacuum dried to obtain 1.40g of a white solid compound, which was recorded as compound B2. After testing, the nuclear magnetic hydrogen spectrum data of compound B2 are as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ8.63(s,1H),7.73(d,J=3.5Hz,1H),6.63(d,J=3.6Hz,1H),3.85(s,3H). ESI-MS,m / z=168.02[M+H] + .

[0041] Weigh 0.47g of compound B2 and 0.85g of methyl 4-aminomethylbenzoate hydrochloride, dissolve in 20mL of isopropanol, then add 1.63g of N,N-diisopropylethylamine, reflux and stir at 85°C and 200rpm for 16h, and after the reaction, naturally cool the reaction solution to room temperature, spin dry the solvent, add 5mL of dichloromethane and methanol and mix well, and obtain 0.23g of white solid by silica gel column chromatography (volume ratio of petroleum ether and ethyl acetate 1:1), which is recorded as compound B3. After testing, the nuclear magnetic hydrogen spectrum of compound B3, the data are as follows: 1 H NMR (400 MHz, DMSO-d 6)δ8.16–8.04(m,2H),7.91(d,J=8.1Hz,2H),7.46(d,J=8.0Hz,2H),7.14(d,J=3. 4Hz, 1H), 6.59 (d, J = 3.4Hz, 1H), 4.79 (d, J = 6.1Hz, 2H), 3.83 (s, 3H), 3.70 (s, 3H). ESI-MS,m / z=297.23[M+H] + .

[0042] 0.23g of compound B3 obtained in the above step was dissolved in 12mL of a mixture of tetrahydrofuran, methanol and deionized water in a volume ratio of 1:1:1, and 0.33g of lithium hydroxide monohydrate was added. The mixture was stirred under reflux at 60°C and 200rpm for 1h. After the reaction, the solvent was dried by spin drying, 2mL of deionized water was added, and the pH was adjusted to 5-6 with a 1M hydrochloric acid aqueous solution. A large amount of solid precipitated, which was filtered and the filter cake was vacuum dried to obtain 0.22g of a white solid, which was recorded as compound B4. After testing, the H NMR spectrum data of compound B4 were as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ12.84(s,1H),8.35(s,1H),8.15(s,1H),7.89(d,J=8.2Hz,2H),7.44(d,J=8.0Hz,2 H), 7.18 (d, J = 3.4Hz, 1H), 6.65 (d, J = 3.4Hz, 1H), 4.80 (d, J = 6.1Hz, 2H), 3.71 (s, 3H). ESI-MS,m / z=283.30[M+H] + .

[0043] At 0°C, add 0.10g of compound B4 to 8mL of N,N-dimethylformamide, add 0.20g of 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate and 0.14g of N,N-diisopropylethylamine in turn, and stir the reaction at 0°C and 300rpm for 30min, then add 67mg of 4-fluoro-1,2-phenylenediamine, and stir the reaction at room temperature at 200rpm for 5h. After the reaction is completed, pour the reaction solution into 70mL of deionized water, extract with ethyl acetate 3 times, each time with 20mL, combine the organic phases, wash with 50mL of saturated sodium chloride aqueous solution, dry with 5g of anhydrous magnesium sulfate, filter, and concentrate the filtrate under reduced pressure to about 15mL, and purify it by silica gel column chromatography (the volume ratio of dichloromethane and methanol is 200:5) to obtain 80mg of white solid, which is the target compound, recorded as compound CN27. Figure 2 , the product NMR data are as follows: 1 H NMR (400 MHz, DMSO-d 6)δ9.54(s,1H),8.18–8.07(m,2H),7.91(d,J=7.9Hz,2H),7.43(d,J=8.0Hz,2H),7.15(d,J=3.5Hz,1H),7.09(dd,J=8.7,6.4Hz,1H) ,6.60(d,J=3.4Hz,1H),6.53(dd,J=11.3,2.9Hz,1H),6.35(td,J=8.5,2.9Hz,1H),5.22(s,2H),4.78(d,J=6.1Hz,2H),3.70(s,3H). ESI-MS,m / z=391.32[M+H] + .

