Beta-nicotinamide mononucleotide generation system and method for preparing beta-nicotinamide mononucleotide through double-enzyme synergy

Abstract

The invention relates to the technical field of biosynthesis, in particular to a beta-nicotinamide mononucleotide generation system and a method for preparing beta-nicotinamide mononucleotide through double-enzyme synergy. The beta-nicotinamide mononucleotide generation system comprises an NRK-HS01 whole-cell catalyst, an ADK whole-cell catalyst, nicotinamide ribose, adenosine triphosphate and MgCl2. The NRK-HS01 whole-cell catalyst is coupled with an ATP regeneration system (ADK whole-cell catalyst) to be used for catalyzing nicotinamide ribose and adenosine triphosphate, NMN is synthesized in one step, the molar generation rate of NMN is 99% or above, the ATP cost is reduced by 50%, feedback inhibition of by-product ADP accumulation on the synthesis reaction can be reduced, meanwhile, ATP recycling is achieved, the synthesis efficiency is improved, the production cost is saved, and the method is suitable for industrial production. And the method has important significance on industrial development of biosynthesis of NMN.

Description

Technical Field

[0001] The present invention relates to the technical field of biosynthesis, and in particular to a β-nicotinamide mononucleotide production system and a method for preparing β-nicotinamide mononucleotide in a coordinated manner using two enzymes. Background Art

[0002] β-Nicotinamide mononucleotide (NMN), as a substance naturally present in the human body, plays a key role in the production of cellular energy. NMN is one of the important precursors for the synthesis of nicotinamide adenine dinucleotide in mammals. Nicotinamide adenine dinucleotide plays a vital role in maintaining human health. It is mainly involved in electron transfer reactions. However, with age, the total content of nicotinamide adenine dinucleotide will gradually decrease. Since nicotinamide adenine dinucleotide cannot be directly supplemented externally, the role of NMN is particularly important. It can enter the human blood, increase the content of β-nicotinamide mononucleotide in tissues, and then quickly convert into nicotinamide adenine dinucleotide in organs to play its important physiological functions.

[0003] Common methods for synthesizing NMN include chemical synthesis and biological synthesis. The chemical synthesis process is relatively complex, with many steps, requires the use of organic reagents for protection and deprotection, is environmentally unfriendly, isomer separation is difficult, and the product yield is low. Compared with chemical synthesis, the advantages of synthesizing NMN using biological methods, i.e. whole-cell methods, include the following: (1) the reaction is carried out in one step, with few side reactions and relatively simple separation and purification; (2) green synthesis, high atomic utilization rate, and strong economy; (3) wastewater treatment after product purification is simple, which is conducive to large-scale application. Nicotinamide riboside and ATP generate NMN under the catalysis of nicotinamide ribokinase, which is considered to be the most promising synthetic route for NMN.

[0004] In the prior art, some people use Klm-NRK enzyme from Kluyveromyces marx to catalyze NR to produce NMN. Klm-NRK enzyme from Kluyveromyces marx can catalyze 100g / L (0.30M) NR within 8h, and the molar yield of NMN is 84.2%, but Klm-NRK only retains 40% enzyme activity under the commonly used industrial action conditions of 40-65°C and pH 5-8.5, and the catalytic efficiency is seriously lost. In addition, ATP has high cost and high consumption, and the accumulation of the generated byproduct ADP will inhibit the key enzymes in the biocatalytic reaction, which will reduce the conversion efficiency or proceed in the reverse direction. In order to solve the above problems, the present invention intends to construct an adenylate kinase (ADK) type ATP regeneration system for catalyzing the one-step synthesis of NMN from NR and ATP, reduce the feedback inhibition of the byproduct ADP accumulation on the synthesis reaction, and realize the recycling of ATP at the same time, so as to improve the synthesis efficiency and save production costs, which is of great significance to the industrial development of biosynthesis of NMN. Summary of the invention

[0005] The purpose of the present invention is to provide a β-nicotinamide mononucleotide production system and a method for preparing β-nicotinamide mononucleotide by dual enzyme synergistically, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a β-nicotinamide mononucleotide production system, which comprises 20-25U / mL NRK-HS01 whole cell catalyst, 20-25U / mL ADK whole cell catalyst, 100-250mM nicotinamide ribose (NR), 100-120mM adenosine triphosphate (ATP) and 40-50mM MgCl 2 ;

[0008] The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6;

[0009] The preparation method of the ADK whole-cell catalyst comprises the steps of transferring a recombinant vector containing an ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.7.

