Clostridium difficile-based cell wall protein display system and construction and application thereof

Abstract

According to the present invention, the cell wall anchoring protein truncated Cwp66 is firstly provided, the cell wall anchoring function of the cell wall anchoring protein truncated Cwp66 is retained, the expression efficiency of the foreign protein is significantly improved, and the unexpected technical effect is produced. On the basis, the invention provides a cell wall protein display system, when a chassis strain is non-toxic clostridium difficile, the display system shows excellent expression performance and colonization ability in an intestinal anaerobic environment, and the display system is obviously superior to the prior art. Furthermore, the invention also provides a cell surface display system taking the non-toxic clostridium difficile as a chassis strain, namely a recombinant strain for displaying the effect protein on the surface of a cell wall; the invention also discloses an application of the compound in tumor resistance. The engineering strain not only realizes efficient expression and display of effect protein on the surface of the cell wall of clostridium difficile, but also has excellent expression performance and colonization ability in an intestinal anaerobic environment, can significantly inhibit the growth of tumors in a mouse model, provides a new thought for treatment of colorectal cancer, and has broad application prospects. The method has important social significance and market value.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and microbiology, and relates to a protein drug targeted display carrier, and specifically to using non-toxic Clostridium difficile as a protein drug display carrier and its application in the treatment of colorectal cancer. Background Art

[0002] With the development of scientific research, more and more evidence shows that bacteria can selectively colonize in the core of the tumor and preferentially grow in hypoxic and necrotic tumor microenvironments (TMEs). Therefore, synthetic biology tools are used to modify bacteria and use them as new tumor-specific delivery systems. Among them, targeted modification of microorganisms that can colonize in lesions and use them as protein drug delivery carriers is a feasible treatment path. If engineered bacteria are used as a "biofactory" for intratumoral drug delivery and effective protein drugs are continuously produced, tumor regression can be achieved and systemic side effects can be reduced. However, how to reduce the virulence of engineered bacteria and how to achieve efficient expression and display of protein drugs are technical problems that need to be solved in the aforementioned treatment strategies.

[0003] It is well known to those skilled in the art that the bacterial protein display system is a method that uses bacteria as hosts to express and anchor foreign proteins or polypeptides on the bacterial surface. The cell surface display of proteins or peptides with specific functions has the following advantages: (1) the molecules displayed on the bacterial surface are freely accessible and directly aggregate with the target molecules; (2) the aforementioned molecules are more stable than free molecules after being attached to the cell wall matrix; (3) there is no need to prepare or purify the displayed proteins in advance. Based on these advantages, since the mid-1980s, when scientists proposed the phage display system, a large number of display systems for yeast, Gram-positive bacteria and Gram-negative bacteria have been reported. At present, these systems have been used in biotechnology and industrial applications, and have made significant progress in whole-cell biocatalysis, live vaccine development, biosorbent and biosensor development, epitope mapping, antigen delivery, inhibitor design and protein / peptide library screening.

[0004] Clostridioides difficile (C. difficile) is a strictly anaerobic, spore-forming Gram-positive bacterium and the main pathogen of antibiotic-associated diarrhea. When patients take broad-spectrum antibiotics, antibiotic-sensitive bacteria die, leading to an imbalance in the intestinal flora. C. difficile takes the opportunity to proliferate and secrete toxins, causing C. difficile infection (CDI). CDI is more common in children and elderly patients with relatively low immunity, and symptoms include abdominal pain, diarrhea, and pseudomembranous colitis. The C. difficile toxin gene is encoded by a 19.6kb pathogenicity locus (PaLoc) locus, which determines whether C. difficile has the ability to produce toxins and cause disease. In the previous research of the inventor's team, the CRISPR (Clustered regularly interspaced short palindromic repeats)-Cpf1 system was used to perform full-length knockout of the PaLoc locus, and the avirulent Clostridium difficile strain ΔPaLoc was constructed; the avirulent Clostridium difficile did not have the ability to cause disease in the hamster animal model.

[0005] Although the above studies have disclosed non-toxic Clostridium difficile and reduced its toxicity as an engineered bacterium, how to achieve efficient expression and display of protein drugs is still a technical problem that needs to be solved. So far, there has been no report on the use of Clostridium difficile as a protein drug display carrier. Summary of the invention

[0006] In order to solve the technical problems of efficient expression and display of protein drugs in the prior art, this application provides an engineering strain with non-toxic Clostridium difficile as a protein drug display carrier. The engineered strain expresses the signal peptide + Cwp66 truncated transmembrane region + effector protein fusion protein through the pMTL82151 plasmid, achieving efficient expression and display of effector protein on the surface of Clostridium difficile, producing unexpected technical effects. Not only that, the engineered strain can significantly inhibit tumor growth in a mouse model, providing a new idea for the treatment of colorectal cancer and having important practical application value.

[0007] The technical solution of the present invention:

[0008] A cell wall anchor protein truncated Cwp66 for efficiently expressing foreign proteins, wherein the amino acid sequence of the anchor protein truncated Cwp66 includes the amino acid sequence shown in SEQ ID NO: 10. The present invention pioneered the use of truncated Cwp66 protein as a cell wall anchor protein for display, filling the gap in the prior art. In addition, although the Cwp66 protein is a cell wall protein unique to Clostridium difficile and has excellent cell wall anchoring function, the inventor unexpectedly discovered that only by adopting the truncation modification described in the present application can the expression efficiency of foreign proteins be significantly improved while retaining its cell wall anchoring function, which can be seen to have produced unexpected technical effects.

[0009] Preferably, the amino acid sequence of the anchoring protein is selected from the following (1), (2) or (3):

[0010] (1) the amino acid sequence shown in SEQ ID NO: 1;

[0011] (2) the amino acid sequence shown in SEQ ID NO: 2;

[0012] (3) An amino acid sequence as shown in SEQ ID NO: 1 or 2, in which one or more amino acids are replaced, deleted or added and which is capable of anchoring to the cell wall and efficiently expressing foreign proteins.

