Pseudomonas oryzae D339 strain and application thereof

Abstract

The invention discloses a pseudomonas oryzae D339 strain and application thereof, and belongs to the technical field of rice production. The pseudomonas oryzae D339 strain provided by the invention has various excellent characteristics of dissolving insoluble organic phosphorus and inorganic phosphorus, producing siderophores, producing plant hormones IAA and JA, tolerating heavy metals and the like; under normal growth conditions, heavy metal stress conditions and low-nitrogen treatment conditions, the tillering number of the rice can be remarkably increased, the tillering time can be advanced, and meanwhile growth of overground and underground parts of the rice can be promoted; the Pseudomonas oryzae D339 has the promotion effect on the tillering and overground and underground part growth of rice, is not influenced by rice varieties, and has obvious effects on a plurality of tested rice varieties such as Nipponbare, Jiushui 134, YLiangyou No.1 and the like; the compound can be used for preparing a rice biological agent, has the advantages of low cost, good effect and no toxic or side effect, and can assist in high and stable yield of rice under different growth conditions, improvement of rice quality and guarantee of grain safety.

Description

Technical Field

[0001] The invention relates to the technical field of microbial agents, and in particular to a Pseudomonas oryzae D339 strain and an application thereof. Background Art

[0002] As the world's main food crop, the tillering period and number of rice tillers are important indicators of field management and an important way to promote high yields of rice. Tillering is a natural growth process in which Gramineae plants produce lateral buds from the base or underground stem nodes, and then develop into new branches. Plant tillering can increase the number of plants. In crop production, the more effective tillers, the more plants, and the higher the number of grain ears, which helps to directly increase the final yield of crops; at the same time, plant tillering can increase the photosynthetic area of ​​the plant, so that the plant can maximize the photosynthetic efficiency in a limited growth space and promote plant growth; plant tillering can also improve plant stress resistance and enhance the plant's ability to resist adverse environments such as diseases and stress. Even if some main stems or parts of the plant are damaged, tillers can replace the damaged parts and continue to grow, enhancing the overall survival ability. Therefore, promoting rice tillering is an effective way to increase rice yield.

[0003] As a reproductive organ of a plant, seeds have the characteristic of "vertical" transmission, that is, they can pass on all the biological characteristics of the variety, including the beneficial microorganisms living in the seeds, to the offspring. A large number of studies have shown that rice seeds are rich in endophytic fungi and bacteria, and the combined effects of these endophytic beneficial bacteria will affect crop yield characteristics such as seed germination, plant growth and tillering. Summary of the invention

[0004] The purpose of the present invention is to provide a Pseudomonas oryzae D339 strain and its application, so as to provide a beneficial strain that can significantly promote rice tillering and rooting, and at the same time has multiple functions such as solubilizing phosphate, producing iron carriers, and producing plant hormones, thereby contributing to the high and stable yield of rice under different growth conditions.

[0005] To achieve the above object, the present invention provides a strain of Pseudomonas oryzae D339, the Latin name of which is Pseudomonas oryzihabitans The 16S rDNA sequence is shown in SEQ ID NO.1, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on December 16, 2024. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the deposit number is GDMCC No: 65646.

[0006] Preferably, the strain has good phosphate solubilizing ability, siderophore producing ability, and hormone producing ability.

[0007] Preferably, the hormone-producing ability includes the ability to produce IAA and the ability to produce JA.

[0008] A use of the Pseudomonas oryzae D339 strain as described above in promoting rice tillering, wherein promoting rice tillering includes promoting the number of tillers and advancing the tillering time.

[0009] Preferably, the Pseudomonas oryzae D339 strain has the ability to promote rice tillering under heavy metal stress conditions; the heavy metal is Cd; and the heavy metal stress concentration is 5 mg / kg.