[0010] Preferably, the β-nicotinamide mononucleotide production system comprises 20 U / mL NRK-HS01 whole cell catalyst, 20 U / mL ADK whole cell catalyst, 200-250 mM nicotinamide riboside, 100 mM adenosine triphosphate and 40 mM MgCl 2 .

[0011] Further preferably, the β-nicotinamide mononucleotide production system comprises 20 U / mL NRK-HS01 whole cell catalyst, 20 U / mL ADK whole cell catalyst, 200 mM nicotinamide riboside, 100 mM adenosine triphosphate and 40 mM MgCl 2 .

[0012] Preferably, when preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

[0013] Preferably, when preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

[0014] The present invention provides the use of the above-mentioned β-nicotinamide mononucleotide production system in the preparation of β-nicotinamide mononucleotide.

[0015] The present invention provides a method for preparing β-nicotinamide mononucleotide by dual enzyme synergy, comprising the following steps:

[0016] NRK-HS01 whole cell catalyst, ADK whole cell catalyst, nicotinamide riboside, ATP and MgCl 2 Mix to obtain a reaction solution; in the reaction solution, the enzyme activity of the NRK-HS01 whole cell catalyst is 20-25U / mL, the enzyme activity of the ADK whole cell catalyst is 20-25U / mL, the concentration of nicotinamide riboside is 100-250mM, the concentration of adenosine triphosphate is 100-120mM, and the MgCl 2 The concentration is 40-50mM;

[0017] performing a coupling reaction on the reaction solution to obtain the β-nicotinamide mononucleotide;

[0018] The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6;

[0019] The preparation method of the ADK whole-cell catalyst comprises the steps of transferring a recombinant vector containing an ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.7.

[0020] Preferably, the enzyme activity of the NRK-HS01 whole cell catalyst in the reaction solution is 25 U / mL, the enzyme activity of the ADK whole cell catalyst is 25 U / mL, the concentration of nicotinamide riboside is 200-250 mM, the concentration of adenosine triphosphate is 100 mM, and the concentration of MgCl 2 The concentration is 40mM.

[0021] Further preferably, the enzyme activity of the NRK-HS01 whole cell catalyst in the reaction solution is 25 U / mL, the enzyme activity of the ADK whole cell catalyst is 25 U / mL, the concentration of nicotinamide riboside is 200 mM, the concentration of adenosine triphosphate is 100 mM, and the MgCl 2 The concentration is 40mM.

[0022] Preferably, the coupling reaction time is 3-5 h, the temperature is 35-40° C., the pH is 7-8, and the rotation speed is 200-220 rpm.

[0023] Preferably, when preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

[0024] Preferably, when preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

[0025] The present invention discloses the following technical effects:

[0026] The present invention couples the NRK-HS01 whole-cell catalyst with an ATP regeneration system (ADK whole-cell catalyst) to catalyze NR and ATP to synthesize NMN in one step. The molar generation rate of NMN is above 99%, the ATP cost is reduced by 50%, and the feedback inhibition of the synthesis reaction caused by the accumulation of the byproduct ADP can be reduced. At the same time, the recycling of ATP is realized to improve the synthesis efficiency and save production costs, which is of great significance to the industrial development of biosynthesis of NMN.

[0027] The present invention also has the following technical effects:

[0028] 1. The present invention constructs a new recombinant Escherichia coli NRK-HS01, and significantly improves the enzyme activity of the recombinant bacteria through site-directed mutagenesis, thereby achieving efficient synthesis of NMN.

[0029] 2. The present invention will construct a new recombinant Escherichia coli ADK, which not only provides raw materials for NMN synthesis through continuous ATP regeneration, but also reduces the feedback inhibition of the synthesis reaction caused by the accumulation of byproduct ADP.