[0013] A nucleotide sequence encoding the aforementioned anchor protein truncated Cwp66, wherein the nucleotide sequence is selected from the following (1), (2) or (3):

[0014] (1) the nucleotide sequence shown in SEQ ID NO:7;

[0015] (2) the nucleotide sequence shown in SEQ ID NO: 8;

[0016] (3) A nucleotide sequence that is different from the nucleotide sequence shown in SEQ ID NO: 7 or 8, but encodes the amino acid sequence shown in SEQ ID NO: 1 or 2.

[0017] Based on the cell wall protein display system of the anchor protein as described above, the display system uses non-toxic Clostridium difficile or Escherichia coli as the chassis strain, and introduces plasmid expression signal peptide SPYY66 and anchor protein truncation Cwp66. Among them, the non-toxic Clostridium difficile is Clostridium difficile with the PaLoc gene and cwp66 gene knocked out. The plasmid expression signal peptide SPYY66 has the amino acid sequence shown in SEQ ID NO:9. The pathogenicity of the strain was significantly reduced by knocking out the PaLoc gene, and its safety was better than that of Escherichia coli in the hamster model sensitive to Clostridium difficile.

[0018] In addition, the inventor unexpectedly discovered that when the chassis strain is avirulent Clostridium difficile, the display system exhibits excellent expression performance and colonization ability in the anaerobic environment of the intestine, which is significantly better than the engineered bacteria used as protein drug delivery carriers in the prior art. It can be seen that the display system described in this application can not only achieve efficient expression of effector proteins, but also has made significant progress in stability and functionality, providing new ideas for the development of drug delivery systems.

[0019] A non-toxic engineered strain of Clostridium difficile, the engineered strain is a recombinant strain that displays the effector protein on the surface of the cell wall through a cell surface display system with non-toxic Clostridium difficile as the chassis strain as described above. Wherein, the effector protein is αPD-L1, IL-18 or other oncolytic proteins. The engineered strains of αPD-L1 and IL-18 obtained by the present invention displayed on the membrane surface of Clostridium difficile have significant oncolytic effects. In the animal model, compared with the ΔPalocΔcwp66 (non-toxic Clostridium difficile) control group, the subcutaneous tumor volume of mice in the ΔPalocΔcwp66_αPD-L1 experimental group (engineered strain displaying αPD-L1 on the surface) was reduced by 72%, and the subcutaneous tumor volume of mice in the ΔPalocΔcwp66_IL-18 experimental group (engineered strain displaying IL-18 on the surface) was reduced by 53%. Compared with the PBS control group, the subcutaneous tumor volume of mice in the ΔPalocΔcwp66_αPD-L1 experimental group decreased by 84%, and the subcutaneous tumor volume of mice in the ΔPalocΔcwp66_IL-18 experimental group decreased by 73%. This fully demonstrates that the non-toxic Clostridium difficile engineered strain described in this application provides a practical new method for the treatment of colorectal cancer, which has important practical application value and social significance.

[0020] As mentioned above, the application of non-toxic Clostridium difficile engineered strains in anti-tumor. The engineered strain not only achieves efficient expression and display of effector proteins on the surface of Clostridium difficile cell walls, but also has excellent expression performance and colonization ability in the anaerobic environment of the intestine, while achieving precise release of drugs. Under this premise, the oncolytic effect of the effector protein itself is fully exerted, so that the engineered strain can significantly inhibit tumor growth in mouse models, providing new ideas for the treatment of colorectal cancer.

[0021] The method for constructing the non-toxic Clostridium difficile engineered strain as described above comprises the following steps:

[0022] (1) Knockout the virulence island (PaLoc) and cell wall protein cwp66 genes of Clostridium difficile to construct chassis cells for effector protein cell wall display. The PaLoc locus gene was knocked out to obtain the avirulent mutant ΔPaLoc. On this basis, the Cell Wall protein 66 (cwp66) gene was further knocked out to provide more sites for protein display and obtain chassis cells.

[0023] (2) Introducing a promoter, a membrane localization signal peptide, a fusion fragment of the anchor protein truncated Cwp66 and an effector protein into the chassis cells described in step (1), displaying the effector protein on the surface of the non-toxic Clostridium difficile cell wall, and obtaining a non-toxic Clostridium difficile engineered strain for anti-tumor use.

[0024] Beneficial effects of the present invention:

[0025] (1) This application discloses for the first time a truncated Cwp66 protein as a display cell wall anchor protein, filling the gap in the prior art. The anchor protein significantly improves the expression efficiency of foreign proteins while retaining its cell wall anchor function, producing unexpected technical effects.

[0026] (2) The present application also provides a cell wall protein display system based on the aforementioned anchor protein. When the display system uses the non-toxic Clostridium difficile as the chassis strain, it not only achieves efficient expression of effector proteins, but also exhibits excellent expression performance and colonization ability in the anaerobic environment of the intestine, thereby solving the technical problems of efficient expression and display of protein drugs in the prior art.

[0027] (3) The present application also provides an engineered strain based on the aforementioned display system, which not only fully exerts the oncolytic effect of the effector protein itself, but also unexpectedly finds that the strain itself can inhibit tumor growth (tumor volume is reduced by up to 73%), providing a new idea for the treatment of colorectal cancer and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Attached Figure 1 Schematic diagram of the CRISPR-Cpf1 gene editing principle described in Example 1 of the present invention.

