Genetically engineered bacterium for producing rosavin and application of genetically engineered bacterium

Abstract

The invention discloses recombinant escherichia coli for producing rosavin and application of the recombinant escherichia coli. The genetically engineered bacterium contains phenylalanine ammonia lyase, 4-coumaric acid coenzyme A ligase, cinnamyl coenzyme A reductase, glucosyltransferase, arabinosyltransferase, arabinokinase and uridine diphosphate carbohydrate pyrophosphorylase, and can be used for producing rosavin through fermentation, and the highest yield can reach 7.5 g / L. The method lays a foundation for large-scale industrial production of rosavin.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular, to a genetically engineered bacterium capable of producing rosavirin, an application of the genetically engineered bacterium in producing rosavirin, and a method for heterologously producing rosavirin using genetically engineered bacteria. Background Art

[0002] Rosavin (cinnamyl-(6'-O-α-L-arabinopyranosyl)-O-β-D-glucopyranoside) has the structure shown in the following formula I, which is cinnamyl alcohol-glucose-arabinoside. Its English name is Rosavin, its chemical name is trans-cinnamyl-(6'-O-β-D-arabinpyranosyl)-O-β-D-glucopyranoside, and its CAS number is 84954-92-7. Its molecular formula is C 20 H 28 O 10 , molecular weight 428.18.

[0003]

[0004] It is an important and unique secondary metabolite and main active ingredient of the rare Rhodiola rosea L. plant of the Rhodiola rosea family, and is an important marker commonly used to evaluate the quality of Rhodiola rosea extracts. Studies have found that Rosavi has a variety of beneficial pharmacological effects, such as intelligence, anti-cancer, immune enhancement, anti-depression, and anti-ultraviolet radiation.

[0005] At present, Rosavi is mainly produced by plant extraction. Rose Rhodiola grows in high-altitude cold areas, and its wild resources are rare. In recent years, due to over-exploitation, the resources of Rose Rhodiola have been severely damaged and have been classified as a national second-level key protected wild plant. Due to the constraints of growth conditions, pests and diseases, Rhodiola has not yet achieved large-scale artificial cultivation; and the accumulation cycle of active ingredients in the plant Rhodiola is very long, and it takes about 5-7 years of growth to obtain enough active ingredients.

[0006] In the body, the precursors of rosavidin are cinnamic alcohol and rosavidin. Among them, cinnamic alcohol has the following characteristics: English name Cinnamic alcohol, chemical name 3-phenyl-2-propene-1-ol, molecular formula C 9 H 10 O, molecular weight is 134.18, CAS number is 104-54-1, structural formula is

[0007]

[0008] Rosin, having the following characteristics: English name Rosin, chemical name is (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E)-3-phenyl-2-enoxy]oxane-3,4,5-triol or trans-cinnamy-O-β-D-glucopyranoside, molecular formula is C 15 H 20 O 6 , with a molecular weight of 296.32, CAS number 85026-55-7, and the structural formula is

[0009]

[0010] In 2006, Patov et al. reported the chemical synthesis of rosavin (Kishida, M., Akita, H. (2005) Simple synthesis of phenylpropenoid β-D-glucopyranoside congeners based on Mizoroki-Heck type reaction of organoboron reagents. Tetrahedron Lett. 46, 4123-4125.). However, the chemical synthesis steps are numerous, the yield is low, the cost is high, and the environmental pollution is relatively serious. Therefore, it is necessary to develop a method for efficiently producing rosavin. Summary of the Invention

[0011] The purpose of the present invention is to overcome the above-mentioned defects existing in the prior art, and to provide a genetically engineered bacterium capable of fermentatively producing rosavin and its application in the production of rosavin.

[0012] The present invention provides a genetically engineered bacterium for producing rosavin, which is obtained by introducing genes encoding phenylalanine ammonia-lyase, genes encoding 4-coumarate-CoA ligase, genes encoding cinnamoyl-CoA reductase, genes encoding glucosyltransferase, genes encoding UDP-glucose dehydrogenase, genes encoding UDP-xylose synthase, genes encoding UDP-xylose 4-epimerase, and genes encoding sugar chain elongation arabinosyltransferase into Escherichia coli for expression, so as to achieve the de novo synthesis of rosavin by microorganisms.

[0013] Preferably, the sugar chain elongating arabinosyltransferase is from the UGT91R subfamily, including SlUGT91R1 from Solanum lycopersicum, NtUGT91R1 from Nicotiana tabacum, CsUGT91R1 from Camellia sinensis and SpUGT91R4 from Solanum pennellii.

[0014] In addition, preferably, the gene encoding phenylalanine ammonia lyase PAL is selected from the gene AtPAL of Arabidopsis thaliana phenylalanine ammonia lyase,

[0015] The gene encoding 4-coumarate-CoA ligase or cinnamate-CoA ligase is selected from Ph4CL1, Gm4CL4, Os4CL3 and HcCNL from Petunia hybrid, Glycine max, Oryza sativa and Hypericum calycinum;

[0016] The gene encoding cinnamoyl-CoA reductase is selected from the group consisting of EuCCR, LpCCR1 and OsCCR1 genes from Eucalyptus gunnii, Lolium perenne and Oryza sativa;

[0017] The gene encoding UDP glucose syltransferase is selected from a gene encoding UDP glucose syltransferase UGT73C5 or a gene encoding UDP glucose syltransferase Bs-YjiC.

[0018] The present invention provides a genetically engineered bacterium capable of heterologously producing rosavidin, characterized in that the gene encoding UDP glucose dehydrogenase, the gene encoding UDP xylose synthase, and the gene encoding UDP xylose 4-epimerase introduced into the genetically engineered bacterium are replaced with a gene encoding arabinokinase AraK and a gene encoding uridine diphosphate sugar pyrophosphorylase, so as to realize the synthesis of UDP-arabinose using L-arabinose as a substrate and then synthesize rosavidin from scratch;

[0019] Preferably, the gene encoding arabinokinase AraK is the PbAraK gene selected from Paludisphaera borealis, and the gene encoding uridine diphosphate sugar pyrophosphorylase is the AtUSP gene from Arabidopsis thaliana;

[0020] Alternatively, the gene encoding 4-coumarate-CoA ligase and the gene encoding cinnamoyl-CoA reductase are replaced with a carboxylic acid reductase and a phosphopantetheinyl transferase; preferably, the gene encoding the carboxylic acid reductase is the MmCAR gene from Mycobacterium marinum and the gene encoding the phosphopantetheinyl transferase is the NiNPT gene from Nocardia iowensis.

[0021] Specifically, the starting bacteria is Escherichia coli, preferably phenylalanine-producing Escherichia coli. More specifically, the phenylalanine-producing Escherichia coli is obtained by knocking out or inactivating trpE, tyrR, tyrA and pykF genes or reducing their expression in the starting Escherichia coli.

[0022] Furthermore, the UDP-glucose hydrolase gene ushA and the β-galactosidase gene lacZ were knocked out or inactivated or their expression was reduced in Escherichia coli.

[0023] In a preferred embodiment, each introduced gene is introduced into the host bacteria in the form of one or more plasmids, or integrated into the host bacteria genome; preferably, the nucleotide sequence of each gene is optimized according to the codon preference of the host bacteria.

[0024] The present invention provides the use of the genetically engineered bacteria in the production of rosavirin, rosavirin and / or cinnamyl alcohol, especially for the production of rosavirin.

[0025] The present invention provides a method for preparing rosavirin, rosavirin and / or cinnamyl alcohol, which produces rosavirin, rosavirin and / or cinnamyl alcohol by fermenting the genetically engineered bacteria; optionally, the method further comprises a step of purifying rosavirin, rosavirin and / or cinnamyl alcohol.

[0026] The genetically engineered bacteria of the present invention can ferment and produce rosavidin, with a maximum yield of 7539.1 mg / L. Therefore, the present invention provides a biosynthetic method for efficiently producing rosavidin in microorganisms, laying a foundation for the industrial large-scale synthesis of rosavidin, and has important scientific value and social benefits.

