Variant microorganism having improved L-glutamic acid production capacity, and method for producing L-glutamic acid using same

Abstract

The present invention relates to a variant microorganism having an improved L-glutamic acid production capacity and a method for producing L-glutamic acid using the same, the variant microorganism being capable of improving the production yield of L-glutamic acid as compared to a parent strain by weakening or inactivating the activity of the RamB protein.

Description

Technical Field

[0001] The present invention relates to a mutant microorganism having improved L-glutamic acid production ability and a method for producing L-glutamic acid using the mutant microorganism. Background Art

[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation. Its salt form, monosodium L-glutamate (MSG), balances and harmonizes the overall taste of food to increase the preference of meat, fish, chicken, vegetables, sauces, broths, and dressings. It can also enhance the taste of low-salt foods that reduce salt to 30%, so it is widely used as a seasoning for household and processed food production.

[0003] Simply studying the fermentation pathway of L-glutamate, glucose mainly goes through the glycolytic pathway, but a part of it is metabolized into two molecules of pyruvic acid through the pentose phosphate pathway. One of the molecules fixes CO 2 It becomes oxaloacetic acid, and another molecule combines with acetyl CoA, and pyruvate becomes citric acid. Oxaloacetic acid and citric acid enter the TCA cycle again to become α-ketoglutaric acid. Among them, due to the lack of oxidative metabolic pathways from α-ketoglutaric acid to succinic acid, and the close participation of isocitrate dehydrogenase and glutamate dehydrogenase, the reductive amino acid reaction of α-ketoglutaric acid is carried out efficiently, thereby generating L-glutamate.

[0004] The production of L-glutamic acid can utilize wild-type strains obtained in a natural state or mutants modified in a manner to improve their glutamic acid production capacity. In recent years, in order to improve the production efficiency of L-glutamic acid, microorganisms such as Escherichia coli and Corynebacterium, which are often used for the production of useful substances such as amino acids and nucleic acids, have been used as targets, and gene recombination technology has been applied to develop various recombinant strains or mutants with excellent L-glutamic acid production capacity and L-glutamic acid production methods using them. In particular, the following attempts have been made: direct mutations in genes such as enzymes, transcription factors, and transport proteins involved in the biosynthetic pathway of L-glutamic acid, or induction mutations in promoters that regulate their expression, thereby expanding the production of L-glutamic acid. However, the types of proteins such as enzymes, transcription factors, and transport proteins that are directly or indirectly related to the production of L-glutamic acid reach tens to hundreds of species, so whether the L-glutamic acid production capacity is increased according to the activity changes of such proteins, in fact, still requires a lot of research.

[0005] Prior art literature

[0006] Patent Literature

[0007] (Patent Document 1) U.S. Patent No. 6852516

[0008] (Patent Document 2) U.S. Patent No. 6962805 Summary of the invention

[0009] An object of the present invention is to provide a mutant microorganism having an improved L-glutamic acid production capacity.

[0010] Another object of the present invention is to provide a method for producing L-glutamic acid using the above-mentioned mutant microorganism.

[0011] One embodiment of the present invention provides a mutant microorganism in which the activity of RamB protein is weakened or inactivated and the L-glutamic acid production ability is improved.

[0012] The "RamB protein" used in the present invention is a transcriptional regulator that regulates the expression of genes aceA, aceB, ack and pta involved in acetic acid metabolism. The RamB protein in the present invention can be a polypeptide encoded by the ramB gene or the Cgl0369 gene and having RamB protein activity, but is not limited thereto.

[0013] The nucleic acid and protein sequence information of the RamB protein can be obtained through known sequence databases (eg, GenBank, UniProt).

[0014] The "weakened activity" used in the present invention refers to the reduction in the expression of genes encoding target enzymes, transcription factors, transport proteins, etc., compared with the original microorganism, i.e., the wild-type strain or the strain before modification. Such weakening of activity includes the following situations: the activity of the protein itself is reduced compared with the activity of the protein possessed by the original microorganism by nucleotide substitution, insertion, deletion or a combination thereof of the encoding gene, and the overall protein activity level in the cell is lower than that of the wild-type strain or the strain before modification by hindering the expression of the gene encoding it or hindering translation, etc., and also includes the combination thereof.