[0029] Attached Figure 2 Schematic diagram of the construction of the ΔPaLocΔcwp66 engineered strain chassis cell described in Example 1 of the present invention. Wherein: (A) Schematic diagram of the construction of the ΔPaLocΔcwp66 engineered chassis cell. (B) Gel electrophoresis analysis of the ΔPaloc mutant; (C) Sequence alignment and sequencing peak graph of WT and ΔPaLoc mutant; (D) Gel electrophoresis analysis of the Δcwp66 mutant; (E) Sequence alignment and sequencing peak graph of WT and ΔPalocΔcwp66 mutant.

[0030] Attached Figure 3 This is the identification of the ΔPaLocΔcwp66 engineered strain chassis cells described in Example 1 of the present invention. In which: (A) SDS-PAGE analysis of the expression of Cwp66 protein in C. difficile; (B) Western blot quantitative analysis of Cwp66 protein.

[0031] Attached Figure 4 The screening of effector expression promoters described in Example 1 of the present invention. (A) Screening of effector expression promoters using gusA as a reporter gene; (B) Fluorescence value at an excitation wavelength of 455 nm after adding reaction substrate 4-MUG and reacting with gusA as a reporter gene; (C) Fluorescence photo of GFP expression initiated by Pat promoter.

[0032] Attached Figure 5 Schematic diagram of displaying GFP in the ΔPaLocΔcwp66 engineered bacterial chassis cells as described in Example 2 of the present invention. Among them, (A) Schematic diagram of Clostridioides difficile engineered strain; (B) Two schemes of Cwp66 transmembrane domains with different truncated lengths; (C) pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP are fused with gfp reporter gene at the C-terminus; (D) Western blot analysis results; (E) Fluorescence microscopy observation; (F) Flow cytometry detection of GFP protein display results.

[0033] Attached Figure 6 The display of αPD-L1 in the ΔPaLocΔcwp66::αPD-L1 engineered bacteria as described in Examples 3-5 of the present invention. Wherein: (A) Schematic diagram of the structure of the recombinant plasmid pMTL82151_pta_cwp66_PD-L1_His; (B) Western blot detection of PD-L1_His expression; (C) Schematic diagram of the structure of the recombinant plasmid pMTL82151_pta_cwp66_IL18; (D) Western blot detection of IL18 expression.

[0034] Attached Figure 7 The effectiveness of the constructed display system using E. coli BL21 (DE3) as the chassis cell described in Example 7 of the present invention was verified. Among them: (A) the expression of pMTL82151_pta_GFP in BL21 (DE3); (B) the results of GFP protein display detected by flow cytometry; (C) the results of GFP expression in E. coli BL21 (DE3) were analyzed by Western blot.

[0035] Attached Figure 8The ΔPaLocΔcwp66::αPD-L1 described in Example 6 of the present invention and the ΔPaLocΔcwp66::IL18 engineered bacteria described in Example 8 are used to treat colorectal cancer. Wherein: (A) Tumor volume of tumor-bearing mice treated with ΔPaLocΔcwp66::αPD-L1 and ΔPaLocΔcwp66::IL18 engineered bacteria; (B) Histogram of tumor weights of mice in different treatment groups; (C) Graph of changes in tumor volume of mice in different treatment groups over time. DETAILED DESCRIPTION

[0036] The present invention will be further described below in conjunction with the embodiments.

[0037] Example 1: Construction of a cell wall protein display system based on anchor protein truncation of Cwp66

[0038] (1) Construction of effector protein cell wall display chassis cells

[0039] CRISPR-Cpf1 is an endonuclease-based immune system in bacteria. The schematic diagram of its gene editing principle is shown in the attached figure. Figure 1 As shown. Specifically: (A) First, a plasmid containing iLacP::Cpf1, sRNAP::crRNA and Up-arm::Down-arm is transferred into the cell, and an active Cpf1-crRNA RNP complex is formed after lactose induction. As the mature RNP complex recognizes specific DNA targets, it induces DNA double-strand breaks in a misplaced manner. The edited cells undergo homologous recombination reactions between the Up-arm::Down-arm region and the cell genome to obtain the target mutant strain. (B) The PAM sequence is represented by letters ("TTTN", N = A / T / G / C). The misplaced cleavage site of the Cpf1 / crRNA RNP complex is shown in the scissors in the figure, as well as the detailed nucleotide composition and secondary structure of the pre-crRNA.

[0040] In the previous work, the inventors developed a gene editing toolkit based on CRISPR-Cpf1 for genome editing of Clostridioides difficile. This example uses CRISPR-Cpf1 gene editing technology to knock out the virulence island (PaLoc) and cell wall protein cwp66 genes of Clostridioides difficile, and construct ΔPaLocΔcwp66 cell wall display chassis cells of effector proteins (see Figure 2 ).

[0041] in Figure 2A shows two steps of chassis cell construction using pWH53 vector. First, positive transformants carrying cwp66 gene targeting vector were screened based on C. difficileΔPaLoc mutant strain by BHIS-Tm medium screening; then, BHIS-Tm-lactose (BHISL) medium was used for screening again to obtain ΔPaLocΔcwp66 engineered chassis cells.

[0042] Figure 2 B is the gel electrophoresis analysis of ΔPaLoc knockout mutants. Lane M is the DNA molecular weight standard, and lanes 1 to 24 are for ΔPaLoc mutant detection. Figure 2 As can be seen from B, the PaLoc gene was successfully knocked out, ΔPaLoc chassis cells were obtained, and avirulent Clostridium difficile was successfully constructed.

[0043] Figure 2 C is the sequence alignment and sequencing peak diagram of WT and ΔPaLoc mutant strains; Figure 2 As can be seen from C, the PaLoc virulence island was completely knocked out.

[0044] Figure 2 D Gel electrophoresis analysis of WT and ΔPaLocΔcwp66 knockout mutants. Lane M is a DNA molecular weight standard, lane 1 is WT, and lanes 2 to 24 are Δcwp66 mutant strains. Figure 2 As can be seen from D, the cwp66 gene was successfully knocked out in the ΔPaLoc chassis cells to obtain ΔPaLocΔcwp66 chassis cells.