[0027] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the synthesis of rosavidin by recombinant Escherichia coli, where a shows the de novo synthesis pathway of UDP-arabinose and b shows the salvage pathway of UDP-arabinose.

[0029] Figure 2The graph is a comparison of the cinnamyl alcohol production of E. coli strains BPHE-CA1-8, BHPE-AHL and BPHE-AMN. Among them, a is a comparison of the cinnamyl alcohol production of BPHE-CA1-8 and BHPE-AHL, and b is a comparison of the cinnamyl alcohol production of BHPE-AHL and BPHE-AMN.

[0030] Figure 3 The figure is a comparison chart of the conversion rates of cinnamyl alcohol and ligand by different glycosyltransferases, wherein a shows the conversion rate of cinnamyl alcohol, and b shows the conversion rate of ligand.

[0031] Figure 4 The HPLC analysis results of the fermentation products of E. coli strains BPHE-RV0, BPHE-RV1 and BPHE-RV2 are shown in Figure 1. a represents BPHE-RV0, b represents BPHE-RV1 and c represents BPHE-RV2.

[0032] Figure 5 The figure shows the results of LC-MS analysis of fermentation products.

[0033] Figure 6 is the NMR diagram of Rosavi. Wherein, a is 1 H NMR, b is 13 C NMR.

[0034] Figure 7 This is a comparison chart of the rosavir production of BPHE-RV2, BPHEU-RV and BPHEUZ-RV.

[0035] Figure 8 The fermentation results of BPHEUZ-RV in a 5L fermenter. DETAILED DESCRIPTION

[0036] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0037] In the first aspect, the present invention provides a genetically engineered bacterium for efficiently fermenting and producing rosavidin, which contains a gene encoding phenylalanine ammonia lyase PAL, a gene encoding 4-coumarate CoA ligase 4CL, a gene encoding cinnamoyl CoA reductase CCR, a gene encoding UDP glycosyltransferase UGT, a gene encoding sugar chain elongation glycosyltransferase GGT and a gene encoding UDP glucose dehydrogenase UGD, a gene encoding UDP xylose synthase UXS, and a gene encoding UDP-4-xylose isomerase UXE.

[0038] According to the present invention, when the genetically engineered bacteria contains the above-mentioned coding gene, the genetically engineered bacteria can biosynthesize cinnamyl alcohol, rosin and rosin:

[0039] The inventors of the present invention, based on the above-mentioned genetically engineered bacteria, introduced a gene encoding arabinokinase AraK and a gene encoding uridine diphosphate pyrophosphorylase USP to replace the above-mentioned gene encoding UDP glucose dehydrogenase UGD, the gene encoding UDP xylose synthase UXS, and the gene encoding UDP xylose isomerase UXE, and constructed a biosynthetic pathway for generating UDP-arabinose from arabinose, thereby realizing the synthesis of rosavirin using glucose and arabinose as raw materials and increasing the yield of rosavirin.

[0040] According to the present invention, the term "phenylalanine ammonia lyase PAL" is phenylalanine ammonia-lyase, abbreviated as PAL, which is an enzyme that catalyzes the direct removal of ammonia from phenylalanine to generate trans-cinnamic acid. It can be from various sources, for example, microbial sources, plant sources, and its corresponding amino acid sequence is well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not go into details.

[0041] Preferably, the phenylalanine ammonia lyase PAL is Arabidopsis thaliana phenylalanine ammonia lyase AtPAL.

[0042] According to the present invention, the term "4-coumarate coenzyme A ligase 4CL" is hydroxycinnamate: CoA ligase, abbreviated as 4CL, which is a key enzyme in the phenylpropanoid metabolic pathway in the biosynthesis of monolignols and flavonoids. It can be from various sources, for example, microbial sources, plant sources, and its corresponding amino acid sequence is well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat it.

[0043] Preferably, the 4-coumarate-CoA ligase 4CL is parsley 4-coumarate-CoA ligase Pc4CL.

[0044] Further preferably, the 4-coumarate CoA ligase 4CL can be replaced by Hypericum perforatum Cinnamate:CoALigase cinnamate CoA ligase HcCNL.

[0045] According to the present invention, the term "cinnamoyl-CoA reductase CCR" is cinnamyl-CoA reductase, abbreviated as CCR, which is responsible for catalyzing the most important metabolic reaction in the biosynthesis of lignin monomers, and it transfers phenylpropionic acid metabolites to the synthesis pathway of lignin. It can be from various sources, for example, microbial sources, plant sources, and its corresponding amino acid sequences are well known to those skilled in the art, and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat them.

[0046] Preferably, the cinnamoyl-CoA reductase CCR is Arabidopsis thaliana cinnamoyl-CoA reductase AtCCR.

[0047] Further preferably, the cinnamoyl-CoA reductase CCR is ryegrass cinnamoyl-CoA reductase LpCCR1.

[0048] According to the present invention, the term "glycosyltransferase UGT" is UDP-glycosyltransferase, abbreviated as UGT. It catalyzes the activation of various types of UDP-sugars in vivo and connects the sugar groups to different receptor molecules, such as proteins, nucleic acids, oligosaccharides, lipids and small molecules, thereby giving new biological functions to the glycosylated products. It can be from various sources, such as microbial sources and plant sources, and its corresponding amino acid sequences are well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or by querying in relevant public literature, and the present invention will not repeat them.

[0049] Preferably, the glycosyltransferase UGT is Arabidopsis thaliana UDP glycosyltransferase AtUGT73C5.

[0050] Further preferably, the glycosyltransferase UGT is Bacillus subtilis UDP glycosyltransferase Bs-YjiC.

[0051] According to the present invention, the term "glycosides specific UDP-glycosyltransferase GGT" is a type of glycosyltransferase UGT that specifically uses glycoside as an acceptor molecule and specifically connects the glycosyl to the glycosyl of the acceptor molecule in a glycosidic bond-forming manner. It is a key enzyme for extending the sugar chain of glycoside compounds. It can be from various sources, such as microbial sources and plant sources, and its corresponding amino acid sequences are well known to those skilled in the art and can be obtained using conventional technical means in the art, for example, by searching in a database (such as NCBI) or by querying in relevant public literature, and the present invention will not repeat them.

[0052] Preferably, the sugar chain elongation glycosyltransferase GGT is a sugar chain elongation glycosyltransferase UGT91R1 from the UGT91R subfamily.

[0053] According to the present invention, the term "UDP-glucose dehydrogenase UGD" is UDP-glucose 6-dehydrogenase, abbreviated as UGD, which catalyzes UDP-glucose to generate UDP-glucuronic acid in vivo. It can be from various sources, for example, microbial sources, plant sources, and its corresponding amino acid sequences are well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat them.

[0054] According to the present invention, the term "UDP xylose synthase UXS" is UDP-xylose synthase, abbreviated as UXS, which catalyzes UDP-glucuronic acid to generate UDP-xylose in vivo. It can be from various sources, such as microbial sources and plant sources, and its corresponding amino acid sequence is well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat them.

[0055] According to the present invention, the term "UDP xylose-4-epimerase UXE" is UDP-xylose-4-epimerase, abbreviated as UXE, which catalyzes UDP-xylose to generate UDP-arabinose in vivo. It can be from various sources, such as microbial sources and plant sources, and its corresponding amino acid sequences are well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat them.

[0056] According to the present invention, the term "arabinokinase AraK" is arabinokinase, abbreviated as AraK, which catalyzes arabinose to generate arabinose-1-phosphate in vivo. It can be from various sources, such as microbial sources and plant sources, and its corresponding amino acid sequence is well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat it in detail.

[0057] According to the present invention, the term "uridine diphosphate sugar pyrophosphorylase USP" is Uridine diphosphate sugar pyrophosphorylase, abbreviated as USP, which catalyzes monosaccharide-1-phosphate to generate UDP-sugar in vivo. It can be from various sources, such as microbial sources and plant sources, and its corresponding amino acid sequence is well known to those skilled in the art and can be obtained by conventional technical means in the art, for example, by searching in a database (such as NCBI) or querying in relevant public literature, and the present invention will not repeat them.