[0015] According to a specific example of the present invention, the weakening of the activity of the RamB protein can be achieved by inserting, replacing, deleting, or a combination thereof, all or part of the gene encoding the RamB protein.

[0016] The term "inactivation" used in the present invention refers to the following situations: the expression of genes encoding proteins such as enzymes, transcription factors, and transport proteins is not expressed at all compared to the original microorganism, i.e., the wild-type strain or the strain before modification, or even if expressed, it has no activity.

[0017] According to a specific example of the present invention, the gene encoding the RamB protein may include the base sequence of SEQ ID NO:1.

[0018] In addition, according to a specific example of the present invention, the RamB protein may consist of the amino acid sequence of SEQ ID NO:2.

[0019] The base sequence or amino acid sequence of the RamB protein according to the present invention may be composed of or necessarily contain a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with each sequence, and may have the original function. Here, "homology" or "identity" refers to the consistency rate (%) between the base sequence or amino acid sequence used as a reference and any other base sequence or amino acid sequence when the two sequences are aligned and analyzed in a manner that corresponds to the greatest extent.

[0020] "Productivity is improved" used in the present invention means that the productivity of L-glutamic acid is increased compared to the parent strain. The above-mentioned parent strain refers to a wild type or mutant strain that becomes a mutation object, including a target that directly becomes a mutation object or a target that is transformed by a recombinant vector, etc. In the present invention, the parent strain can be a microorganism or strain of the wild type Corynebacterium genus or the Corynebacterium genus mutated from the wild type without L-glutamic acid production ability or with L-glutamic acid production ability.

[0021] Examples of the Corynebacterium strain include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, and Corynebacterium spp. marinum), Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium seudopelargi, or Corynebacterium flavescens, but is not limited thereto.

[0022] According to a specific example of the present invention, the mutant microorganism may be a strain of the genus Corynebacterium.

[0023] The mutant microorganism according to the present invention can improve the L-glutamic acid production capacity by weakening or inactivating the activity of the RamB protein.

[0024] According to a specific example of the present invention, the mutant microorganism may be obtained by deleting the gene encoding RamB protein.

[0025] Specifically, the variant microorganism with improved L-glutamic acid productivity shows an increased L-glutamic acid productivity compared to the parent strain, and in particular, the L-glutamic acid production can be increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the parent strain, or can be increased by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times or 10 times, but is not limited thereto. As an example, the mutant microorganism in which the activity of the RamB protein is weakened or inactivated can increase the production of L-glutamic acid by 5% or more, specifically, by 5 to 50% (preferably 10 to 40%), compared to the parent strain.

[0026] The composition comprising the variant microorganism according to the present invention can be used as a composition for L-glutamic acid production.

[0027] The mutant microorganism according to one embodiment of the present invention can be achieved by using a recombinant vector in which the gene encoding the RamB protein is deleted in the parent strain.

[0028] "Carrier (vector)" used in the present invention refers to all types of nucleic acid sequence transport structures used as a means for delivering and expressing target genes to host cells. Unless otherwise specified, the above-mentioned carrier can represent the insertion of the nucleic acid sequence carried into the host cell gene for expression and / or independent expression. Such a carrier includes the necessary regulatory sequences that are operably connected in order to express the gene insert, and "operably connected (operably linked)" refers to the functional combination of the target gene and its regulatory sequence with each other and connected in a manner that can carry out gene expression, and "regulatory sequence" includes a promoter sequence for implementing transcription, an arbitrary operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0029] The vector used in the present invention is not particularly limited as long as it can be replicated in the host cell, and any vector known in the art can be used. As an example of the above-mentioned vector, a plasmid, a cosmid, a virus and a phage in a natural state or a recombinant state can be cited. For example, as a phage vector or a cosmid vector, there are pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and as a plasmid vector, there are pBR system, pUC system, pBluescriptII system, pGEM system, pTZ system, pCL system and pET system, etc., but it is not limited thereto.