[0044] Example 3

[0045] This example provides a specific process for synthesizing compound CE7.

[0046] 3.27g of compound C1 (p-methoxyaniline, CAS: 104-94-9, purchased from Shanghai MacLean Biochemical Technology Co., Ltd.), 3.11g of C2 (4-chlorobenzaldehyde, CAS: 104-88-1, purchased from Bidex Pharmaceuticals), 2.44g of C3 (sodium pyruvate, CAS: 113-24-6, purchased from Bidex Pharmaceuticals) were dissolved in 60mL of anhydrous ethanol, and then 1.85mL of concentrated hydrochloric acid was added and refluxed at 80°C for 30min at a speed of 250rpm. After the reaction was completed, the reaction solution was cooled to room temperature to produce a large amount of solids, which were filtered, and the filter cake was washed twice with 4mL of anhydrous ethanol and vacuum dried to obtain a brown solid C4 (3.20g, yield 46%). The NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ13.93(s,1H),8.45(s,1H),8.28(d,J=8.6Hz,2H),8.12(d,J=2.9Hz,1H),8.07( d, J=9.2Hz, 1H), 7.60 (d, J=8.6Hz, 2H), 7.52 (dd, J=9.2, 2.8Hz, 1H), 3.92 (s, 3H). ESI-MS,m / z=314.19[M+H] + .

[0047] At 0°C, 6 mL of N,N-dimethylformamide was added to 0.10 g of compound C4 to dissolve, 0.15 g of 1-[bis(dimethylamino)methylene]-1H-benzotriazolium 3-oxide tetrafluoroborate and 49 mg of triethylamine were added in sequence, and stirred at 0°C and 250 rpm for 30 min, then 56 mg of O-(tetrahydro-2H-pyran-2-yl)hydroxylamine was added, and the reaction was continued to stir at room temperature and 250 rpm for 2.5 h. After the reaction was completed, the reaction solution was poured into 150 mL of deionized water, extracted with 40 mL of ethyl acetate, the organic phase was washed with 100 mL of saturated sodium chloride aqueous solution, dried with 5 g of anhydrous magnesium sulfate, filtered, and the filtrate was concentrated to about 15 mL under reduced pressure, and purified by silica gel column chromatography (petroleum ether: ethyl acetate = 4:1) to obtain a light yellow solid C5 (50 mg, yield 38%). The NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ11.93(s,1H),8.30(d,J=8.3Hz,2H),8.14(s,1H),8.05(d,J=9.1Hz,1H),7.62(d,J=8.2Hz,2H),7.56–7.46(m,2H),5 .21(d,J=3.4Hz,1H),4.11(t,J=9.6Hz,1H),3.89(s,3H),3.61(d,J=11.2Hz,1H),1.85–1.68(m,3H),1.68–1.51(m,3H). ESI-MS,m / z=413.30[M+H] + .

[0048] Repeat the above steps of this example to prepare a sufficient amount of C5, and mix the samples prepared from different batches evenly for later use.

[0049] 0.10 g of compound C5 was dissolved in 3 mL of ethyl acetate, and then 4 mL of saturated hydrogen chloride in ethyl acetate solution was added, and the mixture was stirred at room temperature and 200 rpm for 4 h. After the reaction, a large amount of solid was produced in the reaction solution, which was filtered and vacuum dried to obtain off-white solid CE7 (75 mg, yield 95%). Figure 3 , the NMR data of the product are as follows: 1 H NMR (400 MHz, DMSO-d 6 )δ11.50(s,1H),8.30(d,J=8.5Hz,2H),8.11(s,1H),8.07(d,J=9.2Hz,1H),7.68–7.56(m,3H),7.51(dd,J=9.2,2.8Hz,1H),3.89(s,3H). ESI-MS,m / z=329.26[M+H] + .