[0058] It is well known that among the 20 different amino acids constituting proteins, except for Met (ATG) or Trp (TGG) which are respectively encoded by a single codon, the other 18 amino acids are respectively encoded by 2-6 codons (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, second edition, 1989, see Appendix D on page 950). That is, due to the degeneracy of the genetic code, there are mostly more than one codons that determine an amino acid, and the substitution of the third nucleotide in the triplet codon often does not change the composition of the amino acid, so the nucleotide sequence of the gene encoding the same protein can be different. According to the known codon table and the amino acid sequence of the corresponding enzyme, those skilled in the art can completely deduce the nucleotide sequence of the gene that can encode them, and obtain the nucleotide sequence by biological methods (such as PCR method, mutation method) or chemical synthesis method.

[0059] According to a preferred embodiment of the present invention, the gene encoding phenylalanine ammonia lyase PAL is the AtPAL gene from Arabidopsis thaliana, GenBank: AY133595.1.

[0060] According to a preferred embodiment of the present invention, the gene encoding 4-coumarate-CoA ligase 4CL is the Pc4CL gene from parsley, GenBank: X13325.1.

[0061] According to a more preferred embodiment of the present invention, the gene encoding 4-coumarate coenzyme A ligase 4CL is replaced with the HcCNL gene from Hypericum perforatum, GenBank: JQ743645.1.

[0062] According to a preferred embodiment of the present invention, the gene encoding cinnamoyl-CoA reductase CCR is the AtCCR gene from Arabidopsis thaliana, GenBank: AF332459.1.

[0063] According to a more preferred embodiment of the present invention, the gene encoding cinnamoyl-CoA reductase CCR is the LpCCR1 gene from Lolium perenne, GenBank: AY061888.

[0064] According to a preferred embodiment of the present invention, the gene encoding glucosyltransferase UGT is the AtUGT73C5 gene from Arabidopsis thaliana, GenBank: KJ138865.1.

[0065] According to a more preferred embodiment of the present invention, the gene encoding glucosyltransferase YjiC is the Bs-YjiC gene from Bacillus subtilis, GenBank: CP053102.1.

[0066] According to a preferred embodiment of the present invention, the gene encoding glycan elongation glucosyltransferase GGT is the SlUGT91R1 gene from Solanum lycopersicum, GenBank: AK323431.1.

[0067] According to a preferred embodiment of the present invention, the gene encoding UDP-glucose dehydrogenase is the endogenous EcUGD gene from Escherichia coli, Gene ID 946571.

[0068] According to a preferred embodiment of the present invention, the gene encoding UDP-xylose synthase is the SmUXS gene from Sinorhizobium meliloti, Genbank: GU062741.

[0069] According to a preferred experimental mode of the present invention, the gene encoding UDP-xylose-4-epimerase is the SmUXE gene from Sinorhizobium meliloti, Genbank: HM004122.

[0070] According to a preferred experimental method of the present invention, the gene encoding arabinokinase AraK is the PbAraK gene from Paludisphaera borealis, Genbank: WP_083713045.1

[0071] According to a preferred experimental method of the present invention, the gene encoding uridine diphosphate sugar pyrophosphorylase USP is the AtUSP gene from Arabidopsis thaliana, Genbank: NM_124635.4.

[0072] According to the present invention, the strain used to construct the genetically engineered bacteria can be various strains conventionally used in the art, for example, fungi, such as yeast, or bacteria, such as bacillus. According to a preferred embodiment of the present invention, the strain is Escherichia coli, and there is no special requirement for the type of Escherichia coli used to construct the Escherichia coli expression strain, and it can be various Escherichia coli commonly used in the art that can express the target gene. In order to better express the target gene, the Escherichia coli is preferably BL21 (DE3) and Escherichia coli DH5α, and more preferably the Escherichia coli strain BL21 (DE3).

[0073] The inventors of the present invention have found in their research that, compared with using wild-type Escherichia coli, when Escherichia coli is constructed to produce high phenylalanine, the efficiency of obtaining the target product can be further improved by introducing the genes of the present invention as described above.

[0074] Wherein, the Escherichia coli BPHE with high phenylalanine production can be an Escherichia coli that does not express tyrR (DNA-binding transcriptional dual regulator), tyrA (fused chorismate mutase / prephenatedehydrogenase), trpE (anthranilate synthase subunit) and pykF (pyruvate kinase 1) genes, and its construction can be achieved by a variety of methods, for example, it can include a λRed recombination system, a CRISPR-Cas9 recombination system, and RNAi, etc. Preferably, the λRed recombination system is used for the construction of the Escherichia coli with high phenylalanine production of the present invention. The Escherichia coli with high phenylalanine production constructed by the present invention is more suitable for synthesizing rosavidin.

[0075] According to the present invention, the construction method of the genetically engineered bacteria can be completed by conventional technical means in the art, for example, by introducing a vector into the corresponding strain into which a corresponding gene is inserted. The present invention has no special requirements for the type of expression vector, and can be various expression vectors commonly used in the art that can express the target gene in the strain, such as plasmids, etc. It should be understood by those skilled in the art that the construction method of the expression vector can adopt various methods commonly used in the art, such as connecting the target gene to the vector after enzyme digestion, which will not be repeated here.

[0076] Among them, the genes used to construct the genetically engineered bacteria of the present invention can be cloned into one vector and introduced into Escherichia coli, or cloned into different vectors and introduced into Escherichia coli. Due to the carrying capacity of the vector and the carrying capacity of the number of exogenous vectors of Escherichia coli, it is preferred that the genes used to construct the genetically engineered bacteria of the present invention are cloned into 2-3 vectors and introduced into Escherichia coli.

[0077] There is no particular limitation on the order in which the genes used to construct the genetically engineered bacteria of the present invention are arranged in the vector, as long as they can be effectively expressed.

[0078] In a second aspect, the present invention provides the use of the genetically engineered bacteria as described above in the production of rosavirin.

[0079] In a third aspect, the present invention provides a method for heterologous de novo synthesis of rosavirin in a microorganism, wherein the genetically engineered bacteria as described above are cultured in a medium containing glucose, and the expression of exogenous genes is induced to produce rosavirin.

[0080] According to the present invention, the culture conditions are conventional culture conditions, such as using a culture medium containing antibiotics as a selection marker, culturing at 35-40°C until OD 600 is 0.5-0.7, and then isopropyl-β-D-thiogalactoside (IPTG) is added to induce expression at 14-20° C. During fermentation culture, the above genes can be translated into corresponding proteins and make the corresponding proteins play their roles.

[0081] Wherein, taking the genetically engineered bacteria as Escherichia coli as an example, the culture medium can be LB culture medium (the solvent is water, and the solutes and their final concentrations are: Tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L), or modified M9Y (Na 2 HPO 4 12H 2 O 15.12g / L, KH 2 PO 4 3.0g / L, NaCl 0.5g / L, MgSO 4 7H2O 0.5g / L, CaCl2 0.011g / L, NH 4 Cl 1.0 g / L, Tryptone 15 g / L, yeast extract 5 g / L, glucose 20 g / L) liquid medium, or modified M9Y (Na 2 HPO 4 12H 2 O 15.12g / L, KH 2 PO 4 3.0g / L, NaCl 0.5g / L, MgSO 4 7H 2 O 0.5 g / L, CaCl 2 0.011g / L, NH 4 Cl 1.0 g / L, Tryptone 15 g / L, yeast extract 5 g / L, glucose 10 g / L, arabinose 10 g / L) liquid culture medium, which can be selected by those skilled in the art according to actual conditions.

[0082] According to the present invention, when the obtained genetically engineered bacteria are cultured to produce rosavirin, it is also preferred to activate the constructed genetic engineering to prepare a seed solution, for example, by culturing at 35-40° C. for 12-20 hours in a culture medium containing antibiotics used as selection markers.