[0030] The above-mentioned vector can be representatively constructed as a vector for cloning or a vector for expression. The vector for expression can use conventional vectors used in the art for expressing foreign genes or proteins in plants, animals or microorganisms, and can be constructed by various methods well known in the art.

[0031] The "recombinant vector" used in the present invention can be constructed with prokaryotic cells or eukaryotic cells as hosts, can be replicated independently of the genome of the host cell, or can be sutured to the genome itself. The above-mentioned host cell is capable of replicating the vector and may include a replication origin as a specific base sequence for starting replication. For example, when the vector used is an expression vector and a prokaryotic cell is used as the host, it generally includes a strong promoter (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter) that can enable transcription, a ribosome binding site for the initiation of translation, and a transcription / translation termination sequence. When eukaryotic cells are used as hosts, the replication origins initiated in the eukaryotic cells contained in the vector include f1 replication origin, SV40 replication origin, pMB1 replication origin, adenovirus replication origin, AAV replication origin, and BBV replication origin, but are not limited thereto. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV) can be used, and usually have a polyadenylation sequence as a transcription termination sequence.

[0032] The above-mentioned recombinant vector may include a selection marker, which is used to screen transformants (host cells) transformed by the vector. In the culture medium treated with the above-mentioned selection marker, only cells expressing the selection marker can survive, so transformed cells can be screened. As representative examples, the above-mentioned selection markers include ampicillin, kanamycin, streptomycin, chloramphenicol, etc., but are not limited thereto.

[0033] By inserting the above-mentioned recombinant vector into a host cell, a transformant can be prepared, and the above-mentioned transformant can be obtained by introducing the recombinant vector into a suitable host cell. The host cell is a cell that can stably and continuously clone or express the above-mentioned expression vector, and any host cell known in the art can also be used.

[0034] When prokaryotic cells are transformed to produce recombinant microorganisms, Escherichia coli strains such as E. coli DH5α, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, and E. coli XL1-Blue; Corynebacterium strains; Bacillus strains such as Bacillus subtilis and Bacillus thuringiensis; various enteric bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas can be used as host cells, but are not limited thereto.

[0035] When eukaryotic cells are transformed to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells can be used as host cells, for example, Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., but are not limited to these.

[0036] As used in the present invention, “transformation” refers to the phenomenon of introducing foreign DNA into host cells to cause artificial genetic changes, and “transformant” refers to a host cell into which foreign DNA is introduced and which stably maintains the expression of the target gene.

[0037] In the above transformation, a suitable vector introduction technique is selected according to the host cell, so that the target gene or the recombinant vector containing the same can be expressed in the host cell. For example, the vector introduction can be carried out by electroporation, heat shock, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. As long as the transformed gene can be expressed in the host cell, it can be included, without being limited to being inserted into the chromosome of the host cell or being located outside the chromosome.

[0038] The transformant includes cells transfected, transformed or infected with the recombinant vector according to the present invention in vivo or in vitro, and can be used as the same term as a recombinant host cell, a recombinant cell or a recombinant microorganism.

[0039] The transformant of the present invention may not include humans.

[0040] The gene inserted into the recombinant vector for transformation of the present invention can be replaced into a host cell such as a microorganism of the genus Corynebacterium by homologous recombination and crossover.

[0041] According to a specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0042] In another aspect of the present invention, there is provided a method for producing L-glutamic acid, comprising the steps of: culturing the above-mentioned variant microorganism in a culture medium; and recovering L-glutamic acid from the above-mentioned variant microorganism or the culture medium in which the variant microorganism is cultured.

[0043] The above-mentioned culture can be carried out according to suitable culture medium and culture conditions known in the art, and those skilled in the art can easily adjust the culture medium and culture conditions for use. Specifically, the above-mentioned culture medium can be a liquid culture medium, but is not limited thereto. The culture method can include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0044] According to a specific example of the present invention, the above-mentioned culture medium must meet the requirements of specific strains in a suitable manner and can be appropriately changed by those skilled in the art. Regarding the culture medium of Corynebacterium microorganisms, reference can be made to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but it is not limited thereto.