[0045] Figure 2 E Sequence alignment and sequencing peak diagram of WT and Δcwp66 mutant strains. Figure 2 D shows that the cwp66 gene was knocked out and the ΔPaLocΔcwp66 chassis cells were successfully constructed.

[0046] (2) Identification of ΔPaLocΔcwp66 chassis cells

[0047] In this example, SDS-PAGE was used to analyze the expression of Cwp66 protein in C. difficile. Figure 3 As shown in A. Figure 3 As we know, Figure 3A shows three genotypes: CD630 (WT), ΔPaLocΔcwp66, and Δcwp66. Among them, Cwp66 protein can be detected in CD630 (marked by a dotted box), while the protein is not detected in ΔPaLocΔcwp66 and Δcwp66, indicating that Cwp66 has been successfully knocked out in these genotypes. On the left is a 10-180 kDa prestained protein marker. Western blot quantitative analysis of Cwp66 protein, the expression of Cwp66 protein was detected by anti-Cwp66 antibody, as shown in Figure 3 As shown in B. Figure 3 B shows that the bar graph shows that Cwp66 protein is normally expressed in CD630, but not in ΔPaLocΔcwp66 and Δcwp66. This fully demonstrates that Cwp66 protein is no longer expressed in ΔPaLocΔcwp66 chassis cells, and the chassis cells are successfully constructed.

[0048] (3) Screening a promoter to express a membrane localization signal peptide + Cwp66 protein transmembrane fragment, and introducing it into the chassis cells obtained in step (1) to obtain a cell wall protein display system.

[0049] First, β-galactosidase (lacZ) was used as an indicator gene, and promoters with different promoter strengths were selected to drive the expression of the lacZ gene based on the previous transcriptome data of Clostridium sporogenes. The reason for choosing Clostridium sporogenes is that Clostridium sporogenes is closely related to Clostridium difficile, and the promoters can be used universally; secondly, in order to avoid the homologous recombination caused by the use of Clostridium difficile's own promoter, the inverted expression plasmid is unstable. The lacZ gene can cut X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) to produce a blue substrate, and the depth of blue is proportional to the expression level of the lacZ gene. Use this method to screen and obtain promoters for use (see Appendix for details). Figure 4 ).

[0050] Figure 4 A is a promoter for screening effector expression using gusA as a reporter gene. Among them, the control group (Control), Pta (pyruvate, phosphokinase promoter), Ptb (phosphate transporter promoter), PrstA (peptide transport system A promoter) and abrBP (hypothetical protein binding partner promoter). Figure 4 A shows that different promoters have different intensities in promoting genes, from strong to weak, in the order of Pta>Ptb>PrstA>abrBP. Figure 4 B is the fluorescence value after adding the reaction substrate 4-MUG and gusA as the reporter gene to react; specifically: the fluorescence value of the mixed reactant at an excitation wavelength of 365nm and an emission wavelength of 455nm was detected at 0min, 15min, and 30min respectively. Figure 4B shows that different promoters have different intensities in promoting genes, from strong to weak, in the order of Pta>Ptb>PrstA>abrBP. Figure 4 AThe results are consistent. Figure 4 C is a fluorescence photograph of GFP expression driven by Pta promoter. Figure 4 C shows that the Pta promoter is the promoter with the highest promoter efficiency. Therefore, the promoter determined in the final screening is the Pta promoter.

[0051] The plasmid expression signal peptide SPYY66 is the wild-type signal peptide sequence of the Cpw66 gene, and the plasmid expression signal peptide SPYY66 has the amino acid sequence shown in SEQ ID NO:6.

[0052] Screening of anchor protein truncated Cwp66: The NovoPro protein transmembrane region prediction website predicted that the sequence length of the transmembrane region of the Cwp66 protein was 1-610 bp. Based on this prediction result, the inventors subsequently designed 6 transmembrane regions of the anchor protein Cwp66 for screening based on the 1-1833 bp sequence of cwp66. The amino acid sequences of the transmembrane domains of Cwp66 with 6 different truncated lengths are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6:

[0053] Finally, the inventors verified through experiments that: (1) the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 can correctly display the GFP protein on the cell wall of non-toxic Clostridium difficile; (2) the amino acid sequences shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6 cannot correctly display the GFP protein on the cell wall of non-toxic Clostridium difficile. This fully shows that even after design, not all truncated Cwp66 transmembrane domains have the function of acting as anchoring proteins ( Figure 5 F). Therefore, the truncated Cwp66 screened in the present application has a non-obvious function as an anchoring protein, achieving an unexpected technical effect. Figure 5 B shows the two different truncated lengths of the Cwp66 transmembrane domain scheme, as follows:

[0054] Solution 1: The Cwp66 transmembrane domain is 666 bp long (pMTL82151_pta_cwp66_1);

[0055] Solution 2: The Cwp66 transmembrane domain is 1545 bp in length (pMTL82151_pta_cwp66_2).

[0056] In addition, the anchor protein truncated Cwp66 determined in this embodiment has the following advantages compared with the anchor proteins in the prior art: (1) the truncated Cwp66 protein has a natural affinity with the cell wall of Clostridium difficile, ensuring the stability of the anchor; (2) the truncated Cwp66 protein reduces steric hindrance, which is beneficial to the correct folding and function of the exogenous protein.

[0057] Example 2: Display of GFP protein in ΔPaLocΔcwp66 avirulent C. difficile chassis cells

[0058] Attached Figure 5 Schematic diagram of displaying GFP in the ΔPaLocΔcwp66 engineered bacterial chassis cells constructed in Example 1. Figure 5 A is a schematic diagram of the Clostridioides difficile engineering strain. Figure 5 A shows that the engineered strain has knocked out the ΔPaLoc virulence gene island and the cwp66 gene, and the cwp66 gene membrane localization signal + truncated Cwp66 transmembrane domain + effector fusion protein is expressed by an exogenous plasmid. The specific operations in this embodiment are as follows:

[0059] (1) Construction of pMTL82151_pta_cwp66_1 and pMTL82151_pta_cwp66_2 basic plasmids The genome of Clostridium beijerinckii strain 8052 was used as a template, and the pta promoter fragment was amplified from Clostridium beijerinckii using primer pair HW1637 / HW1638.