[0010] Preferably, the Pseudomonas oryzae D339 strain has the ability to promote rice tillering under low nitrogen level and normal nitrogen level conditions; the low nitrogen level is a nitrogen concentration of 7 mg / kg; the normal nitrogen level is a nitrogen concentration of 40 mg / kg.

[0011] A use of the Pseudomonas oryzae D339 strain as described above in promoting the dry weight of the above-ground part and the underground part of rice, wherein the rice is grown under normal conditions, heavy metal stress conditions or low nitrogen conditions.

[0012] A use of the Pseudomonas oryzae D339 strain as described above in the preparation of a rice biological preparation, wherein the biological preparation contains the Pseudomonas oryzae D339 strain; the biological preparation is intended to promote rice tillering, root growth or alleviate the effects of adversity.

[0013] Preferably, the adverse environment includes excessive heavy metals or low nitrogen soil.

[0014] Therefore, the Pseudomonas oryzae D339 strain and its application provided by the present invention have the following specific technical effects: (1) The Pseudomonas oryzae D339 strain provided by the present invention can significantly promote the number of rice tillers and advance the tillering time under normal growth conditions, heavy metal stress conditions, and low nitrogen conditions, and can also promote the growth of above-ground and underground parts of rice; (2) The Pseudomonas oryzae D339 strain provided by the present invention has a promoting effect on rice tillering and the growth of above-ground and underground parts, which is not affected by rice varieties. Multiple rice varieties such as Nipponbare, Xiushui 134, and Y Liangyou No. 1 were tested and all showed significant effects; (3) The Pseudomonas oryzae D339 strain provided by the present invention has many excellent properties, such as dissolving poorly soluble organic and inorganic phosphorus, producing siderophores, producing plant hormones IAA and JA, and tolerating heavy metals; (4) The Pseudomonas oryzae D339 strain provided by the present invention can be used to prepare rice biological agents, which have low cost, good effect, and no toxic side effects. It can help to increase and stabilize rice yields under different growth conditions, improve rice quality, and ensure food security. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0016] Figure 1 The Pseudomonas oryzae D339 strain in Example 1 of the present invention ( Pseudomonas oryzihabitans ) Characteristics of colonies formed on LB medium (a) and photos of LB shake flask fermentation culture (b); Figure 2 The Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) Photo of the culture medium for qualitative evaluation of siderophore production capacity; Figure 3 The figures are the statistical results of tiller number (a), dry weight of above-ground and underground parts (b), and line graph of tiller number over time (c) of rice in the experimental group and the control group in Example 3 of the present invention. The data are mean ± standard error, n = 13. Figure 4 The results are as follows: the number of tillers (a) and the dry weight of the aboveground and underground parts (b) of the rice Y Liangyou No. 1 in the experimental group and the control group in Example 4 of the present invention after being cultured at 0 and 5 mg / kg cadmium concentrations for 60 days; wherein the data are mean ± standard error, n = 6; Figure 5 The photographs (a), the statistical results of tiller number (b), the statistical results of dry weight of above-ground and underground parts (c), the detection results of nitrogen content (d) and the statistical results of nitrogen utilization efficiency (e) of the experimental group and the control group of rice Xiushui 134 cultured for 60 days under low nitrogen and normal nitrogen levels in Example 5 of the present invention are shown; wherein the data are mean ± standard error, n = 6. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0018] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0019] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0020] The culture medium formula (per liter) used in the embodiment is as follows: LB medium: 5 g yeast powder, 10 g tryptone, and 10 g sodium chloride.

[0021] NRBIP liquid culture medium: glucose 10.0 g, calcium phosphate 5.0 g, magnesium chloride 5.0 g, magnesium sulfate 0.25 g, potassium chloride 0.2 g, and ammonium sulfate 0.1 g.

[0022] CAS-LB double-layer solid culture medium: Add 15 mL of CAS dye solution to 180 mL of 1% water agar medium, shake well and pour into the plate as the lower culture medium, and 2% agar LB medium as the upper culture medium.