[0050] Performance Verification

[0051] 1. Detect the selective binding of three compounds to the target protein H1FX.

[0052] 1.1H1FX codon optimization

[0053] Codon optimization, gene synthesis, and H1FX-pET28a vector construction of the H1FX gene for heterologous expression in Escherichia coli BL21 (purchased from Beijing Qingke Biotechnology Co., Ltd.) were all completed by Beijing Qingke Biotechnology Co., Ltd.

[0054] 1.2 Purification of recombinant H1FX protein

[0055] The E. coli BL21 (DE3) culture transformed with the H1FX-pET28a vector was inoculated into LB medium (5 g yeast powder, 10 g peptone and 7 g sodium chloride dissolved in 1 L water and sterilized by high pressure) at a volume fraction of 2%, cultured in a shaking incubator at 37°C for 3 h, and the inducer IPTG was added to a final concentration of 0.1 mM, and cultured at 16°C, 120 rpm for 12 h.

[0056] The collected bacteria were washed twice with phosphate buffer (50 mM, pH 7.0) and then resuspended, disrupted by ultrasound for 20 min, and centrifuged at 12000 rpm for 20 min. The supernatant was the recombinant H1FX cell-free crude enzyme solution.

[0057] The nickel affinity chromatography resin column was equilibrated with 2 column volumes of binding buffer. After the prepared cell-free crude enzyme solution was loaded, it was further washed with 5 column volumes of binding buffer. The target protein was eluted with 2 column volumes of elution buffer and desalted and concentrated by a 30 kDa ultrafiltration tube.

[0058] The components of each buffer are as follows (the solvent is water):

[0059] Binding buffer: 0.5 M NaCl, 50 mM KPB, pH 7.0.

[0060] Wash buffer: 50 mM imidazole, 0.5 M NaCl, 50 mM KPB, pH 7.0.

[0061] Elution buffer: 200 mM imidazole, 0.5 M NaCl, 50 mM KPB, pH 7.0.

[0062] The protein concentration was determined by measuring the optical absorption of the protein at 280 nm using NanoDrop 2000 (Thermo) and combining the molecular weight and optical rotation coefficient predicted from http: / / www.expasy.Org / .

[0063] 1.3 Compound gradient dilution

[0064] Compounds CN25, CN27 and CE7 prepared in Examples 1-3 were dissolved to 1 mM using PBST buffer containing 5% DMSO (v / v) (PBS buffer containing 0.5% Tween 20), and then diluted to 333.3 μM, 111.1 μM, 37 μM, 12.3 μM, 4.1 μM, 1.37 μM, 0.45 μM, 0.15 μM and 0.05 μM, respectively, using PBST buffer containing 5% DMSO (v / v).

[0065] 1.4 SPR analysis

[0066] Insert the CM5 chip (Cytiva, BR-1005-30) into the Biacore instrument, and allow ethanolamine to flow through the CM5 chip at a flow rate of 10 μL / min to complete the chip activation. Dilute the protein prepared in step 1.2 to 50 μg / mL with sodium acetate solution at pH 5.0 and then perform ligand coupling. The coupling amount R max =(analysate M W / ligand M W )×R L ×S m , where R max The maximum binding capacity of the chip surface is usually 100RU in small molecule tests. W and li gand M W are the molecular weights of small molecules and proteins, respectively, S m is the stoichiometric ratio. If unknown, select 1. L is the ligand coupling level. The actual coupling amount in the experiment is 1.5 times of R L After protein coupling was completed, a mixed solution of carbodiimide and N-hydroxysuccinimide was prepared in a volume ratio of 1:1, and the chip was sealed.

[0067] The compound samples with different gradient dilutions obtained in step 1.3 were placed in the sample rack for multi-cycle detection. The affinity constant (K D ) fitting.