[0060] Using the genome of Clostridium difficile CD630 as a template, primer pairs HW546 / HW1323 and HW546 / HW1319 were used to amplify two transmembrane region fragments of different lengths, cwp66_1 (1-666bp) and cwp66_2 (1-1545bp), of the cwp66 gene. An AvrⅡ restriction site was designed and inserted at the end of the transmembrane region to facilitate the subsequent expression of the displayed protein and ensure that the displayed protein was translated in the same open reading frame.

[0061] Using the homologous recombination method, the amplified pta promoter fragment was overlapped and extended with two transmembrane region fragments of different lengths, cwp66_1 (1-666bp) and cwp66_2 (1-1545bp), and then connected to the linearized pMTL82151 vector cut with the restriction endonuclease BamHⅠ and transformed into competent cells. Finally, the pMTL82151_pta_cwp66_1 and pMTL82151_pta_cwp66_2 plasmids were screened.

[0062] The relevant primer sequences are as follows:

[0063] HW1637: gagctcggtacccggggatccTATTCAGAACATTAAAAGAATGGTGAAT

[0064] HW1638: catAATCTATTTATCTCCTCTCTATATCCTATCTCTA

[0065] HW546: AATTTCACAGGAGGGCTGAAatgaaaatatcaaaaaagatagtgtctttg

[0066] HW1323:GACGCGTGACGTCGACTCTAGAGCCTAGGTCTTTCTACAGAATTAG

[0067] HW1319: gacgcgtgacgtcgactctagagCctaggatttaagcctctagc

[0068] (2) Construction of pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids

[0069] Figure 5 C is the pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids, which fused the gfp reporter gene at the C-terminus of the membrane localization signal peptide + Cwp66 protein transmembrane fragment to test the effector protein display system.

[0070] The specific construction process is as follows: using pWH136 as a template, the sequence fragments of GFP were amplified with primer pairs HW1485 / HW1486 and HW1660 / HW1661, respectively, and connected to the linearized vectors pMTL82151_pta_cwp66_1 and pMTL82151_pta_cwp66_2 after restriction endonuclease AvrⅡ digestion, and transformed into competent cells, and finally the pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids were screened. Figure 5 D is the result of Western blot analysis, indicating that the Clostridioides difficile engineered strain successfully expressed the recombinant protein carrying GFP. The relevant primer sequences are as follows:

[0071] HW1485: aattctgtagaaagacctaggATGGGATCCATGTCGAAGGG

[0072] HW1486: acgtcgactctagagcctaggAAACAGCTATGACCGCGGC

[0073] HW1660: gctagaggcttaaatcctaggATGGGATCCATGTCGAAGGG

[0074] HW1661: acgtcgactctagagcctaggAGGAAACAGCTATGACCGCG

[0075] (3) Detection of the effect of GFP display in the chassis cells of the engineered strain of ΔPalocΔcwp66 avirulent Clostridium difficile

[0076] First, pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids were transformed into Escherichia coli CA434, and the transformants were transferred to LB liquid medium for culture. After the strain grew, it was mixed with Clostridium difficile liquid and spotted on BHIS solid plate for conjugation transformation. After 18 hours, the bacteria were scraped off and spread on BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol to screen the transformants. Fluorescence microscopy and flow cytometry were used to detect the expression of green fluorescence on the surface of the chassis cells of the ΔPalocΔcwp66 non-toxic Clostridium difficile engineered strain. Figure 5 E is the result of fluorescence microscopy observation. Figure 5 E shows that the pMTL82151_pta_cwp66 group has an obvious fluorescent signal (highlighted part), which indicates that the GFP green fluorescent protein is correctly expressed in the engineered strain. Flow cytometry results ( Figure 5 F) Tip: GFP green fluorescent protein is successfully displayed on the cell wall surface of the ΔPalocΔcwp66 avirulent engineered strain chassis.

[0077] Example 3: ΔPalocΔcwp66 avirulent Clostridium difficile engineered strain displays αPD-L1_His protein

[0078] (1) Construction of pMTL82151_pta_cwp66_αPD-L1_His plasmid

[0079] Using pSRR3 as a template, the sequence fragment of αPD-L1_His was amplified with primer pair HW1854 / HW1855, connected to the linearized vector pMTL82151_pta_cwp66_1 after restriction endonuclease AvrⅡ digestion, and transformed into competent cells. Finally, the pMTL82151_pta_cwp66_αPD-L1_His plasmid was screened. Its structure diagram is shown in Figure 6 As shown in A. Figure 6 A shows that the plasmid contains TraJ, pBP1, catP and RepA genes, as well as the 1-666bp fragment of the cwp66 gene. The cwp66 gene is fused with PD-L1 and His tag. The detection primers WH103 / HW1181 were used to detect the successfully connected pMTL82151_pta_cwp66_αPD-L1_His plasmid, and the agarose gel electrophoresis band size was 1988bp.