[0030] 3. The present invention co-reacts the whole-cell catalysts prepared by two recombinant Escherichia coli with the substrate, and under the condition of high substrate concentration, the efficient synthesis of NMN by dual enzyme synergistic catalysis can be achieved, wherein the NRK-HS01 whole-cell catalyst is used to catalyze the synthesis of NMN from NR and ATP; the ADK whole-cell catalyst is used to catalyze the cyclic regeneration of ATP in the system, without the need for a phosphate donor, which greatly reduces the reaction cost, reduces the generation of the by-product ADP, and increases the NMN yield.

[0031] 4. The present invention discloses a method for producing β-nicotinamide mononucleotide using a whole-cell method. The entire catalytic reaction is carried out at room temperature and pressure, which is environmentally friendly. No toxic or harmful organic solvents are used, which reduces environmental pollution. The entire catalytic process is a one-step reaction, which has the advantages of high conversion rate, concise purification steps and simple procedures, and better saves production costs.

[0032] In summary, the present invention solves the problem of byproduct accumulation feedback inhibition conversion in the NMN biosynthesis process by rationally combining nicotinamide ribokinase and adenylate kinase, which can meet the high-concentration substrate efficient catalytic synthesis of NMN, while effectively reducing costs. The method of nicotinamide ribokinase equipped with an ATP regeneration system provided by the present invention has important application prospects for the application of efficient synthesis of β-nicotinamide mononucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0034] Figure 1 Schematic diagram of the process for constructing recombinant Escherichia coli;

[0035] Figure 2 is the NMN standard curve measured at a wavelength of 260 nm in Example 3;

[0036] Figure 3 This is the reaction HPLC detection diagram of NRK-HS01 whole cell catalyst;

[0037] Figure 4 This is the peak diagram of the liquid chromatography of β-nicotinamide mononucleotide standard;

[0038] Figure 5 This is a diagram of the process of synthesizing NMN using the synergistic catalytic activity of the NRK-HS01 whole-cell catalyst and the ADK whole-cell catalyst;

[0039] Figure 6 This is a graph showing the changes in each component during the 3 h coupling reaction under the most suitable conditions in Example 7. DETAILED DESCRIPTION

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0042] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0043] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the description of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the description of this invention are obvious to those skilled in the art. The description and examples of this invention are merely exemplary.

[0044] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0045] In the following examples or comparative examples: Escherichia coli DH5α and Escherichia coli BL21(DE3) were purchased from TransGen Biotech; the vector pET-28a-(+) was purchased from Novagen.

[0046] The components and concentrations in LB medium are as follows: yeast extract 5 g / L, tryptone 10 g / L, sodium chloride 10 g / L.

[0047] The specific method for measuring enzyme activity is as follows: Prepare 5 mL containing 100 mmol / L nicotinamide ribose and 100 mmol / L adenosine triphosphate with Tris-HCl buffer solution, add 20 mmol / L magnesium chloride, adjust the pH to 7.5 with Tris, add 1 mL of enzyme solution, react at 37 °C for 1 h, take 1 mL of the reaction solution, heat it in a 100 °C water bath for 5 min, detect the concentration of β-nicotinamide mononucleotide by high performance liquid chromatography. At 37 °C, the amount of enzyme required to catalyze the reaction of 500 μmol nicotinamide ribose to generate 1 μmol β-nicotinamide mononucleotide within 1 h is defined as one enzyme activity unit (U).