[0023] Preparation of CAS dye solution (200 mL): weigh 0.121 g of chrome azuro blue S and dissolve it in deionized water to make up to 100 mL. 3+ Solution (1 mM FeCl 3 6H 2 O, 10mM HCl) was added to 100mL of chrome azuro blue S solution and mixed well as solution A; 0.1458g of CTAB was weighed and dissolved in deionized water, and the volume was fixed to 80mL as solution B; solution A was slowly added to solution B and mixed well to prepare CAS staining solution.

[0024] MKB liquid culture medium: 5 g casamino acids, 15 ml glycerol, 2.5 g magnesium sulfate heptahydrate, 2.5 g potassium dihydrogen phosphate, adjust pH to 7.2.

[0025] Example 1 Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ), screen the colonies grown on LB plates from the homogenate of Dejing No. 6 rice seeds with completely sterilized seed coats. On the LB plates, Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) In the early stage of growth, the colony surface is smooth, round, light yellow, and the diameter is generally 1~2 mm ( Figure 1 a). In the later stage, it appears wrinkled and has serrated edges. Pseudomonas oryzihabitans ) is shown in SEQ ID NO.1, and was deposited in Guangdong Provincial Microbiological Culture Collection Center on December 16, 2024. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the deposit number is GDMCCNo:65646.

[0026] SEQ ID NO.1: TGAGAGGAGCTTGCTCCTCGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTAGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATTAGATGAGCCTAGGTCGGATTAGCTAGTTGGTAGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCCTCGGGTCGTAAAGCACTTTAAGTTGGGAGGAAGGGCTCATAGCGAATACCTGTGAGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGATAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGTCTGGCTAGAGTGCGGTAGAGGGTAGTGGAATTTCCAGTGTAGCGGTGAAATGCGTAGATATTGGAAGGAACACCAGTGGCGAAGGCGACTACCTGGACTGACACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCAACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCATTAAGTTGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCC Example 2 Examine the effect of Pseudomonas oryzihabitans strain D339 ( Pseudomonas oryzihabitans ) on the plant growth-promoting functional characteristics as follows: S21. Evaluation of phosphorus-solubilizing ability: Respectively, 0.5 mL of the bacterial solution of Pseudomonas oryzihabitans strain D339 (OD600 = 0.8) was inoculated into 50 mL NRBIP liquid medium, which used insoluble organic phosphorus calcium phytate and inorganic phosphorus tricalcium phosphate as the only phosphorus source. Cultured at 37°C and 180 rpm for 5 days, with three replicates for each treatment, and a blank control of NRBIP liquid medium without bacteria was set. The cultured fermentation broth was then filtered into a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 min. The soluble phosphorus content of the supernatant was determined by the molybdenum antimony colorimetric method, and the pH value of the fermentation broth was determined using a pH meter.

[0027] S22. Evaluation of siderophore production: 1) Qualitative evaluation: Select CAS-LB double-layer solid culture medium. Under sterile conditions, filter the CAS dye solution with a sterile filter with a pore size of 0.22μm, add it to a 1% agar sterile culture medium at 60℃ at a volume ratio of 10%, mix it evenly, and pour it into the plate as the lower layer of the culture medium. After it cools and solidifies, pour an equal amount of iron-free LB culture medium into the plate as the upper layer. Then, 2μL of Pseudomonas oryzae D339 bacterial solution (OD 600 = 0.8) was inoculated into CAS-LB double-layer solid culture medium and cultured in a 37°C constant temperature incubator in the dark for five days. The color change zone around the strain and the range of the color change were observed to qualitatively evaluate the siderophore production capacity of the strain.