[0083] According to a preferred embodiment of the present invention, the above LB medium can be used for the activation of genetically engineered bacteria, that is, to prepare seed solution. The above modified M9Y medium can be used for the production of rosavidin. Preferably, for the above genetically engineered bacteria containing arabinokinase and uridine diphosphate sugar pyrophosphorylase, the above modified M9Y medium containing arabinose can be used for the production of rosavidin. Among them, the inoculation amount of the seed solution can also be a conventional choice in the art, for example, the inoculation amount is 1% by volume, that is, 1 mL of the seed solution is added to every 100 mL of M9Y liquid culture medium.

[0084] In addition, the present invention has no particular limitation on the concentration of IPTG. Preferably, the amount of IPTG added can make its final concentration in the M9 liquid culture medium be 0.08-0.12 mM.

[0085] According to the present invention, the antibiotic is an antibiotic used as a selection marker on the expression vector. Taking the commonly used transformation vector of Escherichia coli as an example,

[0086] The antibiotics, for example, can be streptomycin and kanamycin; the concentrations of the antibiotics are conventionally selected in the art, for example, the amount of streptomycin added is such that its final concentration is 80-120 mg / L; the amount of kanamycin added is such that its final concentration is 40-60 mg / L; the amount of ampicillin added is such that its final concentration is 50-100 mg / L.

[0087] The present invention will be described in detail below by way of examples.

[0088] In the following examples, E. coli strain BL21 (DE3) and E. coli DH5α were purchased from Beijing Quanshijin Biotechnology Co., Ltd. E. coli strain BL21 (DE3) was used for the expression of all genes in the present invention, and E. coli DH5α was used for the cloning of all genes in the present invention. E. coli BPHE with high phenylalanine production was created in this experiment and used for the fermentation production of rosavidin.

[0089] E. coli expression vectors pCDFDuet-1, pRSFDuet-1, and pETDuet-1 were purchased from Novagen.

[0090] Phusion high-fidelity DNA polymerase and 2×High-fidelity Master Mix were purchased from Thermo Company.

[0091] ClonExpress Multis One Step Cloning Kit was purchased from Vazyme.

[0092] All primers and genes used were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0093] The experimental methods in the following examples without specifying specific conditions were carried out according to conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual", or according to the conditions recommended by the manufacturers of the corresponding biological reagents.

[0094] The phenylalanine ammonia lyase gene PAL is from Arabidopsis thaliana (AtPAL, GenBank: AY133595.1).

[0095] The 4-coumarate-CoA ligase or cinnamate-CoA ligase gene 4CL or CNL is from parsley (Pc4CL, GenBank: X13325.1); or from Hypericum perforatum (HcCNL, GenBank: JQ743645.1).

[0096] The cinnamoyl-CoA reductase gene CCR is from Arabidopsis thaliana (AtCCR, GenBank: AF332459.1); or from ryegrass (LpCCR1, GenBank: AY061888).

[0097] The glucosyltransferase gene UGT is from Arabidopsis thaliana (AtUGT73C5, GenBank: KJ138865.1); or from Bacillus subtilis (BsYjiC, GenBank: CP053102.1).

[0098] The sugar chain elongation arabinosyltransferase gene UGT91R1 is from tomato (S1UGT91R1, GenBank: AK323431.1).

[0099] The gene encoding phosphoglucomutase is from the endogenous gene EcPgm of Escherichia coli, Gene ID 945271.

[0101] The gene encoding UTP-glucose 1-phosphate uridyltransferase is from the endogenous gene EcGalU of Escherichia coli, GeneID 945231.

[0102] The gene encoding UDP-glucose dehydrogenase is from the endogenous gene EcUGD of Escherichia coli, Gene ID 946571.

[0103] The gene encoding UDP-xylose synthase is from Sinorhizobium meliloti (SmUXS, Genbank: GU062741).

[0104] The gene encoding UDP-xylose-4-epimerase is from Sinorhizobium meliloti (SmUXE, Genbank: HM004122).

[0105] The gene encoding arabinokinase is from Paludisphaera borealis (PbAraK, Genbank: WP_083713045.1)

[0106] The gene encoding UDP-sugar pyrophosphorylase is from Arabidopsis thaliana (AtUSP gene, Genbank: NM_124635.4)

[0107] Plasmids pKD46 (temperature-sensitive, containing exo, bet and gam genes regulated by arabinose promoter, Ampr), pKD4 (containing kanamycin resistance gene with FRT sites at both ends, Kanr), and pCP20 (temperature-sensitive, encoding FLP recombinase that can recognize FRT sites, Ampr) are all commercially available.

[0108] Example 1

[0109] This example is used to illustrate the reconstruction of the rosavidin synthesis pathway in high-phenylalanine-producing Escherichia coli.

[0110] The high-phenylalanine-producing Escherichia coli strain BPHE does not express tyrR (DNA-binding transcriptional dual regulator), tyrA (fused chorismate mutase / prephenate dehydrogenase), trpE (anthranilate synthase subunit) and pykF (pyruvate kinase 1) genes (i.e., the trpE, tyrR, tyrA and pykF genes are knocked out in the original strain Escherichia coli BL21 strain), and its construction method refers to patent application number 201910403327.6 (Liu Tao, Bi Huiping, Wang Shuai, Zhuang Yibin, Ma Yanhe. Rosavi analogs and genetically engineered bacteria for producing the same and their applications).

[0111] The Escherichia coli expression vector V1 is pCDFDuet-4CL-PAL-CCR. The preparation method of the vector refers to patent ZL201611179577.9 (Liu Tao, Zhou Wei, Bi Huiping, Zhuang Yibin, Yin Hua, Ma Yanhe. Recombinant Escherichia coli for producing cinnamyl alcohol and linalool, construction method and application).

[0112] The E. coli expression vector V2 is pRSFDuet-AtUGT73C5-SlUGT91R1. The preparation method of the vector refers to patent ZL201910403327.6 (Liu Tao, Bi Huiping, Wang Shuai, Zhuang Yibin, Ma Yanhe. Rosavi analogs and genetically engineered bacteria for producing the same and their applications). The CaUGT3 gene fragment in the original expression vector pRSFDuet-AtUGT73C5-CaUGT3 is replaced with SlUGT91R1. The specific method is as follows:

[0113] (1) Using primers 73C5-5FPBam / 73C5-3RPSal as guides and the synthetic AtUGT73C5 gene (whose nucleotide sequence was optimized based on the codon preference of the host cell, and the same was true for the subsequent steps, so no further explanation was given) as a template, PCR was performed to amplify the AtUGT73C5 gene, which was then digested with BamHI and SalI and ligated into the plasmid pRSFDuet1 digested with BamHI and SalI to construct pRSFDuet-AtUGT73C5.

[0114] (2) Using primers SlUGT91R1-5FPKpn / SlUGT91R1-3RPPac as guides and the synthetic SlUGT91R1 gene as a template, PCR was performed to amplify the SlUGT91R1 gene, which was digested with KpnI and PacI and then ligated into the plasmid pRSFDuet-AtUGT73C5 digested with KpnI and PacI to construct pRSFDuet-AtUGT73C5-SlUGT91R1.

[0115] The E. coli expression vector V3 is pETDuet-EcUGD-SmUXS-SmUXE. The preparation method of the vector refers to patent ZL201910403327.6 (Liu Tao, Bi Huiping, Wang Shuai, Zhuang Yibin, Ma Yanhe. Rosavi analogs and genetically engineered bacteria for producing the same and their applications). A UDP xylose-4-epimerase gene SmUXE is connected to the original expression vector pETDuet-EcUGD-SmUXS. The specific method is as follows:

[0116] (1) PCR was performed using primers EcUGD-5FPNco / EcUGD-3RPNot as guides and Escherichia coli BL21 (DE3) culture medium as a template to amplify the EcUGD gene, which was then digested with NcoI and NotI and ligated into the plasmid pETDuet-1 digested with NcoI and NotI to construct pETDuet-EcUGD.

[0117] (2) Using primers SmUXS-5FPNde / SmUXS-3RPKpn as guides and the synthetic codon-optimized SmUXS gene as a template, PCR was performed to amplify the SmUXS gene, which was then digested with NdeI and KpnI and ligated into the plasmid pETDuet-EcUGD digested with NdeI and KpnI to construct pETDuet-EcUGD-SmUXS.