[0045] According to a specific example of the present invention, the culture medium may contain various carbon sources, nitrogen sources and trace element components. As the carbon source that can be used, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, etc. are included; oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc.; fatty acids such as palmitic acid, stearic acid, linoleic acid; alcohols such as glycerol and ethanol; organic acids such as acetic acid. These substances can be used alone or in the form of a mixture, but are not limited to this. As the nitrogen source that can be used, peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included. Nitrogen sources can also be used alone or in the form of a mixture, but are not limited to this. As a source of phosphorus that can be used, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts can be included, but are not limited to this. In addition, the culture medium may contain metal salts such as magnesium sulfate or ferrous sulfate required for growth, but is not limited to this. In addition, essential growth substances such as amino acids and vitamins may be included. In addition, precursors suitable for the culture medium may be used. The above-mentioned culture medium or individual components may be added to the culture solution in batches or continuously in a suitable manner during the culture process, but are not limited thereto.

[0046] According to a specific example of the present invention, during the culture process, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the microbial culture solution in an appropriate manner to adjust the pH of the culture solution. In addition, during the culture process, a defoaming agent such as fatty acid polyethylene glycol ester can be used to suppress the generation of bubbles. Further, in order to maintain the aerobic state of the culture solution, oxygen or oxygen-containing gas (such as air) can be injected into the culture solution. The temperature of the culture solution can generally be 20°C to 45°C, for example, 25°C to 40°C. The culture time can continue until the desired production of the useful substance is obtained, for example, it can be 10 to 160 hours.

[0047] According to a specific example of the present invention, in the above-mentioned step of recovering L-glutamic acid from the cultured Corynebacterium microorganism and the culture medium for culturing the above-mentioned microorganism, the produced L-glutamic acid can be collected or recovered from the culture medium according to the culture method and using a suitable method known in the art. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion) and other methods can be used, but are not limited thereto.

[0048] According to a specific example of the present invention, in the step of recovering L-glutamic acid, the culture medium may be centrifuged at a low speed to remove biomass, and the obtained supernatant may be separated by ion exchange chromatography.

[0049] According to a specific example of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid.

[0050] The mutant microorganism according to the present invention can improve the production yield of L-glutamic acid compared with the parent strain by weakening or inactivating the activity of the RamB protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 The structure of plasmid pK19msb according to one embodiment of the present invention is shown. DETAILED DESCRIPTION

[0052] The present invention will be described in more detail below, but such description is provided for illustrative purposes only to help understand the present invention, and the scope of the present invention is not limited to such illustrative description.

[0053] Example 1. Preparation of strains with disrupted RamB protein gene

[0054] In order to confirm the effect of inactivation of the RamB protein on L-glutamic acid production, a vector in which a part of the above gene was deleted and a strain into which the above vector was introduced were prepared.

[0055] 1-1. Recombinant vector

[0056] The genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template, and the primer pairs of primers 1 and 2 and primers 3 and 4 were used to implement PCR respectively. Two kinds of PCR products of about 0.5kb and 0.6kb size amplified by PCR were mixed and used as templates, and the primer pairs of primers 1 and 4 were used to carry out overlapping PCR and connected into a fragment. After pK19msb vector (SEQ ID NO:3) was treated with restriction enzyme smaI (NEB), the above-mentioned fragment was cloned using T4 ligase. The vector constructed in this way was named as pK_△ramB.

[0057] Pfu premix (bioneer) was used for all PCRs. After denaturation at 95°C for 5 minutes, the reaction was repeated 30 times at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and then reacted at 72°C for 5 minutes.

[0058] The primer sequences used for vector preparation are shown in Table 1 below.

[0059]

Table 1

[0060] Primer name Serial Number Primer sequence (5'-3') Primer 1 SEQ ID NO:4 TGTACGTCCCAGATCGAGG Primer 2 SEQ ID NO:5 ACATATGTGGGGTCCAGGTACCTGTGGATCTCACGC Primer 3 SEQ ID NO:6 GCGTGAGATCCACAGGTACCTGGACCCCACATATGT Primer 4 SEQ ID NO:7 CAGCACGTTGAATCTCAAGC

[0061] 1-2. L-Glutamic Acid-Producing Strain with Disrupted RamB Protein Gene

[0062] Using the above-mentioned vector, mutant strains were prepared as follows.