[0080] The relevant primer sequences are as follows:

[0081] HW1854: aattctgtagaaagacctaggATGGCACAAGTACAATTAGTAGAAACTG

[0082] HW1855: acgtcgactctagagcctaggTCAGTGGTGGTGGTGGTGGT

[0083] WH103: gctggcgaagatcgaagaga

[0084] HW1181:ggcctcttcgctattacgcc

[0085] (2) Detection of the effect of displaying αPD-L1_His protein in the non-toxic engineered strain ΔPalocΔcwp66

[0086] The pMTL82151_pta_cwp66_αPD-L1_His plasmid was transformed into Escherichia coli CA434, and the transformants were transferred to LB liquid medium for culture. After the strain grew, it was mixed with Clostridium difficile liquid and spotted on BHIS solid plate for conjugation transformation. After 18 hours, the bacteria were scraped off and spread on BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol to screen the transformants. Protein expression was detected by Western Blot ( Figure 6 B). Figure 6 B shows the expression of cwp66_PD-L1_His recombinant protein in C. difficile strain. Figure 6 B shows that αPD-L1_His protein was successfully expressed in the engineered strain, and the protein band size was 39 kDa.

[0087] Example 4: ΔPalocΔcwp66 avirulent engineered strain displays αPD-L1_GFP protein

[0088] (1) Construction of pMTL82151_pta_cwp66_αPD-L1_GFP plasmid

[0089] Using pSRR3 as a template, the primer pair HW1854 / HW1856 was used to amplify the sequence fragment of αPD-L1. Using pWH136 as a template, the primer pair HW1857 / HW1486 was used to amplify the sequence fragment of GFP. Using the homologous recombination method, the amplified sequence fragments of αPD-L1 and GFP were overlapped and extended, and then connected to the linearized vector pMTL82151_pta_cwp66_1 after restriction endonuclease AvrⅡ digestion, and transformed into competent cells, and finally the pMTL82151_pta_cwp66_αPD-L1_GFP plasmid was screened. The agarose gel electrophoresis band size of the successfully connected pMTL82151_pta_cwp66_αPD-L1_GFP plasmid was 2777bp using the detection primers WH103 / HW1181.

[0090] The relevant primer sequences are as follows:

[0091] HW1854: aattctgtagaaagacctaggATGGCACAAGTACAATTAGTAGAAACTG

[0092] HW1856: atggatcccatTCCTCCAGTTTCAGGTAATCCTCC

[0093] HW1857: actggaggaATGGGATCCATGTCGAAGGG

[0094] HW1486: acgtcgactctagagcctaggAAACAGCTATGACCGCGGC

[0095] WH103: gctggcgaagatcgaagaga

[0096] HW1181:ggcctcttcgctattacgcc

[0097] (2) Detection of the effect of displaying αPD-L1_GFP protein in the non-toxic engineered strain ΔPalocΔcwp66

[0098] The pMTL82151_pta_cwp66_αPD-L1_GFP plasmid was transformed into Escherichia coli CA434, and the transformants were transferred to LB liquid medium for culture. After the strain grew, it was mixed with Clostridium difficile liquid and spotted on BHIS solid plates for conjugation transformation. After 18 hours, the bacteria were scraped off and spread on BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol to screen the transformants. Protein expression was detected using Western Blot ( Figure 6 B), the results showed that αPD-L1_GFP protein was successfully expressed in the engineered strain, and the protein band size was 65kDa.

[0099] Example 5: ΔPalocΔcwp66 avirulent engineered strain displays IL18_GFP protein

[0100] The gene sequence of IL18 was obtained by searching the NCBI database, and the protein codon sequence of IL18 was optimized according to the codon usage preference of the Clostridium difficile genome using the NewPu Bio online tool. The optimized sequence is shown in SEQ ID NO: 11. The optimized sequence was connected to the linearized pMTL82151_pta_cwp66_1 vector after restriction endonuclease AvrⅡ digestion and sent to Nanjing GenScript Biotech Co., Ltd. for synthesis to obtain the pMTL82151_pta_cwp66_IL18 plasmid. The agarose gel electrophoresis band size of the pMTL82151_pta_cwp66_IL18 plasmid was detected by using the detection primers WH103 / HW1181, and the band size was 2177bp.

[0101] The pMTL82151_pta_cwp66_IL18 plasmid was transformed into Escherichia coli CA434, and the transformants were transferred to LB liquid medium for culture. After the strain grew, it was mixed with Clostridium difficile liquid and spotted on a BHIS solid plate for conjugation transformation. After 18 hours, the bacteria were scraped off and spread on a BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol to screen the transformants. Figure 6 C is a schematic diagram of the structure of the recombinant plasmid pMTL82151_pta_cwp66_IL18. Figure 6 C shows that the plasmid contains TraJ, pBP1, catP and RepA genes, as well as the 1-666bp fragment of the cwp66 gene and the IL18 gene. Figure 6 D is the result of Western blot analysis, showing the expression of cwp66_IL18 recombinant protein in C. difficile strain; Figure 6 D shows that IL18_GFP protein was successfully expressed in the engineered strain, and the protein band was approximately 70 kDa in size.

[0102] Example 6: ΔPaLocΔcwp66 non-toxic engineered strain displaying αPD-L1 protein for the treatment of colorectal cancer

[0103] (1) Colorectal cancer cell culture:

[0104] After taking the frozen CT26 cells out of the -80℃ refrigerator, quickly put them into a preheated 37℃ constant temperature water bath, shake the cryotube continuously until the liquid is dissolved, add 2mL of complete culture medium, centrifuge at 1000rpm / min for 3min, and discard the supernatant. Gently pipette and resuspend with 5mL of complete culture medium, pipette into the cell culture bottle, shake the cell culture bottle up and down and left and right to disperse the cells, mark them, and place them in a 5% CO 2 , and cultured in a 37°C constant temperature incubator. The medium was changed the next day and the cell morphology was observed.