[0118] (3) Using primers T7SmUXE-5Not / T7SmUXE-3Afl as guides and the synthetic codon-optimized SmUXE gene as a template, PCR was performed to amplify the T7-SmUXS gene, which was digested with NotI and AflII and ligated into the plasmid pETDuet-EcUGD-SmUXS digested with NotI and AflII to construct pETDuet-EcUGD-SmUXS-SmUXE.

[0119] The vectors V1 (pCDFDuet-4CL-PAL-CCR), V2 (pRSFDuet-AtUGT73C5-SlUGT91R1) and V3 (pETDuet-EcUGD-SmUXS-SmUXE) were co-transformed into high-yield phenylalanine Escherichia coli BPHE to obtain the Escherichia coli strain BPHE-RV0 that produces rosavidin. Figure 1 shown.

[0120] In steps (1), (2) and (3) above, the reaction system for the PCR amplification reaction is: 10 μL of 5× phusion HF buffer, 2.5 μL of 2.5 mM dNTP, 0.5 μL of 50 μM forward primer, 0.5 μL of 50 μM reverse primer, 0.5 μL of template, 0.5 μL of Phusion DNA polymerase, and 35.5 μL of water.

[0121] The reaction program of PCR amplification reaction was as follows: pre-denaturation at 98°C for 2 minutes; denaturation at 98°C for 20 seconds, annealing at 56°C for 45 seconds, extension at 72°C for 2 minutes, 30 cycles; and extension at 72°C for 10 minutes.

[0122] As in the above steps, plasmids V1 (pCDFDuet-4CL-PAL-CCR), V2 (pRSFDuet-AtUGT73C5-SlUGT91R1) and V3 (pETDuet-EcUGD-SmUXS-SmUXE) were transformed into the high-yielding phenylalanine Escherichia coli strain BPHE by electroporation. The transformation method is as follows: strain BPHE stored at -80°C was streaked on an antibiotic-free LB plate, cultured overnight in a 37°C incubator, and a single clone was picked into a test tube containing 4 mL of antibiotic-free LB culture medium, and cultured at 37°C, 220 rpm, for 12-16 hours as a seed solution. The seed solution was inoculated in a 250 mL Erlenmeyer flask containing 50 mL of antibiotic-free LB culture medium at a ratio of 1:50, and cultured at 37°C, 220 rpm, until OD 600=0.4-0.5. Transfer the bacterial solution into a 50mL sterile centrifuge tube, centrifuge at 4°C, 4000rpm for 10 minutes, remove the supernatant, and resuspend the bacteria with an equal volume of pre-cooled sterile water. Centrifuge at 4°C, 4000rpm for 10 minutes, remove the supernatant, and resuspend the bacteria with 1 / 2 volume of pre-cooled sterile water. Centrifuge at 4°C, 4000rpm for 10 minutes, remove the supernatant, and resuspend the bacteria with 200μL of pre-cooled sterile water to obtain BPHE competent cells. Take 100μL of BPHE competent cells, add 1μL of plasmids V1, V2 and V3, mix gently, place on ice for 30 minutes, and then transform by electroporation. Immediately add 1000μL of anti-antibody LB liquid culture medium, shake at 37°C, 220rpm for 60 minutes, and then spread the bacterial solution on an LB plate containing streptomycin, kanamycin and ampicillin. The transformed strain BPHE-RV0 carrying three expression vectors was screened by using streptomycin, kanamycin and ampicillin resistance, and the recombinant Escherichia coli strain BPHE-RV0 capable of synthesizing rosavirin was obtained by extracting plasmids for enzyme digestion verification. Figure 1 Middle a.

[0123] Table 1 Primers used in this example

[0124]

[0125] Example 2

[0126] This example is used to illustrate the effects of different cinnamate-CoA ligases (CNL) / 4-coumarate-CoA ligases (4CL) and cinnamoyl-CoA reductases (CCR) on the production of cinnamyl alcohol by recombinant Escherichia coli strains.

[0127] Taking the E. coli expression vector V4 as pCDFDuet-AtPAL-HcCNL-LpCCR1 as an example, the preparation method of vectors containing different CNL or 4CL is described. The plasmid pCDFDuet-AtPAL-Pc4CL-AtCCR is used as a template and pAPA-1 / pAPA-5 are used as primers to amplify the plasmid backbone fragment; the synthetic HcCNL (GenBank: JQ743645.1) gene is used as a template and pET-F / Hc-R are used as primers to amplify the HcCNL gene fragment; the two fragments are constructed by seamless cloning to obtain the plasmid pCDFDuet-AtPAL-HcCNL-AtCCR. Using plasmid V1 as template and CCR-1 / CCR-2 as primers, the plasmid backbone fragment was amplified; using the synthetic LpCCR1 gene (GenBank:AY061888) as template and LpCCR1-1 / LpCCR1-2 as primers, the LpCCR1 gene fragment was amplified; the two fragments were constructed by seamless cloning to obtain the plasmid pCDFDuet-AtPAL-HcC NL-LpCCR1.

[0128] The construction of the vector pCDFDuet-AtPAL-Pc4CL / Ph4CL1 / Gm4CL4 / HcCNL / Os4CL3-AtCCR containing different CNLs or 4CLs can be found in V4. Ph4CL1 (GenBank: JN120849), Gm4CL4 (GenBank: X69955), HcCNL and Os4CL3 (GenBank: Os02g08100) are from Petunia hybrid, Glycine max, Hypericumcalycinum and Oryza sativa, respectively. Vector V1 and the series of vectors were transformed into Escherichia coli BPHE to obtain the cinnamyl alcohol-producing recombinant strains BPHE-CA1 and BPHE-CA2 to CA 5. BPHE-CA1 (containing vector V1 (pCDFDuet-4CL-PAL-CCR)) was used as a control. The yield of cinnamyl alcohol after 24 hours of shake flask fermentation is shown in Figure 2. Figure 2 As shown in a. Among them, BPHE-CA4 had the highest cinnamyl alcohol yield of 396.8±1.6 mg / L, which was 14.2% higher than the control BPHE-CA1. BPHE-CA2 was 5.4% higher than BPHE-CA1. BPHE-CA3 and CA5 had lower cinnamyl alcohol yields than BPHE-CA1.

[0129] The construction of vector pCDFDuet-AtPAL-Pc4CL-AtCCR / EuCCR / LpCCR1 / OsCCR1 containing different CCRs can be found in the construction process of material V4. Among them, EuCCR (GenBank: X79566.1) and OsCCR1 (GenBank: AK064401) are from Eucalyptus gunnii, Lolium perenne and O. sativa, respectively. The vectors were transformed into Escherichia coli BPHE to obtain cinnamyl alcohol-producing recombinant strains BPHE-CA6-CA8. The yield of cinnamyl alcohol after 24 hours of shake flask fermentation is shown in Figure 2. Figure 2 As shown in a, BPHE-CA7 had the highest cinnamyl alcohol yield of 398.4±3.6 mg / L, which was 14.6% higher than that of the control BPHE-CA1.

[0130] The CNL and CCR with the highest yields were combined to construct the vector pCDFDuet-AtPAL-HcCNL-LpCCR1, and the strain BPHE was transformed to obtain the strain BPHE-AHL with the highest cinnamyl alcohol production. The cinnamyl alcohol production was as follows after 24 hours of shake flask fermentation: Figure 2 As shown in a, the cinnamyl alcohol yield reached 424.2±10.8 mg / L, which was 22.1% higher than that of the control strain BPHE-CA1.

[0131] Table 2 Primers used in this example

[0132] Primers Nucleotide sequence pAPA-1 GGATCCGAATTCCGAAATTAATAC pAPA-5 ATTTCCTAATGCAGGAGTCGCATA pET-F ACTCCTGCATTAGGAAATGAGATCTCGATCCCGCGAAAT Hc-R ATTTCGGAATTCGGATCCTTACAGGCGGCTCATCGC CCR-1 GGTACCCTCGAGTCTGGTAAAGAAAC CCR-2 ATGTATATCTCCTTCTTATACTTAAC LpCCR1-1 TAAGAAGGAGATATACATATGACCATTGCGGAAGTTGTG LpCCR1-2 CCAGACTCGAGGGTACCTTACGCGCGAATGGTCACGC

[0133] Example 3

[0134] This example is used to illustrate the effect of carboxylic acid reductase on the yield of cinnamyl alcohol produced by recombinant Escherichia coli strains.