[0068] The results of SPR analysis are as follows Figure 4As shown in the figure, it can be seen that the three compounds can selectively bind to H1FX. According to the test results, the affinity constant of compound CN25 to H1FX is 49.4μM, and it has no binding with negative controls H1-1 and H1-6; the affinity constant of compound CN27 to H1FX is 290nM, and it has no binding with negative controls H1-1 and H1-6; the affinity constant of compound CE7 to H1FX is 119μM, and the affinity constants with negative controls H1-1 and H1-6 are 170μM and 587μM, respectively. This shows that the three compounds CN25, CN27 and CE7 can all be used as H1FX selective inhibitors.

[0069] 2. Detect the ability of three compounds to specifically inhibit H1FX binding to DNA.

[0070] EMSA was used to verify that the three compounds could inhibit H1FX binding to DNA.

[0071] The protein used was the recombinant H1FX protein purified in step 1.2; the rDNA probe that binds to H1FX was designed, and the 5' end was labeled with Cy3 by Beijing Qingke Biotechnology Co., Ltd. The primer sequences are as follows:

[0072] Cy3-rDNA-F:CGTCCCGCCCGCCGCCTTCGCTTCGCGGGT;

[0073] Cy3-rDNA-R:ACCCGGAAGCGAAGGCGGGCGGGCGGGACG.

[0074] Dissolve the probe to 100 μM in deionized water, take 25 μL Cy3-rDNA-F and 25 μL Cy3-rDNA-R, mix them, incubate them in a 95°C metal bath for 10 min, cool them naturally to room temperature, dilute them 10 times, and prepare the Cy3-rDNA double-stranded probe. Add the sample according to the reaction system in Table 1 below, add the liquid to the bottom of the tube, mix gently with a pipette, minimize the generation of bubbles, and let it stand at room temperature in the dark for 30 min.

[0075] Note: In the following table, the concentration of H1FX protein is 1 mg / mL, the concentration of Cy3-rDNA is 5 μM, and the concentrations of D271-0003 (positive control, purchased from TargetMol) and compounds CN25, CN27 and CE7 are 10 mM.

[0076] Table 1 H1FX protein-rDNA cross-linking reaction system

[0077]

[0078] Prepare stacking gel and separation gel according to Table 2 below.

[0079] 1 μL of loading buffer (purchased from Shanghai Bio-Tech Biotechnology Co., Ltd., catalog number: GS066) was added to the reaction solution, and 10 μL of sample was immediately taken after mixing. Electrophoresis was performed at 120V for 30 min in 1×TBE solution (purchased from Beijing Solebow Technology Co., Ltd., catalog number: T1051) under ice water bath, and the fluorescence signal of the gel was detected by fluorescence imaging system.

[0080] Table 2 Concentrating gel and separation gel components

[0081] 10% separation gel 4% stacking gel 40% Acrylamide 1.25mL 0.2mL 1.5MTris-HCl(pH8.8) 1.25mL / 0.5M Tris-HCl (pH 6.8) / 0.5mL Deionized water 2.4mL 1.265mL 50% Glycerin 250μL / 10% APS 50μL 15μL TEMED 5μL 1.5μL