[0048] Example 1

[0049] The gene (KPH72847.1) derived from Haemophilus influenzae was codon-optimized to synthesize the NRK1 gene. According to the sequences of the NRK1 gene and the pET-28a-(+) plasmid, primers were designed using primerpremier5.0. The forward primer was 5'-TTGCATCCAGCGCAGACGATCTTGCACG-3' (SEQ ID NO.1), and the reverse primer was 5'-TCGTCTGCGCTGGATGCAACAGATTTTCAA-3' (SEQ ID NO.2). By PCR amplification technology, a gene clone fragment NRK-HI01 (SEQ ID NO.5) containing BamH I and Xho I restriction sites was obtained. The above gene clone fragment NRK-HI01 was double-digested (BamH I and Xho I) and cloned into 5'-TTGCATCCAGCGCAGACGATCTTGCACG-3' (SEQ ID NO.1). I restriction site) was connected to the pET-28a-(+) plasmid to obtain the recombinant plasmid pET-28a-(+)-NRK-HI01 (pET-28a--NRK-HI01), and the recombinant plasmid was introduced into BL21 (DE3) competent cells, the plasmid was extracted, and the plasmid was used as a template to mutate the 8th amino acid using a forward primer (SEQ ID NO.3: 5'-AGCCGTGAATTTCGCCCAGCGCTGCGCAT-3') and a reverse primer (SEQ ID NO.4: 5'-CTGGGCGAAATTCACGGCTGGTGGTAAAGC-3'), so that the codon encoding glycine (GGC) was mutated to a codon encoding serine (AGC), and the mutated gene NRK-HS01 (SEQ ID NO.6), introduced into DMT competent medium to extract plasmid and sequence verification, after verification, the plasmid was introduced into BL21 (DE3) competent medium, and screened on kanamycin resistant plates to obtain recombinant Escherichia coli NRK-HS01 producing nicotinamide ribokinase. The schematic diagram of the process of constructing recombinant Escherichia coli NRK-HS01 is shown in Figure 1 shown.

[0050] The nucleotide sequence of NRK-HI01 is shown in SEQ ID NO.5, specifically:

[0051] GGATCCATGGGCTTTACCACC GGC

[0052] The nucleotide sequence of NRK-HS01 is shown in SEQ ID NO.6, specifically:

[0053] GGATCCATGGGCTTTACCACC AGC

[0054] Example 2

[0055] Inoculate the recombinant Escherichia coli NRK-HS01 constructed in Example 1 into 50 mL of LB medium containing 100 μg / mL kanamycin sulfate, and culture it at 37 °C and 220 rpm for 12 h until the absorbance OD 600 is 4.0 to obtain a seed solution; take 1 mL of the seed solution into 50 mL of LB medium, and culture it at 37 °C and 220 rpm for 6 h until the absorbance OD 600 is 4.0, add an IPTG inducer with a concentration of 62.5 μg / mL, ferment and induce at 25 °C for 12 h, centrifuge at 4 °C and 8000 rpm for 15 min, remove the supernatant, add Tris-HCl buffer with pH = 7.5, and prepare the cells into a whole-cell suspension with a concentration of 0.1 g / mL. The enzyme activity is 100 U / mL, denoted as the NRK-HS01 whole-cell catalyst.

[0056] Example 3

[0057] Use NMN standard products to prepare 6 groups of standard solutions with concentrations of 0.3, 0.84, 1.12, 1.4, 2.8, and 5.6 mg / mL respectively. Detect by high-performance liquid chromatography (detection conditions: the chromatographic column is an amide column (4.6 mm × 250 mm, 5 μm); the mobile phase is 0.05 M KH 2 PO 4 (pH 4.0): acetonitrile = 35:65; the flow rate is 0.9 mL / min, and the detection wavelength is 260 nm), and record the peak area. Use data processing software, with the concentration as the abscissa and the corresponding peak area in the chromatogram as the ordinate, perform linear regression on the experimental data to obtain the standard curve of NMN ( Figure 2 ). The NMN standard curve is y = 8892357.5026x + 680215.2531, R 2 = 0.9997.

[0058] Example 4

[0059] A 100 mmol / L NR and 100 mmol / L ATP mixed solution was prepared using a Tris-HCl buffer solution with a pH of 7.5, and 20 mmol / L magnesium chloride was added. The pH of the substrate solution was adjusted to 7.5 using a Tris solution, and the whole cell suspension (NRK-HS01 whole cell catalyst) prepared in Example 2 was added to make the enzyme activity of the NRK-HS01 whole cell catalyst in the reaction system 20 U / mL to obtain a reaction solution. The pH of the reaction solution was maintained within 7.5±0.05. When the pH of the reaction solution no longer changed, it indicated that the reaction was complete. The reaction was terminated by heating at 100°C for 5 min, and the reaction solution was diluted 5 times using a Tris-HCl buffer solution. The precipitate was removed by centrifugation, and the supernatant was filtered using a 0.22 μm filter membrane. The filtered supernatant was detected by high performance liquid chromatography. The liquid chromatographic peak diagram of the reaction solution was as shown in FIG. Figure 3 As shown; 4 g / L β-nicotinamide mononucleotide standard solution was prepared using Tris-HCl solution, and the HPLC detection was also performed. The liquid chromatogram of the β-nicotinamide mononucleotide standard solution is shown in Figure 4 The results showed that the NRK-HS01 whole-cell catalyst was able to catalyze the synthesis of β-nicotinamide mononucleotide.