[0135] Construction of recombinant Escherichia coli strains containing carboxylic acid reductase (CAR) and phosphopantetheinyl transferase (PPTase): The Escherichia coli expression vector V5 is pETDuet-AtPAL-MmCAR-NiNPT, and the preparation method of the vector is as follows:

[0136] The MmCAR gene fragment was amplified by PCR using primers MmCAR-1 / MmCAR-2 as guides and the synthetic MmCAR gene (GenBank: 34343525) as template; the NiNPT gene fragment was amplified by PCR using primers NiNPT-1 / NiNPT-2 as guides and the synthetic NiNPT gene (GenBank: WP_218470469.1) as template; the AtPAL gene and plasmid backbone fragment were amplified by PCR using primers pAPA-1 / pAPA-5 as guides and the plasmid pCDFDuet-AtPAL-Pc4CL-AtCCR as template. pCDFDuet-AtPAL-MmCAR-NiNPT was constructed by ligation using ClonExpress Multis One Step Cloning Kit. MmCAR and NiNPT were from Mycobacterium marinum and Nocardia iowensis, respectively. The vector V5 was electrotransformed into the high-yield phenylalanine Escherichia coli BPHE according to the method described in Example 1 to obtain the recombinant Escherichia coli strain BPHE-AMN optimized for synthesizing rosavin precursor cinnamyl alcohol. The yield of cinnamyl alcohol was as follows after 24 hours of shake flask fermentation: Figure 2 As shown in middle b, the cinnamyl alcohol production reached 378.9±4.6 mg / L, which was 9.2% lower than that of the control strain BPHE-AHL.

[0137] Table 3 Primers used in this example

[0138] Primers Nucleotide sequence MmCAR-1 CGACTCCTGCATTAGGAAATTAATACGACTCACTATAGGGG MmCAR-2 GGTATATCTCCTTTTATTAGAGCTC NiNPT-1 GAGCTCTAATAAAAGGAGATATACCATGATTGAAACCATTCTGCCGG NiNPT-2 ATTTCGGAATTCGGATCCTTACGCATACGCAATCGCGG

[0139] Example 4

[0140] This comparative example is used to illustrate the effect of different glycosyltransferases on the conversion rate of cinnamyl alcohol to chelating agent.

[0141] The prokaryotic expression vectors pET28a-AtUGT73C5 and pET28a-BsYjiC containing AtUGT73C5 and Bs-YjiC were respectively transferred into Escherichia coli BL21 (DE3), and single clones were picked into 4 mL LB liquid medium containing kanamycin, and cultured overnight at 37°C and 220 rpm as seed liquid. The culture was inoculated into 250 mL Erlenmeyer flasks containing 50 mL LB liquid medium containing kanamycin at a ratio of 1:50, and cultured at 37°C and 220 rpm until OD 600 =0.6-0.8, add 0.1mM IPTG, induce at 16℃, 220rpm for 16 hours. Collect the bacterial solution by centrifugation at 4℃, 4000rpm, resuspend the bacteria in 5mL50mM Tris-HCl buffer (pH7.4), disrupt the cells by ultrasonication, centrifuge at 4℃, 12000rpm for 10 minutes, and collect the supernatant as the crude enzyme solution. Take 100μL of the crude enzyme solution, add 1mM cinnamyl alcohol and 1mM UDP-glucose, let it stand at 30℃ for 2 hours, add an equal volume of methanol and 5μL 10% trifluoroacetic acid to terminate the reaction. Centrifuge at 4℃, 12000rpm for 10 minutes, filter the supernatant through a 0.22μm filter membrane, and detect by HPLC. The results are as follows Figure 3 As shown in a, the conversion rate of cinnamyl alcohol by Bs-YjiC was 22.4%, which was significantly higher than that of AtUGT73C5 (7.6%).

[0142] Example 5

[0143] This comparative example is used to illustrate the effect of different glycosyltransferases on the conversion rate of rosal to rosalvin.

[0144] UGT91R family UGTs from different sources were selected, including those from Solanum lycopersicum (SlUGT91R1, GenBank: XP_004250158.1), Solanum pennellii (SpUGT91R4, GenBank: XP_015057265.1), Nicotiana tabacum (NtUGT91R1, GenBank: XP_016441370.1) and Camellia sinensis (CsUGT91R1, GenBank: XP_028073379.1), the gene was synthesized and cloned into the prokaryotic expression vectors pET28a-SlUGT91R1, pET28a-SpUGT91R4, pET28a-NtUGT91R1 and pET28a-CsUGT91R1, and transferred into Escherichia coli BL21 (DE3), respectively. The crude enzyme was prepared according to Example 4. Take 100 μL of crude enzyme solution, add 1 mM chelator and 1 mM UDP-arabinose or UDP-xylose, let it stand at 30°C for 2 hours, and add an equal volume of methanol and 5 μL 10% trifluoroacetic acid to terminate the reaction. Centrifuge at 4°C, 12000 rpm for 10 minutes, filter the supernatant through a 0.22 μm filter membrane, and detect with HPLC. The results are as follows Figure 3 As shown in b, the conversion rate of Bs-YjiC to cinnamyl alcohol was 22.4%, significantly higher than AtUGT73C5 (7.6%). The conversion rates of SlUGT91R1, NtUGT91R1, CsUGT91R1 and SpUGT91R4 to chelate and UDP-arabinose were 37.2%, 28.5%, 9.3% and 3.0%, respectively, with SlUGT91R1 having the highest conversion rate.

[0145] Example 6

[0146] This example is used to illustrate the reconstruction of the high-yield rosavidin synthesis pathway of the precursor substance rosavidin in high-phenylalanine-producing Escherichia coli.

[0147] The E. coli expression vector V6 is pRSFDuet-BsYjiC-SlUGT91R1, and the AtUGT73C5 gene fragment in the original expression vector V2 (pRSFDuet-AtUGT73C5-SlUGT91R1) is replaced with BsYjiC. The specific method is as follows:

[0148] Using primers BsYjiC-5FPseamBamH / BsYjiC-3RPseamSal as guides and the synthetic Bs-YjiC gene as a template, PCR was performed to amplify the Bs-YjiC gene, which was then connected to the plasmid pRSFDuet-1 linearized by BamHI and SalI using ClonExpress Multis One Step Cloning Kit to construct pETDuet-BsYjiC. Using primers SlUGT91R1-5FPseamKpn / SlUGT91R1-3RPseamPac as guides and the synthetic SlUGT91R1 gene as a template, PCR was performed to amplify the SlUGT91R1 gene, which was then connected to the plasmid pETDuet-BsYjiC linearized by KpnI and PacI using ClonExpress Multis One Step Cloning Kit to construct pRSFDuet-BsYjiC-SlUGT91R1.

[0149] The vector V4 (pCDFDuet-AtPAL-HcCNL-LpCCR1) and the vectors V6 (pRSFDuet-BsYjiC-SlUGT91R1) and V3 (pETDuet-EcUGD-SmUXS-SmUXE) were transformed into the high-yield phenylalanine Escherichia coli BPHE described in Example 1 according to the method described in Example 1 to obtain the recombinant Escherichia coli strain BPHE-RV1 that can produce a high yield of the rosavidin precursor substance rosavidin. The synthetic pathway from glucose to rosavidin is as follows Figure 1 As shown in a.

[0150] Table 4 Primers used in this example

[0151]

[0152] Example 7

[0153] This example is used to illustrate the reconstruction of the UDP-arabinose salvage pathway for synthesizing rosavidin with glucose and arabinose as substrates in high-phenylalanine-producing Escherichia coli.