[0028] 2) Quantitative evaluation: 0.5 mL of Pseudomonas oryzae D339 bacterial solution (OD 600 = 0.8) was inoculated into 50 mL of sterile MKB liquid medium and cultured at 37°C and 180 rpm for 3 days. Three replicates were used for each treatment. At the same time, MKB liquid medium without bacteria was set as a blank control. The OD of the fermentation liquid was measured. 600 After the fermentation broth was centrifuged (5000rpm, 10min), the supernatant was filtered through a 0.22μm sterile filter. 1mL of the filtrate was mixed with 1mL of CAS quantitative detection solution in equal proportions. After reacting at room temperature for 1h, the OD was measured. 630 The iron carrier unit (%) was calculated using the following formula = 100 × (Ar-AS) / Ar, where As represents the OD of the inoculated sample. 630 value, Ar represents the OD of the blank control 630 The ability of bacteria to produce siderophores is the ratio of siderophore units to bacterial OD 600 ratio.

[0029] S23, hormone production capacity evaluation (1) Evaluation of IAA production capacity 1 mL of Pseudomonas oryzae D339 bacterial solution (OD 600=0.8) was inoculated into 100mL sterile LB liquid medium (containing 100mg / L L-tryptophan), and cultured at 37℃, 180rpm for 2 days. Three replicates were used for each treatment, and an LB liquid medium without bacteria was set as a blank control. After the culture was completed, the fermentation broth was centrifuged (5000rpm, 10min), and the supernatant was taken and colored with an equal volume of Salkowski colorimetric solution in the dark for 30min, and the absorbance at 530nm was measured. The IAA production of the strain was calculated using the IAA standard curve.

[0030] (2) Evaluation of JA production capability 0.5 mL of Pseudomonas oryzae D339 bacterial suspension (OD 600 =0.8) was inoculated into 50 mL of sterile LB liquid medium and cultured at 37°C and 180 rpm for 2 days. Each treatment was repeated 5 times, and an LB liquid medium without bacteria was set as a blank control. After the culture, the jasmonic acid (JA) enzyme-linked immunosorbent assay (ELISA) kit was used to measure the absorbance at 450 nm, and the JA production of the strain was calculated using the JA standard curve.

[0031] Test results Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitan s) are shown in Table 1. The growth-promoting function test results of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitan s) had positive effects on the phosphate solubilization, siderophore production, and hormone production abilities. Pseudomonas oryzihabitan s) was used to qualitatively evaluate the iron carrier production capacity of the uninoculated treatment as the negative control CK, and its inoculated plate showed color, which was consistent with the quantitative evaluation results ( Figure 2 ).

[0032] Table 1 ;

[0033] Note: The ability to produce siderophores depends on the As / Ar value: from 1.0 to 0 with an interval of 0.2. A "+" is added for every 0.2 decrease. Generally, bacteria with an As / Ar value below 0.5 and an SU value greater than 0.5 are considered to have a high ability to produce siderophores. Example 3 Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on rice tillering, the specific steps are as follows: 1) Test materials Based on the model plant Nipponbare ( Oryza. Sativa L. spp. japonica ) as the host plant, and Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is a microbial inoculant.

[0034] 2) Soil inoculants Pick up Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) A single colony was inoculated into a 250 mL conical flask containing 100 mL LB medium, cultured at 37 ° C and 180 rpm for 2 days, and the bacterial fermentation broth was centrifuged (5000 rpm, 10 min) to obtain a bacterial agent. Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitan s) Characteristics of colonies formed on LB medium Figure 1 As shown in part a of the present invention, the LB shake flask fermentation broth (microbial culture) of the strain is as follows Figure 1 As shown in part b.

[0035] The above-mentioned bacterial agent was mixed with sterilized vermiculite, dried in the shade, and balanced for 7 days as an active bacterial inoculant. The inactivated bacteria that had been sterilized at 121°C for 20 min were mixed with sterilized vermiculite, dried in the shade, and balanced for 7 days as an inoculant for the non-inoculated control.