[0060] Example 5

[0061] A mixed solution of 100 mmol / L nicotinamide riboside and 100 mmol / L adenosine triphosphate was prepared using Tris-HCl buffer at pH = 7.5, and 20 mmol / L magnesium chloride was added. The pH of the substrate solution was adjusted to 7.5 with a Tris solution, and the whole cell suspension (NRK-HS01 whole cell catalyst) prepared in Example 2 was added to make the enzyme activity of the NRK-HS01 whole cell catalyst in the reaction system 20 U / mL. The mixture was stirred at 37° C. for 3 h to catalyze the synthesis of β-nicotinamide mononucleotide with a conversion rate of 92.37%.

[0062] Example 6

[0063] After the ADK enzyme gene (adenylate kinase gene) was optimized for codon preference of Escherichia coli, restriction sites of BamH I and Xol I were added at both ends to obtain the final ADK enzyme gene (SEQ ID NO.7), which was inserted into the plasmid pET-28a-(+) to construct the recombinant plasmid pET-28a-(+)-ADK. The recombinant plasmid was commissioned to be synthesized by Shenggong (Shanghai) Biotechnology Co., Ltd. The transformation of the recombinant plasmid and the screening and culturing steps of the recombinant Escherichia coli were the same as in Example 1.

[0064] Pick the positive clones after colony PCR verification and inoculate them into LB liquid medium and culture them at 37°C and 220 rpm for 12 h until the absorbance OD 6004.0, to obtain seed solution; take 1 mL of seed solution to 50 mL of LB medium, and culture at 37°C, 220 rpm for 6 h until the absorbance OD 600 The pH value was 4.0, and IPTG inducer with a concentration of 62.5 μg / mL was added. The fermentation was induced at 30°C for 12 h. The mixture was centrifuged at 8000 rpm at 4°C for 15 min. The supernatant was removed, and Tris-HCl buffer with a pH of 7.5 was added. The bacteria were prepared into a 0.1 g / mL whole-cell suspension with an enzyme activity of 100 U / mL, which was recorded as ADK whole-cell catalyst.

[0065] The nucleotide sequence of the ADK enzyme gene finally used is shown in SEQ ID NO.7, specifically:

[0066] .

[0067] Example 7

[0068] To preliminarily verify the ability of NRK-HS01 whole-cell catalyst coupled with ATP regeneration system (ADK whole-cell catalyst) to synthesize NMN, 20U / mL NRK-HS01 whole-cell catalyst, 20U / mL ADK whole-cell catalyst, 100mM NR, 20mM MgCl were added in sequence. 2 The initial ATP addition amount was 100 mM, and the reaction was carried out at 37°C, pH 7.5, and 220 rpm for 3 h. The NMN molar yield was 97.27%. The process of synergistic catalytic synthesis of NMN by NRK-HS01 whole cell catalyst and ADK whole cell catalyst is as follows Figure 5 shown.

[0069] The addition ratio between substrate and enzyme was appropriately adjusted. When the enzyme addition amount remained unchanged, the NR addition amount was increased to 200 mM, the ATP addition amount was still 100 mM, and the MgCl 2 The added amount remained at 20mM, and the molar production rate of NMN increased to 99.14%. After the introduction of the ATP regeneration system, the amount of ATP added was reduced by 50% compared to the initial conditions, and the cost was significantly reduced.