[0154] The E. coli expression vector V7 is pETDuet-PbAraK-AtUSP, and the preparation method of the vector is as follows:

[0155] (1) The PbAraK gene (Genebank: WP_083713045.1) was synthesized by subcloning into the pET28a expression vector via BamHI and XhoI, and then digested with BamHI and XhoI and then ligated into the pETDuet-1 plasmid digested with BglII and XhoI to obtain pETDuet-PbAraK.

[0156] (2) The codon-optimized AtUSP gene (Genebank: NP_568775.1) was synthesized by subcloning into the pET28a expression vector via NdeI and BamHI, and then digested with NdeI and BamHI and then ligated into the pETDuet-PbAraK plasmid digested with NdeI and BamHI to obtain the vector pETDuet-PbAraK-AtUSP.

[0157] The vectors V4, V6 and V7 were electrotransformed into high-phenylalanine-producing Escherichia coli BPHE according to the method described in Example 1 to obtain the recombinant Escherichia coli strain BPHE-RV2 for synthesizing rosavidin and optimizing the precursor rosavidin. Figure 1 As shown in b.

[0158] Example 8

[0159] This example is used to illustrate the effect of ushA and lacZ gene knockout on the yield of rosavidin.

[0160] The Escherichia coli BPHEUZ with high phenylalanine production and hydrolase knockout is based on BPHE, with the UDP-glucose hydrolase gene ushA (5'-nucleotidase / UDP-sugar hydrolase) and the β-galactosidase gene lacZ (β-galactosidase) knocked out. The preparation method of the strain is as follows:

[0161] According to the present invention, the method for making the ushA and lacZ genes on the chromosome of Escherichia coli non-expressed can be a conventional method in the art, for example, it can be performed by a gene knockout method, or it can be performed by a gene silencing method. The present invention is preferably performed by a gene knockout method. In the present invention, there are no special requirements for the gene knockout method, and it can be various methods that can be used to knock out genes in Escherichia coli, such as using the CRISPR-Cas9 gene editing system. Using Escherichia coli BPHE as the starting strain, the plasmid pCas9 (temperature-sensitive, containing Cas9 and gRNA genes, exo, bet and gam genes regulated by the arabinose promoter, Kan r ) is kept by this laboratory.

[0162] Primers ushA-n20-5FP / ushA-n20-3RP were used to amplify the pCas9 plasmid backbone containing the ushA gene-specific gRNA region, primers ushA-up-5FP / ushA-up-3RP were used to amplify the upstream homology arm of the ushA gene, primers ushA-dn-5FP / ushA-dn-3RP were used to amplify the downstream homology arm of the ushA gene, and primers ushA-cas-5FP / ushA-cas-3RP were used to amplify the pCas9 plasmid backbone containing the Cas9 protein. The four PCR products were seamlessly cloned and assembled into the ushA gene knockout plasmid pCas9-ushA via ClonExpress Multis One Step CloningKit.

[0163] Primers lacZ-n20-5FP / lacZ-n20-3RP were used to amplify the pCas9 plasmid backbone containing the lacZ gene-specific gRNA region, primers lacZ-up-5FP / lacZ-up-3RP were used to amplify the upstream homology arm of the lacZ gene, primers lacZ-dn-5FP / lacZ-dn-3RP were used to amplify the downstream homology arm of the lacZ gene, and primers lacZ-cas-5FP / lacZ-cas-3RP were used to amplify the pCas9 plasmid backbone containing the Cas9 protein. The four PCR products were seamlessly cloned and assembled into the lacZ gene knockout plasmid pCas9-lacZ using the ClonExpress Multis One Step Cloning Kit.

[0164] The gene knockout plasmid pCas9-ushA was transformed into the BPHE strain by electroporation, and the transformants were picked into 2 mL LB liquid culture medium (Kan resistance, 20 mM arabinose induction) and cultured at 30°C, 220 rpm overnight. Then, single clones were streaked on LB plates containing Kan, and positive transformants were verified by PCR using the ushA gene knockout verification primers ushA-GD-5 / ushA-GD-3. They were streaked on LB plates without resistance and cultured at 42°C overnight to lose the plasmid. Then, single clones were picked and streaked on LB plates without resistance and LB plates containing Kan, and single clones that successfully lost resistance were verified by PCR using the ushA gene knockout verification primers ushA-GD-5 / ushA-GD-3. The PCR product was sequenced to verify the successful knockout of the ushA gene, and the recombinant strain BPHEU was obtained.

[0165] The lacZ gene was knocked out by the same method, and the recombinant strain BPHEUZ with knocked out genes ushA and lacZ was obtained based on the phenylalanine high-producing strain BPHE. The primers used for knocking out lacZ gene verification were lacZ-GD-5 / lacZ-GD-3.

[0166] The vectors V4, V6 and V7 were electrotransformed into Escherichia coli BPHEU and BPHEUZ according to the method described in Example 1 to obtain recombinant Escherichia coli strains BPHEU-RV and BPHEUZ-RV that synthesize rosavirin.

[0167] Table 5 Primers used in this example

[0168]

[0169]

[0170] Test Example 1

[0171] Used to illustrate the shake flask fermentation culture of Escherichia coli recombinant strains BPHE-RV0, BPHE-RV1, BPHE-RV2, BPHEU-RV and BPHEUZ-RV and the identification of the products.

[0172] (1) Shake flask fermentation

[0173] The E. coli recombinant expression strains BPHE-RV0, BPHE-RV1, BPHE-RV, BPHEU-RV and BPHEUZ-RV constructed in the above example were inoculated into 4 ml of LB liquid medium containing antibiotics as screening markers (streptomycin, kanamycin and ampicillin, with final concentrations of 100 mg / L, 50 mg / L and 100 mg / L, respectively), and cultured at 37°C for 12 hours to obtain E. coli seed liquid. The obtained E. coli seed liquid was inoculated into 50 mL of modified M9Y liquid fermentation medium containing the antibiotics as screening markers (streptomycin, kanamycin and ampicillin, with final concentrations of 100 mg / L, 50 mg / L and 100 mg / L, respectively) at an inoculum amount of 1% by volume, and cultured at 37°C. When OD 600 When the pH value reached 0.6, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to make the final concentration 0.1 mM, and the culture was induced at 16°C for 16 hours.

[0174] For the BPHE-RV0 and BPHE-RV1 strains, glucose was added at a final concentration of 20 g / L, and fermentation was carried out at 30° C. for 48 hours to obtain fermentation broth A and fermentation broth B containing cinnamyl alcohol, rosin, and rosin.

[0175] For the BPHE-RV2, BPHEU-RV and BPHEUZ-RV strains, glucose was added at a final concentration of 10 g / L and fermented at 30°C for 24 hours. Then, 10 g / L arabinose was added and fermented at 30°C for 24 hours to obtain a fermentation broth containing cinnamyl alcohol, rosin and rosin.

[0176] (2) Product testing

[0177] 1) HPLC detection of the product: 1 mL of the fermentation broth was centrifuged at 12000 rpm for 5 min, and the supernatant was taken for HPLC analysis. The analysis conditions were as follows: the instrument was an Agilent liquid chromatograph, and the measurement conditions included: C18 column (4.6×250 mm); detection wavelength was 254 nm; mobile phase A = water (containing 0.1% volume formic acid), B = acetonitrile; flow rate = 1 mL / min; gradient elution conditions: 0-5 min 20% volume B; 6-25 min 20% volume B to 100% volume B (the concentration of B increased evenly within 6-25 min); 25-30 min, 100% B; 31-40 min, 20% B. The injection volume was 20 μL.

[0178] The results of HPLC test of fermentation broth are shown in Figure 4 Three target product peaks appeared in shake flask fermentation strains BPHE-RV0, BPHE-RV1, BPHE-RV2, BPHEU-RV and BPHEUZ-RV.

[0179] 2) LC-MS and NMR analysis of the product: The peaks monitored in each fermentation broth in step (1) were subjected to LC-MS analysis, wherein the conditions for the LC-MS analysis included: C18 column (4.6×250 mm); detection wavelength 254 nm; gradient elution conditions: 0-5 min 20% volume B; 6-25 min 20% volume B to 100% volume B (the concentration of B increased evenly within 6-25 min); 25-30 min, 100% B; 31-40 min, 20% B. Injection volume 50 μL. ESI positive ion source, molecular weight scanning range 50-1000.