[0036] 3) Design and training of experimental and control groups The rice variety Nipponbare was used as the host plant. The experimental group used the active bacterial inoculant obtained in step 2) as the culture matrix. The roots were inoculated with the Pseudomonas oryzae D339 strain by the root dipping method during planting. The control group (CK) used the control inoculant as the culture matrix. The roots were not inoculated with the Pseudomonas oryzae D339 strain during planting. The plants were cultured under greenhouse conditions for 45 days. During this period, 50 mL of water was poured every 2 days. The number of tillers per day was observed and recorded to determine the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) Whether there is a tillering promotion phenomenon.

[0037] 4) Detection indicators Before sampling, the number of tillers of the plants in the experimental group and the control group was measured, and the average value was taken for statistics and comparison. When collecting samples, the above-ground and underground parts of the plants were separated. The underground roots were washed and dried, and the fresh weight of the above-ground and underground parts was weighed respectively, and then dried in an oven at 65°C to constant weight, and the dry weight was measured.

[0038] 5) Test results The results are as follows Figure 3 As shown in the figure, compared with the control group CK without inoculation, the tiller numbers of the inoculated groups increased significantly ( Figure 3 The dry weight of the aboveground and underground parts also increased significantly ( Figure 3 At the same time, the time of tillering was also advanced. The inoculated group started tillering on the 19th day, while the CK group started tillering on the 22nd day ( Figure 3 In summary, it can be seen that strain D339 ( Pseudomonas oryzihabitans ) While increasing the number of rice tillers, it also advances the time of tillering appearance.

[0039] Example 4 The results showed that the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on rice tillering, as follows: 1) Test materials The sterile seedlings of the rice variety Yliangyou 1, which has low cadmium accumulation, were used as host plants. Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is a microbial inoculant.

[0040] 2) Design and training of the experimental group Using sterile vermiculite as the cultivation medium and Y Liangyou No. 1 sterile seedlings as the host plants, each sterile seedling was inoculated with the Pseudomonas oryzae D339 strain prepared in Example 3 ( Pseudomonas oryzihabitans ) bacterial agent. At the same time, an equal amount of inactivated Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) was used as the control group without inoculation. Plants were cultured in a Cd stress environment (Cd content 5 mg / kg) for 60 days. At the same time, the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) The inoculum group and the non-inoculated group were used as the control group (CK). Six replicates were set for each treatment group.

[0041] 3) Detection indicators By measuring the tiller number, biomass and other indicators of rice in different treatment groups, the effect of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on the growth characteristics of plants under heavy metal pollution conditions.

[0042] 4) Test results like Figure 4 As shown in the figure, compared with the control group CK without inoculation, the tiller number of the inoculated group increased significantly under no Cd stress and 5 mg / kg Cd stress ( Figure 4 The dry weight of the aboveground and underground parts also increased significantly ( Figure 4 Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is resistant to heavy metals.

[0043] Example 5 The results showed that the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on rice tillering, as follows: 1) Test materials The sterile seedlings of rice Xiushui 134 were used as host plants, and Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is a microbial inoculant.

[0044] 2) Design and training of the experimental group Using sterile vermiculite as the cultivation matrix and Xiushui 134 sterile seedlings as the host plants, each sterile seedling was inoculated with the bacterial agent prepared in Example 3 by the root irrigation method, and cultured for 60 days in a low nitrogen stress environment (nitrogen concentration of 7 mg / kg). At the same time, a normal nitrogen environment (nitrogen concentration of 40 mg / kg) was set as a control group, and each treatment group had 6 replicates. During the culture period, the rice in the low nitrogen and normal nitrogen treatment groups was supplemented with equal amounts of low nitrogen and normal nitrogen nutrient solutions to maintain its normal growth.

[0045] 3) Detection indicators By measuring the tiller number, biomass, nitrogen use efficiency and other indicators of rice in different treatment groups, the effect of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on tillering of rice variety Xiushui 134. The nitrogen concentrations in aboveground and underground parts of rice were determined by Kjeldahl method.