[0070] The optimal dosage is: 20U / mL NRK-HS01 whole cell catalyst, 20U / mL ADK whole cell catalyst, 200mM NR, 100mM ATP and 40mM MgCl 2 At this optimal dosage, the coupling reaction was carried out at 37°C and pH 7.5 for 3 hours. The changes of each component during the coupling reaction were as follows: Figure 6 The results showed that under the above conditions, the NMN concentration after 3 hours of reaction was 199.36 mM (66.63 g / L), achieving efficient synthesis of NMN by dual enzyme synergistic catalysis under high substrate concentration.

[0071] The above results show that after the NRK-HS01 whole-cell catalyst is coupled with the ATP regeneration system, the synthesis of NMN can be more efficiently catalyzed at a lower cost.

[0072] Comparative Example 1

[0073] Same as Example 5, except that the NRK-HS01 whole cell catalyst prepared in Example 2 was replaced with a crude enzyme solution prepared by the following method:

[0074] Using the NRK-HI01 gene (SEQ ID NO.6), recombinant Escherichia coli NRK-HI01 was constructed, and then fermented to produce nicotinamide ribokinase to obtain a whole cell suspension with an enzyme activity of 45U / mL. The construction method and enzyme production fermentation method refer to the application document with publication number "CN107603936A".

[0075] The molar yield of NMN in this comparative example was 72.41%.

[0076] Comparative Example 2

[0077] The optimal dosage and reaction conditions are the same as those in Example 7, except that the NRK-HS01 whole cell catalyst prepared in Example 2 is replaced by the crude enzyme solution prepared in Comparative Example 1.

[0078] The molar yield of NMN in this comparative example was 86.41%.

[0079] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A β-nicotinamide mononucleotide production system, characterized in that: The β-nicotinamide mononucleotide production system includes 20-25U / mL NRK-HS01 whole cell catalyst, 20-25U / mL ADK whole cell catalyst, 100-250mM nicotinamide riboside, 100-120mM adenosine triphosphate and 40-50mM MgCl2; The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6; The preparation method of the ADK whole-cell catalyst comprises the steps of transferring a recombinant vector containing an ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.

7.

2. The β-nicotinamide mononucleotide production system according to claim 1, characterized in that The β-nicotinamide mononucleotide production system includes 20 U / mL NRK-HS01 whole cell catalyst, 20 U / mL ADK whole cell catalyst, 200-250 mM nicotinamide riboside, 100 mM adenosine triphosphate and 40 mM MgCl2.

3. The β-nicotinamide mononucleotide production system according to claim 1, characterized in that When preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

4. The β-nicotinamide mononucleotide production system according to claim 1, characterized in that When preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

5. Use of the β-nicotinamide mononucleotide production system according to any one of claims 1 to 4 in the preparation of β-nicotinamide mononucleotide.

6. A method for preparing β-nicotinamide mononucleotide by dual enzyme synergy, characterized in that: The following steps are involved: Mixing NRK-HS01 whole cell catalyst, ADK whole cell catalyst, nicotinamide ribose, adenosine triphosphate and MgCl2 to obtain a reaction solution; the enzyme activity of NRK-HS01 whole cell catalyst in the reaction solution is 20-25U / mL, the enzyme activity of ADK whole cell catalyst is 20-25U / mL, the concentration of nicotinamide ribose is 100-250mM, the concentration of adenosine triphosphate is 100-120mM, and the concentration of MgCl2 is 40-50mM; performing a coupling reaction on the reaction solution to obtain the β-nicotinamide mononucleotide; The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6; The preparation method of the ADK whole-cell catalyst comprises the steps of transferring a recombinant vector containing an ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.

7.

7. The method according to claim 6, characterized in that In the reaction solution, the enzyme activity of the NRK-HS01 whole cell catalyst is 25 U / mL, the enzyme activity of the ADK whole cell catalyst is 25 U / mL, the concentration of nicotinamide riboside is 200-250 mM, the concentration of adenosine triphosphate is 100 mM, and the concentration of MgCl2 is 40 mM.

8. The method according to claim 6, characterized in that The coupling reaction time is 3-5h, the temperature is 35-40°C, the pH is 7-8, and the rotation speed is 200-220rpm.

9. The method according to claim 6, characterized in that When preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

10. The method according to claim 6, characterized in that When preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

Images