[0180] The ms scan results of product peaks 1-3 are as follows Figure 5 As shown, the MS spectrum of peak 1 has the MS characteristic peak 117.0700 of cinnamyl alcohol, the MS spectrum of peak 2 has the MS characteristic peak 319.1151 of rosal, and the MS spectrum of peak 3 has the MS characteristic peaks 446.2007 and 451.1570 of rosal. Through further one-dimensional and two-dimensional NMR and comparison with the NMR spectrum of rosal standard, it can be determined that peak 3 is rosal, which is an important active ingredient of Rhodiola rosea. The NMR data are as follows. Figure 6 As shown, wherein A is 1H NMR and B is 13C NMR.

[0181] It was determined that the strain BPHEUZ-RV had the highest rosavidin production in the shake flask fermentation broth, which could reach 1203.7 mg / L, and the remaining rosavidin and cinnamyl alcohol were 4.3 mg / L and 156.0 mg / L, respectively. The rosavidin production of strain BPHE-RV0 was 119.9 mg / L, and the remaining rosavidin and cinnamyl alcohol were 56.6 mg / L and 109.0 mg / L, respectively. The rosavidin production of strain BPHE-RV1 was 430.5 mg / L, and the remaining rosavidin and cinnamyl alcohol were 86.2 mg / L and 173.4 mg / L, respectively. The rosavidin production of strain BPHE-RV2 was 1071.1 mg / L, and the remaining rosavidin and cinnamyl alcohol were 4.5 mg / L and 80.6 mg / L, respectively. The rosavidin production of strain BPHEU-RV was 1101.3 mg / L, and the remaining rosavidin and cinnamyl alcohol amounts were 4.1 mg / L and 79.5 mg / L, respectively. Figure 7 ).

[0182] Test Example 2

[0183] Used to illustrate the production of Rosavi using a 5L fermenter culture of the recombinant Escherichia coli strain BPHEUZ-RV.

[0184] A single clone of the recombinant expression strain BPHEUZ-RV of Escherichia coli constructed in Example 8 was picked and inoculated into a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium and corresponding antibiotics (streptomycin, kanamycin and ampicillin, with final concentrations of 100 mg / L, 50 mg / L and 100 mg / L, respectively), and cultured at 37°C for 12 hours to obtain an Escherichia coli seed solution.

[0185] The seed solution was inoculated into a 5L fermenter containing 2.5L of modified M9Y medium at a volume of 5%. The culture was carried out at 37°C. When OD 600 When the temperature reached 25.0, 0.2 mM IPTG was added and induced at 16°C for 16 hours. The temperature was raised to 30°C and 800 g / L glucose was added. After 9 hours, 500 g / L arabinose was added to control the residual sugar concentration to be less than 2 g / L. The ventilation was set to 3 L / min, and the dissolved oxygen was controlled at about 30% by coupling with the speed. The pH was controlled at about 7.0 by adding ammonia water. The growth and yield curve of strain BPHEUZ-RV is shown in Figure 1. Figure 8 As shown, with the addition of arabinose, the production of rosavidin increased rapidly, reaching 7539.1±228.7 mg / L in 61 hours, and then the production of rosavidin increased slowly, and rosavidin accumulated slowly, with the remaining rosavidin at 1208.4±16.9 mg / L in 72 hours.

[0186] The Escherichia coli of the present invention can ferment and produce three compounds, namely, rosavirin, rosavidin and cinnamyl alcohol, among which rosavirin is an important active ingredient of Rhodiola rosea, with a maximum yield of 7539.1±228.7 mg / L. The present invention realizes the heterologous synthesis of rosavirin, an important natural active product, in microorganisms, lays a foundation for large-scale industrial production, and has important economic value and social benefits.

[0187] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0188] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0189] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A genetically engineered bacterium for producing rosavidin, It is characterized in that The gene encoding phenylalanine ammonia lyase, the gene encoding 4-coumarate CoA ligase, the gene encoding cinnamoyl CoA reductase, the gene encoding glucosyltransferase, the gene encoding UDP glucose dehydrogenase, the gene encoding UDP xylose synthase, the gene encoding UDP xylose 4-epimerase and the gene encoding sugar chain elongation arabinosyltransferase UGT91R1 were introduced into the starting bacteria for expression to achieve the microbial de novo synthesis of rosavidin.

2. The genetically engineered bacterium according to claim 1, It is characterized in that The sugar chain elongation arabinosyltransferase is from the UGT91R subfamily, specifically from Solanum lycopersicum SlUGT91R1, Nicotiana tabacum NtUGT91R1, Camellia sinensis CsUGT91R1 and Solanum pennellii The SpUGT91R4 gene.

3. The genetically engineered bacterium according to claim 1, It is characterized in that The gene encoding phenylalanine ammonia-lyase is selected from the phenylalanine ammonia-lyase gene AtPAL from Arabidopsis thaliana ; The gene encoding 4-coumarate CoA ligase / cinnamate CoA ligase is selected from Petunia hybrid、Glycine max , Oryza sativa and Hypericum calycinum Ph4CL1, Gm4CL4, Os4CL3, and HcCNL; The gene encoding cinnamoyl-CoA reductase is selected from Eucalyptus gunnii , Loliumperenne and Oryza sativa EuCCR, LpCCR1, and OsCCR1 genes; The gene encoding UDP glucose syltransferase is selected from a gene encoding UDP glucose syltransferase UGT73C5 or a gene encoding UDP glucose syltransferase Bs-YjiC.

4. A genetically engineered bacterium for producing rosavidin, It is characterized in that The gene encoding UDP glucose dehydrogenase, the gene encoding UDP xylose synthase, and the gene encoding UDP xylose 4-epimerase introduced into the genetically engineered bacteria according to any one of claims 1 to 3 are replaced with a gene encoding arabinokinase AraK and a gene encoding uridine diphosphate sugar pyrophosphorylase, so as to synthesize UDP-arabinose using L-arabinose as a substrate and then synthesize rosavidin from scratch; Preferably, the gene encoding arabinokinase AraK is selected from Paludisphaera borealis The PbAraK gene, encoding UDP-glucose pyrophosphorylase, is from Arabidopsis thaliana The AtUSP gene; Alternatively, the gene encoding 4-coumarate-CoA ligase and the gene encoding cinnamoyl-CoA reductase are replaced with a carboxylic acid reductase and a phosphopantetheinyl transferase; preferably, the gene encoding the carboxylic acid reductase is from Mycobacterium marinum The MmCAR gene and the gene encoding phosphopantetheinyl transferase are from Nocardia iowensis The NiNPT gene.

5. The genetically engineered bacterium according to any one of claims 1 to 4, It is characterized in that The starting bacteria is Escherichia coli, preferably phenylalanine-producing Escherichia coli. More specifically, the phenylalanine-producing Escherichia coli is obtained by adding trpE , tyR , tyrA and pyk Gene knockout or inactivation or reduced expression.

6. The genetically engineered bacterium according to claim 4, It is characterized in that UDP-glucose hydrolase gene ushA and β-galactosidase gene lacZ Gene knockout or inactivation or reduced expression.

7. The genetically engineered bacterium according to any one of claims 1 to 6, It is characterized in that The introduced genes are introduced into the host bacteria in the form of one or more plasmids, or integrated into the host bacteria genome; preferably, the nucleotide sequence of each gene is optimized according to the codon preference of the host bacteria.

8. Use of the genetically engineered bacteria according to any one of claims 1 to 7 in the production of rosavirin, rosavirin and / or cinnamyl alcohol.

9. The use according to claim 8, It is characterized in that It is used in the production of Rosavi.

10. A method for preparing rosavidin, rosavidin and / or cinnamyl alcohol, It is characterized in that The method comprises fermenting the genetically engineered bacteria as described in any one of claims 1 to 7 to produce rosavirin, rosavirin and / or cinnamyl alcohol; optionally, further comprising a step of purifying rosavirin, rosavirin and / or cinnamyl alcohol.

Images