[0082] EMSA results Figure 5 As shown in the figure, it can be seen that the three compounds CN25, CN27 and CE7 can inhibit the binding of H1FX to rDNA. Among them, the reaction solution preparation of lanes 1-6 is shown in Table 1, Lane 1: Only Cy3-rDNA labeled probe was added, and no H1FX-rDNA conjugate band was observed; Lane 2: Cy3-rDNA labeled probe and H1FX protein were added, and obvious H1FX-rDNA conjugate bands were detected; Lane 3: Cy3-rDNA labeled probe, H1FX protein and positive control drug D271-0003 were added, and the brightness of the H1FX-rDNA conjugate band was detected to be weakened; Lane 4: Cy3-rDNA labeled probe, H1FX protein and compound CN25, the brightness of H1FX-rDNA conjugate band was detected to be weakened; Lane 5: Cy3-rDNA labeled probe, H1FX protein and compound CN27 were added, and the brightness of H1FX-rDNA conjugate band was detected to be weakened; Lane 6: Cy3-rDNA labeled probe, H1FX protein and compound CE7 were added, and the brightness of H1FX-rDNA conjugate band was detected to be weakened; and the brightness of H1FX-rDNA conjugate bands in lanes 4-6 was lower than that in lane 3 (positive control group). This shows that the three compounds CN25, CN27 and CE7 can inhibit the binding of H1FX to rDNA, and the inhibitory effect is stronger than the positive control drug D271-0003.

[0083] 3. Test the inhibitory effects of three compounds on tumor cell proliferation.

[0084] Detection method: CCK-8 method was used to detect the half inhibitory concentration (IC 50 ).

[0085] Compounds CN25, CN27 and CE7 were dissolved in dimethyl sulfoxide (DMSO) to 40 mM, respectively, and then diluted to 400 μM, 200 μM, 100 μM, 50 μM, 10 μM, 1 μM, 100 nM and 10 nM using 1640 culture medium (containing 10% FBS and 1% penicillin-streptomycin double antibody, volume fraction).

[0086] Prostate cancer cells 22Rv1, LNCaP or PC-3 (provided by the Second Hospital of Shandong University) were inoculated into a 96-well plate at 5000-8000 cells / well and cultured overnight until the cells adhered to the wall and grew. Diluted drugs were added respectively, and after culturing at 37°C for 48 hours, 10ul of CCK-8 (ingredients: methoxy-4-nitrophenyl-3-4-nitrophenyl-5-4-disulfonylbenzene-H-tetrazole monosodium salt) was added to each well, and the cells were incubated in a cell culture incubator for 1-4 hours. The absorbance at 450nm was measured by an enzyme reader.

[0087] Experimental results analysis:

[0088] Inhibition rate = [OD(0 drug addition) - OD(drug addition)] / [OD(0 drug addition) - OD(blank)] × 100%.

[0089] OD (drug added): absorbance value of wells with cells, culture medium, CCK-8 solution and drug solution.

[0090] OD (blank): absorbance value of the wells with culture medium, CCK-8 solution, and no cells.

[0091] OD (0 drug addition): absorbance value of the wells containing cells, culture medium, CCK-8 solution, and no drug solution.

[0092] IC 50 The inhibition rate was calculated by Prism GraphPad 7.0.

[0093] IC of three compounds (CN25, CN27 and CE7) in various prostate cancer cells 50 like Figure 6 and Table 3 below.

[0094] Table 3 IC of compounds inhibiting proliferation of different tumor cells 50

[0095]

[0096] From the above table 3 and Figure 6 It can be seen that compounds CN25, CN27 and CE7 have significant effects in inhibiting the proliferation of prostate cancer cells.

[0097] The above description is only a preferred embodiment of the present invention and does not limit the present invention in other forms. Any technician familiar with the profession may use the technical content disclosed above to change or modify it into an equivalent embodiment with equivalent changes and apply it to other fields. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An antitumor compound for use as a selective inhibitor of H1FX, characterized in that The compound structural formula is: , or .

2. Use of any one or more of the compounds described in claim 1, or their enantiomers, diastereomers, racemates, pharmaceutically acceptable salts, pharmaceutically acceptable carriers and / or excipients, and mixtures thereof in the preparation of drugs for preventing and / or treating tumors.

3. The application according to claim 2, characterized in that: The tumor is prostate cancer.

4. Use of any one or more of the compounds according to claim 1, or their enantiomers, diastereomers, racemates, pharmaceutically acceptable salts, pharmaceutically acceptable carriers and / or excipients, and mixtures thereof in the preparation of H1FX inhibitors.

Images