[0063] The pK_△ramB vector was prepared so that the final concentration was 1 μg / μl or more, and electroporated to Corynebacterium glutamicum U3 (KCCM13218P) (reference document. Tauch et al., FEMS Microbiology letters 123 (1994) 343-347), and then 1 ml of a regeneration medium (containing 18.5 g / l of brain heart infusion and 91 g / l of sorbitol) was immediately added and heat-treated at 46°C for 6 minutes. After treatment, the cells were transferred to a 15 ml cap tube, cultured at 30°C for 2 hours, and then applied to a selection medium (containing 5 g / l of tryptone, 5 g / l of NaCl, 2.5 g / l of yeast extract, 18.5 g / l of brain heart infusion powder, and 15 g / l of agar) containing 20 mg / l of kanamycin. The colonies generated by culturing at 30°C for 72 hours were cultured in BHI medium (brain heart extract 18.5 g / l) for 15 hours to induce secondary recombination and diluted to 10 -2 ~10 -3 , and applied to a selection medium supplemented with 10% sucrose, thereby isolating colonies. The isolated colonies were cultured in two selection mediums supplemented with kanamycin and sucrose, respectively, to screen for strains that were not resistant to kanamycin and had the ability to grow in a medium containing sucrose. This strain was named △ramB.

[0064] Experimental Example 1. Evaluation of L-glutamic acid production ability in cells with disrupted RamB protein gene

[0065] The L-glutamic acid production abilities of Corynebacterium glutamicum U3 as the parent strain and the RamB protein disrupted mutant strain ΔramB prepared in Example 1 were compared.

[0066] In a 100 mL flask containing 10 ml of the glutamic acid production medium shown in Table 2 below, each strain (parent strain or variant) was inoculated at 1% by volume and cultured at 30° C. with shaking at 200 rpm for 48 hours. After the culture was completed, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0067]

Table 2

[0068] Element content glucose 70g / L <![CDATA[(NH 4 ) 2 SO 4 ]]> 5g / L <![CDATA[MgSO 4 ]]> 0.4g / L Urea 2g / L Soybean hydrolysate 15ml / L <![CDATA[KH 2 AFTER 4 ]]> 1g / L <![CDATA[FeSO 4 ]]> 10mg / L <![CDATA[MnSO 4 ]]> 10mg / L Thiamine-HCl 200ug / L Biotin 2ug / L <![CDATA[CaCO 3 ]]> 5％

[0069]

Table 3

[0070]

[0071] As shown in the above Table 3, it was confirmed that the L-glutamic acid production amount increased by about 14.4% compared with the parent strain U3 due to the disruption of the gene encoding the RamB protein.

[0072] So far, the present invention has been studied around its preferred embodiments. It will be appreciated by those skilled in the art that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative perspective rather than a restrictive perspective. The scope of the present invention is shown in the claims rather than in the above description, and should be interpreted as all differences within the scope of their equivalents are included in the present invention.

[0073]

Collection Information

[0074] Name of depository institution: Korea Collection of Microorganisms (KCCM)

[0075] Accession number: KCCM13218P

[0076] Collection date: June 29, 2022

[0077] Classification and nomenclature of biological material: Corynebacterium glutamicum.

Claims

1. A mutant microorganism in which the activity of RamB protein is weakened or inactivated and the L-glutamic acid production capacity is improved.

2. The variant microorganism according to claim 1, wherein The weakening of the activity of the RamB protein is achieved by inserting, replacing, deleting, or a combination thereof, all or part of the gene encoding the RamB protein.

3. The variant microorganism according to claim 2, wherein The gene encoding RamB protein comprises the base sequence of SEQ ID NO:

1.

4. The variant microorganism according to claim 1, wherein The mutant microorganism is a strain of the genus Corynebacterium.

5. A method for producing L-glutamic acid, comprising the following steps: The step of culturing the variant microorganism according to claim 3 in a culture medium; as well as A step of recovering L-glutamic acid from the mutant microorganism or a culture medium in which the mutant microorganism is cultured.

Images