[0046] 4) Test results like Figure 5 As shown in Figure 2, under both normal nitrogen and low nitrogen conditions, the tiller number of the inoculated group increased significantly compared with the control group CK without inoculation ( Figure 5 Part b), the growth state is better ( Figure 5 The above-ground and underground dry weights also increased significantly ( Figure 5 At the same time, the nitrogen content above and below ground in the two nitrogen level inoculation groups was significantly reduced, but the nitrogen use efficiency was significantly increased ( Figure 5 d and e of the results). This indicates that Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) can promote the tillering of Xiushui 134 and significantly improve the nitrogen utilization efficiency of rice.

[0047] Therefore, the oryzae Pseudomonas oryzae D339 strain provided by the present invention has multiple excellent characteristics such as dissolving poorly soluble organic phosphorus and inorganic phosphorus, producing siderophores, producing plant hormones IAA and JA, and tolerating heavy metals; under normal growth conditions, heavy metal stress conditions, and low nitrogen conditions, it can significantly promote the number of rice tillers and advance the tillering time, and at the same time promote the growth of the aboveground and underground parts of rice; the promotion effect on rice tillering and the growth of the aboveground and underground parts is not affected by the rice variety, and multiple rice varieties such as Nipponbare, Xiushui 134, Y Liangyou No. 1, etc. have been tested, all of which have significant effects; it can be used to prepare rice biological preparations, with low cost, good effect, and no toxic side effects, and can help to increase and stabilize the yield of rice under different growth conditions, improve rice quality, and ensure food security.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A strain of Pseudomonas oryzae D339, characterized in that: The Latin name of the strain is Pseudomonas oryzihabitans The 16S rDNA sequence is shown in SEQ ID NO.

1. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on December 16, 2024. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the deposit number is GDMCCNo:65646.

2. The Pseudomonas oryzae D339 strain according to claim 1, characterized in that: The strain has good phosphate-solubilizing ability, iron carrier-producing ability and hormone-producing ability.

3. The Pseudomonas oryzae D339 strain according to claim 2, characterized in that: The hormone production ability includes the ability to produce IAA and the ability to produce JA.

4. Use of a strain of Pseudomonas oryzae D339 according to any one of claims 1 to 3 in promoting tillering of rice, characterized in that: The method of promoting rice tillering includes promoting the tillering quantity and advancing the tillering time.

5. The use of a strain of Pseudomonas oryzae D339 according to claim 4 in promoting rice tillering, characterized in that: The Pseudomonas oryzae D339 strain has the ability to promote rice tillering under heavy metal stress conditions; the heavy metal is Cd; and the heavy metal stress concentration is 5 mg / kg.

6. The use of a strain of Pseudomonas oryzae D339 according to claim 4 in promoting rice tillering, characterized in that: The Pseudomonas oryzae D339 strain has the ability to promote rice tillering under low nitrogen level and normal nitrogen level conditions; the low nitrogen level is a nitrogen concentration of 7 mg / kg; and the normal nitrogen level is a nitrogen concentration of 40 mg / kg.

7. Use of the Pseudomonas oryzae D339 strain according to any one of claims 1 to 3 in promoting the increase of dry weight of above-ground and underground parts of rice, characterized in that: The rice is rice grown under normal conditions, heavy metal stress conditions or low nitrogen conditions.

8. Use of a strain of Pseudomonas oryzae D339 according to any one of claims 1 to 3 in the preparation of rice biological preparations, characterized in that: The biological preparation contains the Pseudomonas oryzae D339 strain; the biological preparation is intended to promote rice tillering, root growth or alleviate the effects of adverse conditions.

9. The use of a strain of Pseudomonas oryzae D339 according to claim 8 in the preparation of rice biological preparations, characterized in that: The adverse conditions include excessive heavy metals or low nitrogen soil.

Images