[0105] (2) Construction of colorectal cancer tumor-bearing mouse model:

[0106] Female Balb / C mice aged 6-8 weeks, weighing 18-20 g, were purchased from Beijing Sibeifu Biotechnology Co., Ltd. Before starting the experiment, the mice were adaptively raised for one week. The breeding level was specific pathogen-free, the day and night time was equal, the room temperature was 23°C ± 2°C, there were 5 mice in each ventilated cage, and food and water were freely available. CT26 cells with good logarithmic growth (cell density reached 80%-90%) were replaced with medium one day in advance, and CT26 cell suspension was prepared with PBS the next day, and its concentration was adjusted to 5×10 5 / mL. The hair in the middle and posterior part of the right armpit of the mouse was removed with depilatory cream, the skin at the injection site was wiped with 75% alcohol, and 200 μL of cell suspension was injected subcutaneously into each mouse to establish a CT26 colorectal cancer tumor-bearing mouse model.

[0107] (3) The ΔPaLocΔcwp66 non-toxic engineered strain displaying αPD-L1 protein is used to treat colorectal cancer:

[0108] After one week of adaptive feeding, the mice were randomly divided into 4 groups, 5 mice in each group, namely PBS control group (blank control), ΔPaLocΔcwp66 group (wild-type strain), and ΔPaLocΔcwp66_αPD-L1 intervention group (engineered strain). 3 After about 100 μL of 5 × 10 8CFU corresponding to the wild-type strain or engineered strain (the bacteria were resuspended in 100 μL PBS). The tail vein was injected twice throughout the experiment to ensure the success rate of drug administration. When the tumor diameter exceeded 2 cm, the mice were killed. During the treatment process, the activity status of each group of mice was observed every day, the number of days the mice survived was recorded, and the survival curve was drawn. The weight and tumor volume of the mice were recorded every three days. The tumor volume calculation formula is: tumor volume (mm 3 )=0.5×length×width 2 .

[0109] Example 7: Display system using Escherichia coli BL21 (DE3) as chassis cells

[0110] In the field of biotechnology and molecular biology, BL21 (DE3) strain is a commonly used expression system. With its high efficiency, flexibility and easy operation, it has become an efficient tool for protein expression. The inventors used Escherichia coli BL21 (DE3) as the chassis cell to verify the effectiveness of the constructed display system. The specific operation is as follows:

[0111] First, the successfully constructed pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids were transformed into Escherichia coli BL21 (DE3). Green fluorescence signals were observed under a fluorescence microscope in the strains of the pMTL82151_pta_cwp66 group, indicating that the GFP green fluorescent protein was correctly expressed in the engineered strains ( Figure 7 A). Similarly, Western Blot results ( Figure 7 C) and flow cytometry results ( Figure 7 B) also shows that GFP green fluorescent protein is successfully displayed on the cell wall surface of the ΔPalocΔcwp66 non-toxic engineered strain chassis. This means that the effectiveness of the constructed display system was successfully verified by using E. coli BL21 (DE3) as the chassis cell. It also shows that the anchor protein truncated Cwp66 described in this application is not only applicable to Clostridium difficile, but also to E. coli, with broad application prospects and considerable economic benefits.

[0112] Example 8: Avirulent engineered strain ΔPaLocΔcwp66 displaying IL-18 protein for the treatment of colorectal cancer

[0113] (1) Colorectal cancer cell culture

[0114] After taking the frozen CT26 cells out of the -80℃ refrigerator, quickly put them into a preheated 37℃ constant temperature water bath, shake the cryotube continuously until the liquid is dissolved, add 2mL of complete culture medium, centrifuge at 1000rpm / min for 3min, and discard the supernatant. Gently pipette and resuspend with 5mL of complete culture medium, pipette into the cell culture bottle, shake the cell culture bottle up and down and left and right to disperse the cells, mark them, and place them in a 5% CO 2 , and cultured in a 37°C constant temperature incubator. The medium was changed the next day and the cell morphology was observed.

[0115] (2) Construction of colorectal cancer tumor-bearing mouse model

[0116] Female Balb / C mice aged 6-8 weeks, weighing 18-20 g, were purchased from Beijing Sibeifu Biotechnology Co., Ltd. Before starting the experiment, the mice were adaptively raised for one week. The breeding level was specific pathogen-free, the day and night time was equal, the room temperature was 23°C ± 2°C, there were 5 mice in each ventilated cage, and food and water were freely available. CT26 cells with good logarithmic growth (cell density reached 80%-90%) were replaced with medium one day in advance, and CT26 cell suspension was prepared with PBS the next day, and its concentration was adjusted to 5×10 5 / mL. The hair in the middle and posterior part of the right armpit of the mouse was removed with depilatory cream, the skin at the injection site was wiped with 75% alcohol, and 200 μL of cell suspension was injected subcutaneously into each mouse to establish a CT26 colorectal cancer tumor-bearing mouse model.

[0117] (3) The ΔPaLocΔcwp66 non-toxic engineered strain expressing IL18 protein is used to treat colorectal cancer

[0118] After one week of adaptive feeding, the mice were randomly divided into 7 groups, with 5 mice in each group, namely PBS control group (blank control), ΔPaLocΔcwp66 group (wild-type strain), and ΔPaLocΔcwp66_IL18 intervention group (engineered strain). When the tumor volume of the mice grew to 100mm 3 After about 100 μL of 5 × 10 8 The wild-type strain or engineered strain corresponding to CFU (the bacteria were resuspended in 100 μL PBS). The tail vein was injected twice throughout the experiment to ensure the success rate of drug administration. When the tumor diameter exceeded 2 cm, the mice were killed. During the treatment, the activity status of each group of mice was observed every day, the number of days the mice survived was recorded, and the survival curve was drawn. The weight and tumor volume of the mice were recorded every three days. The tumor volume calculation formula is: Tumor volume (mm3) = 0.5 × length × width 2 .

[0119] Attached Figure 8The results of treating colorectal cancer with the engineered bacteria ΔPaLocΔcwp66::αPD-L1 displaying αPD-L1 protein described in Example 6 and ΔPaLocΔcwp66::IL18 displaying IL-18 protein described in Example 8. Figure 8 A shows the tumor volume of tumor-bearing mice after treatment with two strains of engineered bacteria: ΔPaLocΔcwp66::αPD-L1 and ΔPaLocΔcwp66::IL18. Figure 8 A It can be seen that: (1) Compared with the PBS control group, the tumor volume of the ΔPaLocΔcwp66 group (non-toxic chassis cells) showed a slightly decreasing trend; this shows that the non-toxic Clostridium difficile chassis cells themselves also have tumor inhibitory effects, which is the first discovery in this application. (2) After the cell wall proteins of Clostridium difficile displayed αPD-L1 and IL18 proteins, the tumor volume of tumor-bearing mice was further significantly reduced on the basis of the non-toxic engineered bacteria chassis cell group. This shows that the ΔPaLocΔcwp66 non-toxic engineered strains that display αPD-L1 or IL-18 proteins have shown good tumor inhibitory effects.

[0120] Figure 8 B is a bar graph of tumor weights of mice in different treatment groups. Figure 8 B shows that: (1) compared with the PBS control group, the tumor weight of the ΔPaLocΔcwp66 group (non-toxic) did not change significantly; (2) compared with the PBS and ΔPaLocΔcwp66 groups, the tumor weight of the ΔPaLocΔcwp66_PD-L1 and ΔPaLocΔcwp66_IL18 treatment groups was significantly reduced. This shows that the use of the cell wall protein display system of Clostridium difficile to display anti-tumor proteins can have a good anti-tumor effect, which is consistent with Figure 8 AThe results are consistent.

[0121] Figure 8 C is a graph showing the changes in tumor volume over time in mice in different treatment groups. Figure 8 C shows that: (1) compared with the PBS control group, the tumor volume of mice in the ΔPaLocΔcwp66 group (wild-type strain) increased over time, but its growth rate was lower than that of the PBS control group; (2) compared with the PBS and ΔPaLoCΔcwp66 groups, the tumor volume of the ΔPaLocΔcwp66_PD-L1 and ΔPaLocΔcwp66_IL18 treatment groups was significantly reduced, where *** indicates p<0.001, **** indicates p<0.0001. This shows that the use of the cell wall protein display system of Clostridium difficile to display anti-tumor proteins can have a good anti-tumor effect.

[0122] In summary, (1) the present application discloses for the first time a truncated Cwp66 protein as a cell wall anchor protein for display, which significantly improves the expression efficiency of foreign proteins and produces unexpected technical effects. (2) The cell wall protein display system based on the aforementioned anchor protein, when using the non-toxic Clostridium difficile as the chassis strain, solves the technical problems of efficient expression and display of protein drugs in the prior art. (3) The engineered strain based on the aforementioned display system not only fully exerts the oncolytic effect of the effector protein itself, but also unexpectedly finds that the strain inhibits tumor growth (tumor volume is reduced by up to 73%), which provides a new idea for the treatment of colorectal cancer and has broad application prospects.

Claims

1. A cell wall anchored protein truncated Cwp66 for efficient expression of foreign proteins, characterized in that: The amino acid sequence of the anchor protein truncated Cwp66 includes the amino acid sequence shown in SEQ ID NO:

10.

2. The anchor protein truncated Cwp66 according to claim 1, characterized in that: The amino acid sequence of the anchor protein is selected from the following (1) and (2): (1) the amino acid sequence shown in SEQ ID NO: 1; (2) the amino acid sequence shown in SEQ ID NO: 2; (3) An amino acid sequence as shown in SEQ ID NO: 1 or 2, in which one or more amino acids are replaced, deleted or added and which is capable of anchoring to the cell wall and efficiently expressing foreign proteins.

3. The nucleotide sequence encoding the anchor protein truncated Cwp66 according to claim 2, characterized in that: The nucleotide sequence is selected from the following (1) and (2): (1) the nucleotide sequence shown in SEQ ID NO:7; (2) the nucleotide sequence shown in SEQ ID NO: 8; (3) A nucleotide sequence that is different from the nucleotide sequence shown in SEQ ID NO: 7 or 8, but encodes the amino acid sequence shown in SEQ ID NO: 1 or 2.

4. A cell wall protein display system based on the anchor protein according to any one of claims 1 to 3, characterized in that: The display system uses avirulent Clostridium difficile or Escherichia coli as the chassis strain, and introduces plasmids to express the signal peptide SPYY66 and the anchor protein truncation Cwp66.

5. The cell wall protein display system according to claim 4, characterized in that: The plasmid expression signal peptide SPYY66 has the amino acid sequence shown in SEQ ID NO:

9.

6. The cell wall protein display system according to claim 4 or 5, characterized in that: The avirulent Clostridium difficile is Clostridium difficile in which the PaLoc gene and the cwp66 gene are knocked out.

7. A non-toxic engineered strain of Clostridium difficile; characterized in that: The engineered strain is a recombinant strain that displays the effector protein on the cell wall surface through the cell surface display system with the avirulent Clostridium difficile as the chassis strain as described in any one of claims 4 to 6.

8. The engineered strain according to claim 7, characterized in that: The effector protein is αPD-L1, IL-18 or other oncolytic proteins.

9. Use of the non-toxic engineered strain of Clostridium difficile as claimed in claim 7 in the preparation of anti-tumor drugs.

10. The method for constructing an avirulent Clostridium difficile engineered strain according to claim 7, comprising the following steps: (1) Knocking out the virulence island (PaLoc) and cell wall protein cwp66 genes of Clostridium difficile to construct an effector protein cell wall display chassis cell; (2) Introducing a promoter, a membrane localization signal peptide, an anchor protein truncated Cwp66 and a fusion fragment of the effector protein into the chassis cell described in step (1), displaying the effector protein on the surface of the non-toxic Clostridium difficile cell wall, and obtaining a non-toxic Clostridium difficile engineered strain for anti-tumor.

Images